Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CelQ - Streptococcaceae

Properties
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: Cellobiose-6-phosphate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactococcus lactis subsp. cremoris SK11
Lactococcus lactis subsp. lactis Il1403
Streptococcus agalactiae 2603V/R
Streptococcus dysgalactiae subsp. equisimilis GGS_124
Streptococcus equi subsp. zooepidemicus MGCS10565 6 2
Streptococcus gallolyticus UCN34
Streptococcus gordonii str. Challis substr. CH1
Streptococcus mitis B6
Streptococcus mutans UA159
Streptococcus pneumoniae TIGR4 3 2
Streptococcus pyogenes M1 GAS
Streptococcus sanguinis SK36 5 2
Streptococcus suis 05ZYH33 4 2
Streptococcus thermophilus CNRZ1066
Streptococcus uberis 0140J
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Sez_1430
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -84
score = 6.61226
sequence = TTTGTTTATAAAAAGTAAACAAA

Site:
position = -38
score = 5.92584
sequence = TTTGTTAATATTTTTAAAATAAA

Gene: Sez_1430: Conserved hypothetical protein
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36

Gene: SSA_0264: Conserved hypothetical protein
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Conserved hypothetical protein
celD2
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1429: Cellobiose-specific PTS system, EIIB component (EC 2.7.1.69)
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
*
Streptococcus sanguinis SK36

Site:
position = -71
score = 6.54065
sequence = TTTGTTTATATATTGAAAATAAA

Gene: SSA_0268: Cellobiose-specific PTS system, EIIB component (EC 2.7.1.69)
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Cellobiose-specific PTS system, EIIB component (EC 2.7.1.69)
celA2
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1428: Cellobiose-specific PTS system, EIIA component (EC 2.7.1.69)
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36

Gene: SSA_0269: Cellobiose-specific PTS system, EIIA component (EC 2.7.1.69)
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Cellobiose-specific PTS system, EIIA component (EC 2.7.1.69)
celB2
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 2
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1427: Cellobiose-specific PTS system, EIIC component (EC 2.7.1.69)

Gene: Sez_1426: Cellobiose-specific PTS system, EIIC component (EC 2.7.1.69)
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
*
Streptococcus pneumoniae TIGR4

Site:
position = -35
score = 6.36613
sequence = TTAATTTATAAAAAATAAAAAAA

Gene: SP_0474: Cellobiose-specific PTS system, EIIC component (EC 2.7.1.69)
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36

Gene: SSA_0270: Cellobiose-specific PTS system, EIIC component (EC 2.7.1.69)
*
Streptococcus suis 05ZYH33

Site:
position = -45
score = 6.56718
sequence = TTTAATTAAAATTTATAAATAAA

Gene: SSU05_0212: Cellobiose-specific PTS system, EIIC component (EC 2.7.1.69)
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Cellobiose-specific PTS system, EIIC component (EC 2.7.1.69)
lacZ
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36

Gene: SSA_0271: Beta-galactosidase (EC 3.2.1.23)
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Beta-galactosidase (EC 3.2.1.23)
SP_0475
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_0475: Conserved hypothetical protein
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33

Gene: SSU05_0213: Conserved hypothetical protein
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Conserved hypothetical protein
 
CRON 2.
celQ
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -164
score = 5.92584
sequence = TTTATTTTAAAAATATTAACAAA

Site:
position = -118
score = 6.61226
sequence = TTTGTTTACTTTTTATAAACAAA

Gene: Sez_1431: Predicted cellobiose utilization transcriptional regulator, ROK family
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
*
Streptococcus pneumoniae TIGR4

Site:
position = -155
score = 6.36613
sequence = TTTTTTTATTTTTTATAAATTAA

Gene: SP_0473: Predicted cellobiose utilization transcriptional regulator, ROK family
 
Streptococcus pyogenes M1 GAS
*
Streptococcus sanguinis SK36

Site:
position = -156
score = 6.54065
sequence = TTTATTTTCAATATATAAACAAA

Gene: SSA_0267: Predicted cellobiose utilization transcriptional regulator, ROK family
*2
Streptococcus suis 05ZYH33

Gene: SSU05_0210: Predicted cellobiose utilization transcriptional regulator, ROK family

Site:
position = -125
score = 6.56718
sequence = TTTATTTATAAATTTTAATTAAA

Gene: SSU05_0211: Predicted cellobiose utilization transcriptional regulator, ROK family
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Predicted cellobiose utilization transcriptional regulator, ROK family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD