Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BfrR - Streptococcaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Fructooligosaccharides utilization
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactococcus lactis subsp. cremoris SK11
Lactococcus lactis subsp. lactis Il1403
Streptococcus agalactiae 2603V/R
Streptococcus dysgalactiae subsp. equisimilis GGS_124
Streptococcus equi subsp. zooepidemicus MGCS10565
Streptococcus gallolyticus UCN34
Streptococcus gordonii str. Challis substr. CH1 4 1
Streptococcus mitis B6
Streptococcus mutans UA159
Streptococcus pneumoniae TIGR4 4 1
Streptococcus pyogenes M1 GAS
Streptococcus sanguinis SK36
Streptococcus suis 05ZYH33 5 1
Streptococcus thermophilus CNRZ1066
Streptococcus uberis 0140J 4 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
bfrR
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1306: Fructooligosaccharides utilization transcriptional regulator BfrR, LacI family
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_1799: Fructooligosaccharides utilization transcriptional regulator BfrR, LacI family
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
*
Streptococcus suis 05ZYH33

Site:
position = -33
score = 6.05851
sequence = TTATTGAAACGTTTCACAAG

Gene: SSU05_1341: Fructooligosaccharides utilization transcriptional regulator BfrR, LacI family
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB0303: Fructooligosaccharides utilization transcriptional regulator BfrR, LacI family
Fructooligosaccharides utilization transcriptional regulator BfrR, LacI family
bfrF
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1304: Fructooligosaccharides ABC transporter, permease protein 1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
*
Streptococcus pneumoniae TIGR4

Site:
position = -93
score = 6.47044
sequence = AAAATGAAACGTTTCAAAAA

Site:
position = -31
score = 6.47044
sequence = AAAATGAAACGTTTCAAAAA

Gene: SP_1798: Fructooligosaccharides ABC transporter, permease protein 1
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33

Gene: SSU05_1340: Fructooligosaccharides ABC transporter, permease protein 1
 
Streptococcus thermophilus CNRZ1066
*
Streptococcus uberis 0140J

Site:
position = -31
score = 6.47044
sequence = AAAATGAAACGTTTCAAAAA

Site:
position = -85
score = 6.47044
sequence = AAAATGAAACGTTTCAAATA

Gene: SUB0304: Fructooligosaccharides ABC transporter, permease protein 1
Fructooligosaccharides ABC transporter, permease protein 1
bfrG
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1303: Fructooligosaccharides ABC transporter, permease protein 2
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_1797: Fructooligosaccharides ABC transporter, permease protein 2
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33

Gene: SSU05_1339: Fructooligosaccharides ABC transporter, permease protein 2
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB0305: Fructooligosaccharides ABC transporter, permease protein 2
Fructooligosaccharides ABC transporter, permease protein 2
bfrE
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -88
score = 6.47044
sequence = AAAATGAAACGTTTCAAAAA

Site:
position = -30
score = 6.47044
sequence = AAAATGAAACGTTTCAAAAA

Gene: SGO_1305: Fructooligosaccharides ABC transporter, substrate-binding protein
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_1796: Fructooligosaccharides ABC transporter, substrate-binding protein
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33

Gene: SSU05_1338: Fructooligosaccharides ABC transporter, substrate-binding protein
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB0306: Fructooligosaccharides ABC transporter, substrate-binding protein
Fructooligosaccharides ABC transporter, substrate-binding protein
bfrA
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1302: Beta-fructosidases (EC 3.2.1.26)
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_1795: Beta-fructosidases (EC 3.2.1.26)
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33

Gene: SSU05_1337: Beta-fructosidases (EC 3.2.1.26)
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB0307: Beta-fructosidases (EC 3.2.1.26)
Beta-fructosidases (EC 3.2.1.26)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD