Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog FucR - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: DeoR
Regulation mode: activator
Biological process: Fucose utilization
Effector: L-fuculose-1-phosphate
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Citrobacter koseri ATCC BAA-895 6 3
Edwardsiella tarda EIB202 2 1
Enterobacter sp. 638
Erwinia amylovora ATCC 49946
Erwinia carotovora subsp. atroseptica SCRI1043
Escherichia coli str. K-12 substr. MG1655 7 2
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 8 3
Photorhabdus luminescens subsp. laumondii TTO1
Proteus mirabilis HI4320
Salmonella typhimurium LT2 2 1
Serratia proteamaculans 568
Yersinia pestis KIM
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
aldA
*
Citrobacter koseri ATCC BAA-895

Site:
position = -218
score = 6.36956
sequence = TTGCCCGTTTGCGGAAATTTACGCTCAAACGGGCAA

Gene: CKO_01448: Aldehyde dehydrogenase A (EC 1.2.1.22) / Glycolaldehyde dehydrogenase (EC 1.2.1.21)
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638

Gene: Ent638_1953: Aldehyde dehydrogenase A (EC 1.2.1.22) / Glycolaldehyde dehydrogenase (EC 1.2.1.21)
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA0118: Aldehyde dehydrogenase A (EC 1.2.1.22) / Glycolaldehyde dehydrogenase (EC 1.2.1.21)
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1415: Aldehyde dehydrogenase A (EC 1.2.1.22) / Glycolaldehyde dehydrogenase (EC 1.2.1.21)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -218
score = 6.23944
sequence = ATGCCCGTTTACGGCAGATTCGTCGCAAACGGGCAA

Gene: KPN_01501: Aldehyde dehydrogenase A (EC 1.2.1.22) / Glycolaldehyde dehydrogenase (EC 1.2.1.21)
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
Aldehyde dehydrogenase A (EC 1.2.1.22) / Glycolaldehyde dehydrogenase (EC 1.2.1.21)
 
CRON 2.
fucA
*
Citrobacter koseri ATCC BAA-895

Site:
position = -225
score = 5.95737
sequence = ATGCCCGTTTGGATAAATAATATTAAGAGCGGTCAT

Site:
position = -281
score = 7.56037
sequence = ATGACCGATTTAATTTATTACTGCGAAAACGGGCAT

Gene: CKO_04159: L-fuculose phosphate aldolase (EC 4.1.2.17)
*
Edwardsiella tarda EIB202

Site:
position = -312
score = 6.77732
sequence = ATGACCGAATAGGCATTTTTTATTTTAAACGGTCAA

Gene: ETAE_0293: L-fuculose phosphate aldolase (EC 4.1.2.17)
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -284
score = 7.28199
sequence = ATGACCGTATTAATTGTTTGTGCCGAAAACGGTCAT

Site:
position = -225
score = 6.28331
sequence = ATGACCGTTTTGATAAATATTTTTAAGAGCGGTCAT

Gene: b2800: L-fuculose phosphate aldolase (EC 4.1.2.17)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -290
score = 7.02013
sequence = ATGACCGAATGAATATATATCGTGGAAAACGGGCAA

Site:
position = -236
score = 5.63669
sequence = ATGCCCGCTTGATGAAATATTATTAAGAACGGGCAT

Gene: KPN_03151: L-fuculose phosphate aldolase (EC 4.1.2.17)
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
*
Salmonella typhimurium LT2

Site:
position = -293
score = 7.08218
sequence = ATGCCCGAATTAAATTATTGCCACGAAAACGGGCAG

Site:
position = -237
score = 6.20421
sequence = TTGCCCGTTTTAAAAAATATTATTAAGAGCGGGCAT

Gene: STM2974: L-fuculose phosphate aldolase (EC 4.1.2.17)
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
L-fuculose phosphate aldolase (EC 4.1.2.17)
fucO
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04157: Lactaldehyde reductase (EC 1.1.1.77)
 
Edwardsiella tarda EIB202

Gene: ETAE_0294: Lactaldehyde reductase (EC 1.1.1.77)
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2799: Lactaldehyde reductase (EC 1.1.1.77)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03150: Lactaldehyde reductase (EC 1.1.1.77)
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2

Gene: STM2973: Lactaldehyde reductase (EC 1.1.1.77)
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
Lactaldehyde reductase (EC 1.1.1.77)
 
CRON 3.
fucP
*
Citrobacter koseri ATCC BAA-895

Site:
position = -310
score = 7.56037
sequence = ATGCCCGTTTTCGCAGTAATAAATTAAATCGGTCAT

Site:
position = -366
score = 5.95737
sequence = ATGACCGCTCTTAATATTATTTATCCAAACGGGCAT

Gene: CKO_04160: L-fucose transporter
 
Edwardsiella tarda EIB202

Gene: ETAE_0291: L-fucose transporter
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -357
score = 6.28331
sequence = ATGACCGCTCTTAAAAATATTTATCAAAACGGTCAT

Site:
position = -298
score = 7.28199
sequence = ATGACCGTTTTCGGCACAAACAATTAATACGGTCAT

Gene: b2801: L-fucose transporter
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -351
score = 7.02013
sequence = TTGCCCGTTTTCCACGATATATATTCATTCGGTCAT

Gene: KPN_03152: L-fucose transporter
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
L-fucose transporter
fucI
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04161: L-fucose isomerase (EC 5.3.1.25)
 
Edwardsiella tarda EIB202

Gene: ETAE_0290: L-fucose isomerase (EC 5.3.1.25)
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2802: L-fucose isomerase (EC 5.3.1.25)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03153: L-fucose isomerase (EC 5.3.1.25)
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2

Gene: STM2976: L-fucose isomerase (EC 5.3.1.25)
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
L-fucose isomerase (EC 5.3.1.25)
fucK
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04163: L-fuculokinase (EC 2.7.1.51)
 
Edwardsiella tarda EIB202

Gene: ETAE_0289: L-fuculokinase (EC 2.7.1.51)
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2803: L-fuculokinase (EC 2.7.1.51)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03154: L-fuculokinase (EC 2.7.1.51)
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2

Gene: STM2977: L-fuculokinase (EC 2.7.1.51)
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
L-fuculokinase (EC 2.7.1.51)
fucU
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04165: L-fucose mutarotase
 
Edwardsiella tarda EIB202

Gene: ETAE_0288: L-fucose mutarotase
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2804: L-fucose mutarotase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03155: L-fucose mutarotase
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2

Gene: STM2978: L-fucose mutarotase
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
L-fucose mutarotase
fucR
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04166: L-fucose operon activator
 
Edwardsiella tarda EIB202

Gene: ETAE_0287: L-fucose operon activator
 
Enterobacter sp. 638

Gene: Ent638_3405: L-fucose operon activator
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2805: L-fucose operon activator
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03156: L-fucose operon activator
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu4112: L-fucose operon activator
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2

Gene: STM2979: L-fucose operon activator
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
L-fucose operon activator
CKO_04162
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04162: hypothetical protein
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
hypothetical protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD