Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur2 - Chloroflexia

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Chloroflexi
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Chloroflexus aggregans DSM 9485
Chloroflexus sp. Y-400-fl
Herpetosiphon aurantiacus ATCC 23779
Roseiflexus castenholzii DSM 13941 6 5
Roseiflexus sp. RS-1 6 5
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
COG0701
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_2028: predicted permease
 
Chloroflexus sp. Y-400-fl
 
Herpetosiphon aurantiacus ATCC 23779
*
Roseiflexus castenholzii DSM 13941

Site:
position = -33
score = 6.97791
sequence = TAAGTGATAGTAACTATCATTTA

Gene: Rcas_3894: predicted permease
*
Roseiflexus sp. RS-1

Site:
position = -33
score = 6.50185
sequence = ACAATGATATTTACTATCATTTA

Gene: RoseRS_0592: predicted permease
predicted permease
 
CRON 2.
Rcas_3893
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_4472: hypothetical protein
*
Roseiflexus castenholzii DSM 13941

Site:
position = -63
score = 5.00797
sequence = TCGTTGAAAGTAACTATCATCTG

Gene: Rcas_3893: hypothetical protein
*
Roseiflexus sp. RS-1

Site:
position = -61
score = 5.80435
sequence = AAAATGGTAGTTGCTATCATTGA

Gene: RoseRS_0845: hypothetical protein
hypothetical protein
 
CRON 3.
Rcas_3900
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl
 
Herpetosiphon aurantiacus ATCC 23779
*
Roseiflexus castenholzii DSM 13941

Site:
position = -157
score = 5.61081
sequence = CAACTGATAGATAAGATCATTTG

Gene: Rcas_3900: Zinc finger domain, similar to cold shock proteins
*
Roseiflexus sp. RS-1

Site:
position = -159
score = 5.46124
sequence = CAAATGATAGACGAGATCATTTG

Gene: RoseRS_0598: Zinc finger domain, similar to cold shock proteins
Zinc finger domain, similar to cold shock proteins
 
CRON 4.
yciC
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_0608: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Chloroflexus sp. Y-400-fl
 
Herpetosiphon aurantiacus ATCC 23779
*
Roseiflexus castenholzii DSM 13941

Site:
position = -59
score = 5.62172
sequence = TCATTGATATACACTATCATCAA

Gene: Rcas_2945: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*
Roseiflexus sp. RS-1

Site:
position = -40
score = 5.87525
sequence = GAACTGATATGATCTATCATTTG

Gene: RoseRS_3105: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
CRON 5.
fmdB
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_0322: putative regulatory protein, FmdB family
 
Chloroflexus sp. Y-400-fl
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_2075: putative regulatory protein, FmdB family
*
Roseiflexus castenholzii DSM 13941

Site:
position = -50
score = 6.06062
sequence = CAAGTGATAGCATATATCACAAA

Gene: Rcas_2948: putative regulatory protein, FmdB family
*
Roseiflexus sp. RS-1

Site:
position = -3
score = 5.96418
sequence = TAAGTGATAGCATATATCACACT

Gene: RoseRS_3107: putative regulatory protein, FmdB family
putative regulatory protein, FmdB family
yciC2
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_0321: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Chloroflexus sp. Y-400-fl
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_4200: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_2949: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Roseiflexus sp. RS-1

Gene: RoseRS_3108: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD