Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HcpR - Chloroflexia

Properties
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator
Biological process: Nitrosative stress response
Effector: Nitric oxide
Phylum: Chloroflexi
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Chloroflexus aggregans DSM 9485 4 2
Chloroflexus sp. Y-400-fl
Herpetosiphon aurantiacus ATCC 23779
Roseiflexus castenholzii DSM 13941 2 1
Roseiflexus sp. RS-1 2 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Rcas_3898
*2
Chloroflexus aggregans DSM 9485

Site:
position = -116
score = 6.47832
sequence = ATCTTGCGCTAGCGCAACGA

Gene: Cagg_2026: Cytochrome c family protein involved in nitrosative stress

Site:
position = -86
score = 6.80655
sequence = AAGTTGCGCTAGCGCAACGT

Gene: Cagg_2669: Cytochrome c family protein involved in nitrosative stress
 
Chloroflexus sp. Y-400-fl
 
Herpetosiphon aurantiacus ATCC 23779
*
Roseiflexus castenholzii DSM 13941

Site:
position = -111
score = 6.46055
sequence = AACTTGCGCCAGCGCAACGA

Gene: Rcas_3898: Cytochrome c family protein involved in nitrosative stress
*
Roseiflexus sp. RS-1

Site:
position = -105
score = 6.46055
sequence = AACTTGCGCCAGCGCAACGA

Gene: RoseRS_0596: Cytochrome c family protein involved in nitrosative stress
Cytochrome c family protein involved in nitrosative stress
Rcas_3899
 2
Chloroflexus aggregans DSM 9485

Gene: Cagg_2025: hypothetical protein involved in nitrosative stress

Gene: Cagg_2670: hypothetical protein involved in nitrosative stress
 
Chloroflexus sp. Y-400-fl
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_3899: hypothetical protein involved in nitrosative stress
 
Roseiflexus sp. RS-1

Gene: RoseRS_0597: hypothetical protein involved in nitrosative stress
hypothetical protein involved in nitrosative stress
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD