Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog UlaR - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: DeoR
Regulation mode: repressor
Biological process: Ascorbate utilization
Effector: Ascorbate-6-phosphate
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 13 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Citrobacter koseri ATCC BAA-895 5 2
Edwardsiella tarda EIB202 9 2
Enterobacter sp. 638
Erwinia amylovora ATCC 49946
Erwinia carotovora subsp. atroseptica SCRI1043
Escherichia coli str. K-12 substr. MG1655 8 2
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 8 2
Photorhabdus luminescens subsp. laumondii TTO1
Proteus mirabilis HI4320
Salmonella typhimurium LT2 8 2
Serratia proteamaculans 568
Yersinia pestis KIM
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
ulaA
*
Citrobacter koseri ATCC BAA-895

Site:
position = -82
score = 5.2836
sequence = TGATTACTTTTGAAAATTAG

Gene: CKO_03643: Ascorbate-specific PTS system, EIIC component
*
Edwardsiella tarda EIB202

Site:
position = -96
score = 4.2109
sequence = TGATTTTTAACGATTGCTAG

Gene: ETAE_3292: Ascorbate-specific PTS system, EIIC component
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -82
score = 5.2836
sequence = TGATTACTTTTGAAAATTAG

Gene: b4193: Ascorbate-specific PTS system, EIIC component
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -83
score = 5.28943
sequence = TGATTATTTTTGATTATTAG

Gene: KPN_04586: Ascorbate-specific PTS system, EIIC component
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
*
Salmonella typhimurium LT2

Site:
position = -80
score = 5.35527
sequence = TGATTACTTTTGAAAATTAA

Gene: STM4383.S: Ascorbate-specific PTS system, EIIC component
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
Ascorbate-specific PTS system, EIIC component
ulaB
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03642: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
 
Edwardsiella tarda EIB202

Gene: ETAE_3293: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4194: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04587: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2

Gene: STM4384: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
ulaC
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03641: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
 
Edwardsiella tarda EIB202

Gene: ETAE_3294: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4195: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04588: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2

Gene: STM4385: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
ulaD
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03639: 3-keto-L-gulonate-6-phosphate decarboxylase UlaD (EC 4.1.1.85) (L-ascorbate utilization protein D)
 
Edwardsiella tarda EIB202

Gene: ETAE_3295: 3-keto-L-gulonate-6-phosphate decarboxylase UlaD (EC 4.1.1.85) (L-ascorbate utilization protein D)
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4196: 3-keto-L-gulonate-6-phosphate decarboxylase UlaD (EC 4.1.1.85) (L-ascorbate utilization protein D)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04589: 3-keto-L-gulonate-6-phosphate decarboxylase UlaD (EC 4.1.1.85) (L-ascorbate utilization protein D)
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2

Gene: STM4386: 3-keto-L-gulonate-6-phosphate decarboxylase UlaD (EC 4.1.1.85) (L-ascorbate utilization protein D)
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
3-keto-L-gulonate-6-phosphate decarboxylase UlaD (EC 4.1.1.85) (L-ascorbate utilization protein D)
ulaE
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03638: L-ribulose-5-phosphate 3-epimerase UlaE (EC 5.1.3.22) (L-ascorbate utilization protein E)
 
Edwardsiella tarda EIB202

Gene: ETAE_3296: L-ribulose-5-phosphate 3-epimerase UlaE (EC 5.1.3.22) (L-ascorbate utilization protein E)
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4197: L-ribulose-5-phosphate 3-epimerase UlaE (EC 5.1.3.22) (L-ascorbate utilization protein E)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04590: L-ribulose-5-phosphate 3-epimerase UlaE (EC 5.1.3.22) (L-ascorbate utilization protein E)
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2

Gene: STM4387: L-ribulose-5-phosphate 3-epimerase UlaE (EC 5.1.3.22) (L-ascorbate utilization protein E)
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
L-ribulose-5-phosphate 3-epimerase UlaE (EC 5.1.3.22) (L-ascorbate utilization protein E)
ulaF
 
Citrobacter koseri ATCC BAA-895
 
Edwardsiella tarda EIB202

Gene: ETAE_3297: L-ribulose-5-phosphate 4-epimerase UlaF (EC 5.1.3.4) (L-ascorbate utilization protein F)
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4198: L-ribulose-5-phosphate 4-epimerase UlaF (EC 5.1.3.4) (L-ascorbate utilization protein F)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04591: L-ribulose-5-phosphate 4-epimerase UlaF (EC 5.1.3.4) (L-ascorbate utilization protein F)
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2

Gene: STM4388: L-ribulose-5-phosphate 4-epimerase UlaF (EC 5.1.3.4) (L-ascorbate utilization protein F)
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
L-ribulose-5-phosphate 4-epimerase UlaF (EC 5.1.3.4) (L-ascorbate utilization protein F)
 
CRON 2.
ETAE_3291
 
Citrobacter koseri ATCC BAA-895
*
Edwardsiella tarda EIB202

Site:
position = -75
score = 4.2109
sequence = CTAGCAATCGTTAAAAATCA

Gene: ETAE_3291: hypothetical protein
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
hypothetical protein
ulaG
*
Citrobacter koseri ATCC BAA-895

Site:
position = -286
score = 5.2836
sequence = CTAATTTTCAAAAGTAATCA

Site:
position = -44
score = 4.34715
sequence = GGATTAATCAAAACAAATCA

Gene: CKO_03645: Probable L-ascorbate-6-phosphate lactonase UlaG (EC 3.1.1.-) (L-ascorbate utilization protein G)
 
Edwardsiella tarda EIB202

Gene: ETAE_3290: Probable L-ascorbate-6-phosphate lactonase UlaG (EC 3.1.1.-) (L-ascorbate utilization protein G)
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -292
score = 5.2836
sequence = CTAATTTTCAAAAGTAATCA

Site:
position = -60
score = 3.91185
sequence = GGATTAATCAAAACCAATCA

Gene: b4192: Probable L-ascorbate-6-phosphate lactonase UlaG (EC 3.1.1.-) (L-ascorbate utilization protein G)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -299
score = 5.28943
sequence = CTAATAATCAAAAATAATCA

Site:
position = -32
score = 4.46798
sequence = TGATTACTATTGAAAATACG

Gene: KPN_04585: Probable L-ascorbate-6-phosphate lactonase UlaG (EC 3.1.1.-) (L-ascorbate utilization protein G)
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
*
Salmonella typhimurium LT2

Site:
position = -59
score = 4.34715
sequence = GGATTAATCAAAACAAATCA

Gene: STM4382: Probable L-ascorbate-6-phosphate lactonase UlaG (EC 3.1.1.-) (L-ascorbate utilization protein G)
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
Probable L-ascorbate-6-phosphate lactonase UlaG (EC 3.1.1.-) (L-ascorbate utilization protein G)
ulaR
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03646: Ascorbate utilization transcriptional regulator UlaR, DeoR family
 
Edwardsiella tarda EIB202

Gene: ETAE_3289: Ascorbate utilization transcriptional regulator UlaR, DeoR family
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4191: Ascorbate utilization transcriptional regulator UlaR, DeoR family
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04584: Ascorbate utilization transcriptional regulator UlaR, DeoR family
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2

Gene: STM4381: Ascorbate utilization transcriptional regulator UlaR, DeoR family
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
Ascorbate utilization transcriptional regulator UlaR, DeoR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD