Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MdxR - Lactobacillaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: activator
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactobacillus acidophilus NCFM 4 2
Lactobacillus brevis ATCC 367
Lactobacillus casei ATCC 334 3 2
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Lactobacillus fermentum IFO 3956
Lactobacillus helveticus DPC 4571 2 1
Lactobacillus johnsonii NCC 533 4 2
Lactobacillus plantarum WCFS1 5 2
Lactobacillus reuteri JCM 1112
Lactobacillus rhamnosus GG
Lactobacillus sakei subsp. sakei 23K
Lactobacillus salivarius subsp. salivarius UCC118
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 7 2
Oenococcus oeni PSU-1
Pediococcus pentosaceus ATCC 25745
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
malX
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
*
Lactobacillus plantarum WCFS1

Site:
position = -103
score = 6.32785
sequence = TTCTGTTAACGTTAACATTA

Gene: lp_0175: Maltose/maltodextrin ABC transporter, substrate-binding protein
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Maltose/maltodextrin ABC transporter, substrate-binding protein
malC
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_0176: Maltose/maltodextrin ABC transporter, permease protein 1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Maltose/maltodextrin ABC transporter, permease protein 1
malD
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_0177: Maltose/maltodextrin ABC transporter, permease protein 2
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Maltose/maltodextrin ABC transporter, permease protein 2
malA
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_0178: Maltodextrose utilization protein MalA
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Maltodextrose utilization protein MalA
 
CRON 2.
malT
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0357: Predicted maltose/maltodextrin permease
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956

Gene: LAF_0024: Predicted maltose/maltodextrin permease
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_1729: Predicted maltose/maltodextrin permease
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0051: Predicted maltose/maltodextrin permease
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1282: Predicted maltose/maltodextrin permease
*2
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Site:
position = -104
score = 6.10104
sequence = TGATGTTACCGTTAACATCG

Gene: LEUM_0893: Predicted maltose/maltodextrin permease

Site:
position = -203
score = 6.30368
sequence = TAATGTTATCGTTAACATTG

Gene: LEUM_0994: Predicted maltose/maltodextrin permease
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0968: Predicted maltose/maltodextrin permease
Predicted maltose/maltodextrin permease
malK
*
Lactobacillus acidophilus NCFM

Site:
position = -104
score = 5.7234
sequence = TTCTGATACCGGTAACATGG

Gene: LBA1870: Maltose phosphorylase (EC 2.4.1.8)
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0358: Maltose phosphorylase (EC 2.4.1.8)
*
Lactobacillus casei ATCC 334

Site:
position = -129
score = 5.77663
sequence = TTATGATAGCGGTAACATTC

Gene: LSEI_0982: Maltose phosphorylase (EC 2.4.1.8)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956

Gene: LAF_0025: Maltose phosphorylase (EC 2.4.1.8)
 
Lactobacillus helveticus DPC 4571

Gene: lhv_2000: Maltose phosphorylase (EC 2.4.1.8)
*
Lactobacillus johnsonii NCC 533

Site:
position = -100
score = 6.13006
sequence = TTTTGATACCGGTAACATTA

Gene: LJ0213: Maltose phosphorylase (EC 2.4.1.8)
 
Lactobacillus plantarum WCFS1

Gene: lp_1730: Maltose phosphorylase (EC 2.4.1.8)
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0052: Maltose phosphorylase (EC 2.4.1.8)
 
Lactobacillus rhamnosus GG

Gene: LGG_00945: Maltose phosphorylase (EC 2.4.1.8)
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1280: Maltose phosphorylase (EC 2.4.1.8)
 2
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0894: Maltose phosphorylase (EC 2.4.1.8)

Gene: LEUM_0995: Maltose phosphorylase (EC 2.4.1.8)
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0967: Maltose phosphorylase (EC 2.4.1.8)
Maltose phosphorylase (EC 2.4.1.8)
galM
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_1731: Aldose 1-epimerase
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1281: Aldose 1-epimerase
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0996: Aldose 1-epimerase
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Aldose 1-epimerase
pgcM
 
Lactobacillus acidophilus NCFM

Gene: LBA1869: Beta-phosphoglucomutase (EC 5.4.2.6)
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_0983: Beta-phosphoglucomutase (EC 5.4.2.6)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956

Gene: LAF_0026: Beta-phosphoglucomutase (EC 5.4.2.6)
 
Lactobacillus helveticus DPC 4571

Gene: lhv_1999: Beta-phosphoglucomutase (EC 5.4.2.6)
 
Lactobacillus johnsonii NCC 533

Gene: LJ0214: Beta-phosphoglucomutase (EC 5.4.2.6)
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0053: Beta-phosphoglucomutase (EC 5.4.2.6)
 
Lactobacillus rhamnosus GG

Gene: LGG_00946: Beta-phosphoglucomutase (EC 5.4.2.6)
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1279: Beta-phosphoglucomutase (EC 5.4.2.6)
 2
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0895: Beta-phosphoglucomutase (EC 5.4.2.6)

Gene: LEUM_0997: Beta-phosphoglucomutase (EC 5.4.2.6)
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0966: Beta-phosphoglucomutase (EC 5.4.2.6)
Beta-phosphoglucomutase (EC 5.4.2.6)
 
CRON 3.
malL
*
Lactobacillus acidophilus NCFM

Site:
position = -78
score = 5.36757
sequence = TTTTGATACCGCTAACATCT

Gene: LBA1872: Oligo-1,6-glucosidase (EC 3.2.1.10)
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0309: Oligo-1,6-glucosidase (EC 3.2.1.10)
*
Lactobacillus casei ATCC 334

Site:
position = -82
score = 5.39035
sequence = TTTTGATAACGGTAACAAAC

Gene: LSEI_0980: Oligo-1,6-glucosidase (EC 3.2.1.10)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
*
Lactobacillus helveticus DPC 4571

Site:
position = -63
score = 5.5702
sequence = TTTTGATACCGGTAACATCC

Gene: lhv_2002: Oligo-1,6-glucosidase (EC 3.2.1.10)
*
Lactobacillus johnsonii NCC 533

Site:
position = -81
score = 5.50873
sequence = TTTTGATACCGGTAACAGAT

Gene: LJ0211: Oligo-1,6-glucosidase (EC 3.2.1.10)
 
Lactobacillus plantarum WCFS1

Gene: lp_0174: Oligo-1,6-glucosidase (EC 3.2.1.10)
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Oligo-1,6-glucosidase (EC 3.2.1.10)
nplT
 
Lactobacillus acidophilus NCFM

Gene: LBA1871: Neopullulanase (EC 3.2.1.135)
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571

Gene: lhv_2001: Neopullulanase (EC 3.2.1.135)
 
Lactobacillus johnsonii NCC 533

Gene: LJ0212: Neopullulanase (EC 3.2.1.135)
*
Lactobacillus plantarum WCFS1

Site:
position = -34
score = 5.79805
sequence = TAATGTAATCGTTTACATAA

Gene: lp_2757: Neopullulanase (EC 3.2.1.135)
 
Lactobacillus reuteri JCM 1112

Gene: LAR_1507: Neopullulanase (EC 3.2.1.135)
 
Lactobacillus rhamnosus GG

Gene: LGG_00944: Neopullulanase (EC 3.2.1.135)
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_0067: Neopullulanase (EC 3.2.1.135)
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Neopullulanase (EC 3.2.1.135)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD