Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HomR - Streptococcaceae

Properties
Regulator type: Transcription factor
Regulator family: LysR
Regulation mode: activator
Biological process: Methionine metabolism; Cysteine metabolism
Effector: O-acetyl-L-serine
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 24 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactococcus lactis subsp. cremoris SK11 1 1
Lactococcus lactis subsp. lactis Il1403 3 2
Streptococcus agalactiae 2603V/R
Streptococcus dysgalactiae subsp. equisimilis GGS_124
Streptococcus equi subsp. zooepidemicus MGCS10565
Streptococcus gallolyticus UCN34 10 4
Streptococcus gordonii str. Challis substr. CH1 2 1
Streptococcus mitis B6 2 1
Streptococcus mutans UA159 10 4
Streptococcus pneumoniae TIGR4 2 1
Streptococcus pyogenes M1 GAS
Streptococcus sanguinis SK36 2 1
Streptococcus suis 05ZYH33 2 1
Streptococcus thermophilus CNRZ1066 4 2
Streptococcus uberis 0140J
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
GALLO_1277
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
*
Streptococcus gallolyticus UCN34

Site:
position = -113
score = 5.72473
sequence = GTTATAAAAAAATCTTATCAC

Gene: GALLO_1277: Homocysteine biosynthesis transcriptional regulator HomR, LysR family
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
*
Streptococcus mutans UA159

Site:
position = -110
score = 5.20554
sequence = GCCATAAGAAAAAGTTATCAC

Site:
position = -175
score = 6.06284
sequence = GCTATAAATTTTATTTATGAC

Gene: SMU.930c: Homocysteine biosynthesis transcriptional regulator HomR, LysR family
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066

Gene: str0452: Homocysteine biosynthesis transcriptional regulator HomR, LysR family
 
Streptococcus uberis 0140J
Homocysteine biosynthesis transcriptional regulator HomR, LysR family
 
CRON 2.
metB
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403

Gene: L0102: Cystathionine gamma-synthase (EC 2.5.1.48)
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
*
Streptococcus gallolyticus UCN34

Site:
position = -142
score = 5.92684
sequence = GTTATAGTTTTTACTTATAGC

Gene: GALLO_1768: Cystathionine gamma-synthase (EC 2.5.1.48)
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1636: Cystathionine gamma-synthase (EC 2.5.1.48)
 
Streptococcus mitis B6

Gene: smi_1508: Cystathionine gamma-synthase (EC 2.5.1.48)
*
Streptococcus mutans UA159

Site:
position = -110
score = 4.85059
sequence = CTTATAGTTTCTTTTTATAGC

Gene: SMU.1675: Cystathionine gamma-synthase (EC 2.5.1.48)
 
Streptococcus pneumoniae TIGR4

Gene: SP_1525: Cystathionine gamma-synthase (EC 2.5.1.48)
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36

Gene: SSA_1737: Cystathionine gamma-synthase (EC 2.5.1.48)
 
Streptococcus suis 05ZYH33

Gene: SSU05_1562: Cystathionine gamma-synthase (EC 2.5.1.48)
*
Streptococcus thermophilus CNRZ1066

Site:
position = -132
score = 5.38269
sequence = GTTATAGTAATAAACTATATC

Gene: str0352: Cystathionine gamma-synthase (EC 2.5.1.48)
 
Streptococcus uberis 0140J
Cystathionine gamma-synthase (EC 2.5.1.48)
metC
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_2187: L-cysteine desulfhydrase
 
Lactococcus lactis subsp. lactis Il1403

Gene: L177593: L-cysteine desulfhydrase
 
Streptococcus agalactiae 2603V/R

Gene: SAG1587: L-cysteine desulfhydrase
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1767: L-cysteine desulfhydrase
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1635: L-cysteine desulfhydrase
 
Streptococcus mitis B6

Gene: smi_1507: L-cysteine desulfhydrase
 
Streptococcus mutans UA159

Gene: SMU.1674: L-cysteine desulfhydrase
 
Streptococcus pneumoniae TIGR4

Gene: SP_1524: L-cysteine desulfhydrase
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36

Gene: SSA_1736: L-cysteine desulfhydrase
 
Streptococcus suis 05ZYH33

Gene: SSU05_1561: L-cysteine desulfhydrase
 
Streptococcus thermophilus CNRZ1066

Gene: str0353: L-cysteine desulfhydrase
 
Streptococcus uberis 0140J

Gene: SUB0427: L-cysteine desulfhydrase
L-cysteine desulfhydrase
 
CRON 3.
tcyD
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
*
Streptococcus gallolyticus UCN34

Site:
position = -104
score = 5.58477
sequence = GCTATAAGCAAATCTTATGGC

Gene: GALLO_1275: Predicted uroporphyrinogen-III decarboxylase
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
*
Streptococcus mutans UA159

Site:
position = -168
score = 5.20554
sequence = GTGATAACTTTTTCTTATGGC

Site:
position = -103
score = 6.06284
sequence = GTCATAAATAAAATTTATAGC

Gene: SMU.932: Predicted uroporphyrinogen-III decarboxylase
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 2
Streptococcus sanguinis SK36

Gene: SSA_2105: Predicted uroporphyrinogen-III decarboxylase

Gene: SSA_2102: Predicted uroporphyrinogen-III decarboxylase
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Predicted uroporphyrinogen-III decarboxylase
tcyE
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1274: Predicted cysteine ABC transporter, substrate-binding protein
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159

Gene: SMU.933: Predicted cysteine ABC transporter, substrate-binding protein
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36

Gene: SSA_2101: Predicted cysteine ABC transporter, substrate-binding protein
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Predicted cysteine ABC transporter, substrate-binding protein
tcyF
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1273: Predicted cysteine ABC transporter, permease protein 1
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159

Gene: SMU.934: Predicted cysteine ABC transporter, permease protein 1
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36

Gene: SSA_2099: Predicted cysteine ABC transporter, permease protein 1
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Predicted cysteine ABC transporter, permease protein 1
tcyG
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1272: Predicted cysteine ABC transporter, permease protein 2
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159

Gene: SMU.935: Predicted cysteine ABC transporter, permease protein 2
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36

Gene: SSA_2098: Predicted cysteine ABC transporter, permease protein 2
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Predicted cysteine ABC transporter, permease protein 2
tcyH
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1271: Predicted cysteine ABC transporter, ATP-binding protein
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159

Gene: SMU.936: Predicted cysteine ABC transporter, ATP-binding protein
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36

Gene: SSA_2097: Predicted cysteine ABC transporter, ATP-binding protein
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Predicted cysteine ABC transporter, ATP-binding protein
 
CRON 4.
metE
 
Lactococcus lactis subsp. cremoris SK11
*
Lactococcus lactis subsp. lactis Il1403

Site:
position = -99
score = 4.30632
sequence = CATATAGTTTAAAACTATAGG

Gene: L0100: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
 
Streptococcus agalactiae 2603V/R

Gene: SAG2049: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
*
Streptococcus gallolyticus UCN34

Site:
position = -172
score = 5.16523
sequence = GTTATAGTTAAAAACTATAAT

Gene: GALLO_1316: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -99
score = 4.58554
sequence = GATATAGTTTTTGGCTATATC

Site:
position = -182
score = 5.17389
sequence = GTTATAGTTTTTGATTATACC

Gene: SGO_0310: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
*
Streptococcus mitis B6

Site:
position = -101
score = 4.76119
sequence = GATATAGTTTCAAACTATATC

Gene: smi_1600: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
*
Streptococcus mutans UA159

Site:
position = -188
score = 5.3623
sequence = GTTATAGATGAAAACTATAAC

Gene: SMU.873: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
*
Streptococcus pneumoniae TIGR4

Site:
position = -218
score = 4.95056
sequence = CTTATAAGAATTACTAATAAC

Site:
position = -251
score = 5.01095
sequence = GTTATAGTCTTTTCTAATAAC

Gene: SP_0585: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
 
Streptococcus pyogenes M1 GAS
*
Streptococcus sanguinis SK36

Site:
position = -182
score = 5.31664
sequence = GTCATAATTTCTACCTATAGC

Site:
position = -99
score = 5.18785
sequence = GTTATAGTTTTAGACTATATC

Gene: SSA_0416: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
*
Streptococcus suis 05ZYH33

Site:
position = -237
score = 4.7159
sequence = TTCATAGATAAAATCTATACC

Site:
position = -101
score = 4.83192
sequence = GTTATAGTCAAAAGTTATACC

Gene: SSU05_1774: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
*
Streptococcus thermophilus CNRZ1066

Site:
position = -60
score = 4.64455
sequence = GATATAGTTTAAAACTATATA

Gene: str0785: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
 
Streptococcus uberis 0140J
5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
metH
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R

Gene: SAG2048: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1315: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159

Gene: SMU.874: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
metF
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403

Gene: L0099: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0311: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Streptococcus mitis B6

Gene: smi_1599: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_0586: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36

Gene: SSA_0417: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Streptococcus suis 05ZYH33

Gene: SSU05_1775: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Streptococcus thermophilus CNRZ1066

Gene: str0786: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Streptococcus uberis 0140J
5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
CRON 5.
metB2
*
Lactococcus lactis subsp. cremoris SK11

Site:
position = -80
score = 4.82647
sequence = GACATAGCATTTTCTTATGGC

Gene: LACR_0831: Cystathionine gamma-lyase (EC 4.4.1.1)
*
Lactococcus lactis subsp. lactis Il1403

Site:
position = -79
score = 5.97337
sequence = GCTATAAAAAAATCTTATAGC

Gene: L0181: Cystathionine gamma-lyase (EC 4.4.1.1)
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066

Gene: str0847: Cystathionine gamma-lyase (EC 4.4.1.1)
 
Streptococcus uberis 0140J
Cystathionine gamma-lyase (EC 4.4.1.1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD