Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MalR3 - Lactobacillaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 17 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactobacillus acidophilus NCFM
Lactobacillus brevis ATCC 367 3 2
Lactobacillus casei ATCC 334
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Lactobacillus fermentum IFO 3956 3 2
Lactobacillus helveticus DPC 4571
Lactobacillus johnsonii NCC 533
Lactobacillus plantarum WCFS1 7 4
Lactobacillus reuteri JCM 1112 4 2
Lactobacillus rhamnosus GG
Lactobacillus sakei subsp. sakei 23K
Lactobacillus salivarius subsp. salivarius UCC118
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 4 3
Oenococcus oeni PSU-1 3 2
Pediococcus pentosaceus ATCC 25745
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
nplT
 
Lactobacillus acidophilus NCFM

Gene: LBA1871: Neopullulanase (EC 3.2.1.135)
 
Lactobacillus brevis ATCC 367

Gene: LVIS_2180: Neopullulanase (EC 3.2.1.135)
 
Lactobacillus casei ATCC 334

Gene: LSEI_0980: Neopullulanase (EC 3.2.1.135)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
*
Lactobacillus fermentum IFO 3956

Site:
position = -56
score = 6.03015
sequence = TTACTCAAACGTTTGCGTAA

Gene: LAF_0739: Neopullulanase (EC 3.2.1.135)
 
Lactobacillus helveticus DPC 4571

Gene: lhv_2001: Neopullulanase (EC 3.2.1.135)
 
Lactobacillus johnsonii NCC 533

Gene: LJ0212: Neopullulanase (EC 3.2.1.135)
*3
Lactobacillus plantarum WCFS1

Site:
position = -34
score = 5.4801
sequence = TAATGTAATCGTTTACATAA

Gene: lp_2757: Neopullulanase (EC 3.2.1.135)

Gene: lp_0193: Neopullulanase (EC 3.2.1.135)

Site:
position = -52
score = 6.31272
sequence = TTAAGCAAACGTTTGCTTAA

Gene: lp_3627: Neopullulanase (EC 3.2.1.135)
*2
Lactobacillus reuteri JCM 1112

Gene: LAR_1507: Neopullulanase (EC 3.2.1.135)

Site:
position = -69
score = 6.07009
sequence = TTAAGTAAACGTTTACATTA

Gene: LAR_0078: Neopullulanase (EC 3.2.1.135)
 
Lactobacillus rhamnosus GG

Gene: LGG_00944: Neopullulanase (EC 3.2.1.135)
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1295: Neopullulanase (EC 3.2.1.135)
*2
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0899: Neopullulanase (EC 3.2.1.135)

Site:
position = -94
score = 5.07643
sequence = CTAAGTAAACGTTTACTGTA

Gene: LEUM_0828: Neopullulanase (EC 3.2.1.135)
 
Oenococcus oeni PSU-1

Gene: OEOE_0040: Neopullulanase (EC 3.2.1.135)
 
Pediococcus pentosaceus ATCC 25745
Neopullulanase (EC 3.2.1.135)
malT2
 
Lactobacillus acidophilus NCFM
*
Lactobacillus brevis ATCC 367

Site:
position = -106
score = 5.4864
sequence = TTACACAAACGTTTGCTTTT

Gene: LVIS_2179: Predicted maltose/maltodextrin permease
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956

Gene: LAF_0738: Predicted maltose/maltodextrin permease
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
*2
Lactobacillus plantarum WCFS1

Gene: lp_3626: Predicted maltose/maltodextrin permease

Site:
position = -106
score = 5.5097
sequence = AAGTGTAAACGTTTACTTTA

Site:
position = -74
score = 5.778
sequence = TATTGTAAACGTTTACGTTA

Gene: lp_3533: Predicted maltose/maltodextrin permease
*2
Lactobacillus reuteri JCM 1112

Site:
position = -115
score = 5.01811
sequence = AAAAGTAAACGGTTGCTAAT

Gene: LAR_1508: Predicted maltose/maltodextrin permease

Gene: LAR_0079: Predicted maltose/maltodextrin permease
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 2
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0898: Predicted maltose/maltodextrin permease

Gene: LEUM_0827: Predicted maltose/maltodextrin permease
*
Oenococcus oeni PSU-1

Site:
position = -59
score = 6.14554
sequence = TTTTGTAAACGTTTACTTAA

Gene: OEOE_0041: Predicted maltose/maltodextrin permease
 
Pediococcus pentosaceus ATCC 25745
Predicted maltose/maltodextrin permease
malR3
 
Lactobacillus acidophilus NCFM
*
Lactobacillus brevis ATCC 367

Site:
position = -108
score = 5.4864
sequence = AAAAGCAAACGTTTGTGTAA

Gene: LVIS_2178: Predicted maltodextrin utilization transcriptional regulator MalR3, LacI family
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
*
Lactobacillus fermentum IFO 3956

Site:
position = -121
score = 6.03015
sequence = TTACGCAAACGTTTGAGTAA

Gene: LAF_0740: Predicted maltodextrin utilization transcriptional regulator MalR3, LacI family
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
*2
Lactobacillus plantarum WCFS1

Gene: lp_3625: Predicted maltodextrin utilization transcriptional regulator MalR3, LacI family

Site:
position = -115
score = 5.778
sequence = TAACGTAAACGTTTACAATA

Site:
position = -83
score = 5.5097
sequence = TAAAGTAAACGTTTACACTT

Gene: lp_3531: Predicted maltodextrin utilization transcriptional regulator MalR3, LacI family
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0083: Predicted maltodextrin utilization transcriptional regulator MalR3, LacI family
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
*2
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Site:
position = -78
score = 6.21664
sequence = TTGAGTAAACGTTTACGCAA

Gene: LEUM_0896: Predicted maltodextrin utilization transcriptional regulator MalR3, LacI family

Site:
position = -135
score = 5.07643
sequence = TACAGTAAACGTTTACTTAG

Gene: LEUM_0829: Predicted maltodextrin utilization transcriptional regulator MalR3, LacI family
*
Oenococcus oeni PSU-1

Site:
position = -149
score = 6.14554
sequence = TTAAGTAAACGTTTACAAAA

Gene: OEOE_0042: Predicted maltodextrin utilization transcriptional regulator MalR3, LacI family
 
Pediococcus pentosaceus ATCC 25745
Predicted maltodextrin utilization transcriptional regulator MalR3, LacI family
agl
 
Lactobacillus acidophilus NCFM

Gene: LBA1812: Alpha-glucosidase (EC 3.2.1.20)
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533

Gene: LJ0569: Alpha-glucosidase (EC 3.2.1.20)
 
Lactobacillus plantarum WCFS1

Gene: lp_3534: Alpha-glucosidase (EC 3.2.1.20)
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0972: Alpha-glucosidase (EC 3.2.1.20)
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Alpha-glucosidase (EC 3.2.1.20)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD