Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Cagg_1084 - Chloroflexia

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process:
Effector:
Phylum: Chloroflexi
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Chloroflexus aggregans DSM 9485 2 2
Chloroflexus sp. Y-400-fl 2 2
Herpetosiphon aurantiacus ATCC 23779
Roseiflexus castenholzii DSM 13941
Roseiflexus sp. RS-1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
COG0730
*
Chloroflexus aggregans DSM 9485

Site:
position = -81
score = 7.4353
sequence = ATACATCAGATGATCTGATGTTT

Gene: Cagg_1085: predicted transporter
*
Chloroflexus sp. Y-400-fl

Site:
position = -41
score = 6.87834
sequence = AAACATCAGATCATCAGATGAAT

Gene: Chy400_3102: predicted transporter
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
predicted transporter
 
CRON 2.
Cagg_1084
*
Chloroflexus aggregans DSM 9485

Site:
position = -36
score = 7.27093
sequence = AAACATCAGATGATATGATCTTT

Gene: Cagg_1084: Transcriptional regulator, GntR family
*
Chloroflexus sp. Y-400-fl

Site:
position = -37
score = 7.27093
sequence = AAACATCAGATGATATGATCTTT

Gene: Chy400_3103: Transcriptional regulator, GntR family
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
Transcriptional regulator, GntR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD