Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CmbR - Streptococcaceae

Properties
Regulator type: Transcription factor
Regulator family: LysR
Regulation mode: repressor (activator)
Biological process: Cysteine metabolism
Effector: O-acetyl-L-serine
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 104 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactococcus lactis subsp. cremoris SK11 14 5
Lactococcus lactis subsp. lactis Il1403 21 9
Streptococcus agalactiae 2603V/R 8 4
Streptococcus dysgalactiae subsp. equisimilis GGS_124 6 3
Streptococcus equi subsp. zooepidemicus MGCS10565 7 4
Streptococcus gallolyticus UCN34 21 9
Streptococcus gordonii str. Challis substr. CH1 10 5
Streptococcus mitis B6 10 6
Streptococcus mutans UA159 14 6
Streptococcus pneumoniae TIGR4 11 7
Streptococcus pyogenes M1 GAS 4 2
Streptococcus sanguinis SK36 13 5
Streptococcus suis 05ZYH33 6 4
Streptococcus thermophilus CNRZ1066 20 10
Streptococcus uberis 0140J 5 4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
metA
 
Lactococcus lactis subsp. cremoris SK11
*
Lactococcus lactis subsp. lactis Il1403

Site:
position = -132
score = 4.33984
sequence = GCCATAGGCAAGTTTTATTAT

Gene: L0101: Homoserine O-succinyltransferase (EC 2.3.1.46)
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
*
Streptococcus gallolyticus UCN34

Site:
position = -107
score = 4.29451
sequence = ATTATAGCTAAAAACTATAAC

Gene: GALLO_0824: Homoserine O-succinyltransferase (EC 2.3.1.46)
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1002: Homoserine O-succinyltransferase (EC 2.3.1.46)
 
Streptococcus mitis B6

Gene: smi_1566: Homoserine O-succinyltransferase (EC 2.3.1.46)
 
Streptococcus mutans UA159

Gene: SMU.1466: Homoserine O-succinyltransferase (EC 2.3.1.46)
*
Streptococcus pneumoniae TIGR4

Site:
position = -145
score = 4.64256
sequence = GATATAAAAATAGACTATAAC

Gene: SP_1576: Homoserine O-succinyltransferase (EC 2.3.1.46)
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36

Gene: SSA_1420: Homoserine O-succinyltransferase (EC 2.3.1.46)
*
Streptococcus suis 05ZYH33

Site:
position = -46
score = 4.6566
sequence = GTTATAGCCAAAACTTATAAC

Gene: SSU05_1306: Homoserine O-succinyltransferase (EC 2.3.1.46)
 
Streptococcus thermophilus CNRZ1066

Gene: str1222: Homoserine O-succinyltransferase (EC 2.3.1.46)
 
Streptococcus uberis 0140J
Homoserine O-succinyltransferase (EC 2.3.1.46)
metB1
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403

Gene: L0102: Cystathionine gamma-synthase (EC 2.5.1.48)
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Cystathionine gamma-synthase (EC 2.5.1.48)
 
CRON 2.
cysD
*
Lactococcus lactis subsp. cremoris SK11

Site:
position = -171
score = 4.38338
sequence = ACTATTTAAAAATTCTATAAC

Gene: LACR_0068: O-acetylhomoserine sulfhydrylase (EC 2.5.1.49)
*
Lactococcus lactis subsp. lactis Il1403

Site:
position = -172
score = 4.1544
sequence = TCCATTAAAAAATCATATCGA

Gene: L75975: O-acetylhomoserine sulfhydrylase (EC 2.5.1.49)
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
O-acetylhomoserine sulfhydrylase (EC 2.5.1.49)
 
CRON 3.
dfpB
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_0592: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)
*
Lactococcus lactis subsp. lactis Il1403

Site:
position = -59
score = 4.81709
sequence = TTGAAAAAATATTTTTATTAG

Gene: L167675: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)
 
Streptococcus agalactiae 2603V/R

Gene: SAG1063: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -10
score = 4.3809
sequence = ATGATAAAATATGGCTATGAA

Gene: SDEG_1040: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -177
score = 4.68511
sequence = TTGATAGTATCATTATATCAC

Site:
position = -10
score = 4.3444
sequence = CTGATAAAATATGGCTATGAA

Gene: Sez_0944: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1120: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1212: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)
 
Streptococcus mitis B6

Gene: smi_1193: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)
 
Streptococcus mutans UA159

Gene: SMU.1074: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)
 
Streptococcus pneumoniae TIGR4

Gene: SP_1230: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)
*
Streptococcus pyogenes M1 GAS

Site:
position = -16
score = 4.72001
sequence = TTGATAAAATATGACTATGAA

Gene: SPy1221: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)
 
Streptococcus sanguinis SK36

Gene: SSA_1201: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)
 
Streptococcus suis 05ZYH33

Gene: SSU05_0689: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)
*
Streptococcus thermophilus CNRZ1066

Site:
position = -83
score = 4.3207
sequence = GTTATAACTTTATTTTATATG

Gene: str0790: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)
 
Streptococcus uberis 0140J

Gene: SUB0943: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)
Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)
dfpA
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403

Gene: L166912: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)
 
Streptococcus agalactiae 2603V/R

Gene: SAG1064: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1041: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_0943: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1121: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1213: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)
 
Streptococcus mitis B6

Gene: smi_1194: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)
 
Streptococcus mutans UA159

Gene: SMU.1075: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)
 
Streptococcus pneumoniae TIGR4

Gene: SP_1231: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)
 
Streptococcus pyogenes M1 GAS

Gene: SPy1222: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)
 
Streptococcus sanguinis SK36

Gene: SSA_1202: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)
 
Streptococcus suis 05ZYH33

Gene: SSU05_0688: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)
 
Streptococcus thermophilus CNRZ1066

Gene: str0789: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)
 
Streptococcus uberis 0140J

Gene: SUB0944: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)
Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)
panT
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_0590: Core component PanP of predicted pantothenate ECF transporter
 
Lactococcus lactis subsp. lactis Il1403

Gene: L166479: Core component PanP of predicted pantothenate ECF transporter
 
Streptococcus agalactiae 2603V/R

Gene: SAG1065: Core component PanP of predicted pantothenate ECF transporter
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1042: Core component PanP of predicted pantothenate ECF transporter
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_0942: Core component PanP of predicted pantothenate ECF transporter
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1122: Core component PanP of predicted pantothenate ECF transporter
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1214: Core component PanP of predicted pantothenate ECF transporter
 
Streptococcus mitis B6

Gene: smi_1195: Core component PanP of predicted pantothenate ECF transporter
 
Streptococcus mutans UA159

Gene: SMU.1076: Core component PanP of predicted pantothenate ECF transporter
 
Streptococcus pneumoniae TIGR4

Gene: SP_1232: Core component PanP of predicted pantothenate ECF transporter
 
Streptococcus pyogenes M1 GAS

Gene: SPy1223: Core component PanP of predicted pantothenate ECF transporter
 
Streptococcus sanguinis SK36

Gene: SSA_1203: Core component PanP of predicted pantothenate ECF transporter
 
Streptococcus suis 05ZYH33

Gene: SSU05_0687: Core component PanP of predicted pantothenate ECF transporter
 
Streptococcus thermophilus CNRZ1066

Gene: str0788: Core component PanP of predicted pantothenate ECF transporter
 
Streptococcus uberis 0140J

Gene: SUB0945: Core component PanP of predicted pantothenate ECF transporter
Core component PanP of predicted pantothenate ECF transporter
 
CRON 4.
plp
*4
Lactococcus lactis subsp. cremoris SK11

Site:
position = -476
score = 4.35449
sequence = TTTATAAATTAAACTTAAAAA

Gene: LACR_0360: Methionine ABC transporter, substrate-binding protein

Gene: LACR_0361: Methionine ABC transporter, substrate-binding protein

Gene: LACR_0362: Methionine ABC transporter, substrate-binding protein

Gene: LACR_0364: Methionine ABC transporter, substrate-binding protein
*4
Lactococcus lactis subsp. lactis Il1403

Site:
position = -514
score = 4.35449
sequence = TTTATAAATTAAACTTAAAAA

Gene: L117444: Methionine ABC transporter, substrate-binding protein

Gene: L118475: Methionine ABC transporter, substrate-binding protein

Gene: L119452: Methionine ABC transporter, substrate-binding protein

Gene: L120334: Methionine ABC transporter, substrate-binding protein
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Methionine ABC transporter, substrate-binding protein
LACR_0363
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_0363: Predicted reductase
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Predicted reductase
metP
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_0365: Methionine ABC transporter, permease protein
 
Lactococcus lactis subsp. lactis Il1403

Gene: L121289: Methionine ABC transporter, permease protein
 
Streptococcus agalactiae 2603V/R

Gene: SAG1639: Methionine ABC transporter, permease protein
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_0385: Methionine ABC transporter, permease protein
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1677: Methionine ABC transporter, permease protein
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1842: Methionine ABC transporter, permease protein
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0460: Methionine ABC transporter, permease protein
 
Streptococcus mitis B6

Gene: smi_1942: Methionine ABC transporter, permease protein
 
Streptococcus mutans UA159

Gene: SMU.1939c: Methionine ABC transporter, permease protein
 
Streptococcus pneumoniae TIGR4

Gene: SP_0151: Methionine ABC transporter, permease protein
 
Streptococcus pyogenes M1 GAS

Gene: SPy0320: Methionine ABC transporter, permease protein
 
Streptococcus sanguinis SK36

Gene: SSA_0376: Methionine ABC transporter, permease protein
 
Streptococcus suis 05ZYH33

Gene: SSU05_1769: Methionine ABC transporter, permease protein
 
Streptococcus thermophilus CNRZ1066

Gene: str0301: Methionine ABC transporter, permease protein
 
Streptococcus uberis 0140J

Gene: SUB0368: Methionine ABC transporter, permease protein
Methionine ABC transporter, permease protein
metN
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_0366: Methionine ABC transporter, ATP-binding protein
 
Lactococcus lactis subsp. lactis Il1403

Gene: L122401: Methionine ABC transporter, ATP-binding protein
 
Streptococcus agalactiae 2603V/R

Gene: SAG1638: Methionine ABC transporter, ATP-binding protein
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_0386: Methionine ABC transporter, ATP-binding protein
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1676: Methionine ABC transporter, ATP-binding protein
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1841: Methionine ABC transporter, ATP-binding protein
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0461: Methionine ABC transporter, ATP-binding protein
 
Streptococcus mitis B6

Gene: smi_1941: Methionine ABC transporter, ATP-binding protein
 
Streptococcus mutans UA159

Gene: SMU.1938c: Methionine ABC transporter, ATP-binding protein
 
Streptococcus pneumoniae TIGR4

Gene: SP_0152: Methionine ABC transporter, ATP-binding protein
 
Streptococcus pyogenes M1 GAS

Gene: SPy0321: Methionine ABC transporter, ATP-binding protein
 
Streptococcus sanguinis SK36

Gene: SSA_0377: Methionine ABC transporter, ATP-binding protein
 
Streptococcus suis 05ZYH33

Gene: SSU05_1768: Methionine ABC transporter, ATP-binding protein
 
Streptococcus thermophilus CNRZ1066

Gene: str0302: Methionine ABC transporter, ATP-binding protein
 
Streptococcus uberis 0140J

Gene: SUB0369: Methionine ABC transporter, ATP-binding protein
Methionine ABC transporter, ATP-binding protein
 
CRON 5.
mmuP
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
*
Streptococcus agalactiae 2603V/R

Site:
position = -97
score = 4.94653
sequence = GTAATAGTTTTTCTTTATCAT

Gene: SAG1306: Predicted S-methylmethionine permease
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1253: Predicted S-methylmethionine permease
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159

Gene: SMU.951: Predicted S-methylmethionine permease
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 2
Streptococcus suis 05ZYH33

Gene: SSU05_2025: Predicted S-methylmethionine permease

Gene: SSU05_2026: Predicted S-methylmethionine permease
*
Streptococcus thermophilus CNRZ1066

Site:
position = -22
score = 4.81521
sequence = GTGATAGTTTTTCTCTATCTC

Gene: str0583: Predicted S-methylmethionine permease
 
Streptococcus uberis 0140J
Predicted S-methylmethionine permease
mmuM
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R

Gene: SAG1305: Homocysteine S-methyltransferase (EC 2.1.1.10)
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1252: Homocysteine S-methyltransferase (EC 2.1.1.10)
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159

Gene: SMU.952: Homocysteine S-methyltransferase (EC 2.1.1.10)
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36

Gene: SSA_1096: Homocysteine S-methyltransferase (EC 2.1.1.10)
 
Streptococcus suis 05ZYH33

Gene: SSU05_2024: Homocysteine S-methyltransferase (EC 2.1.1.10)
 
Streptococcus thermophilus CNRZ1066

Gene: str0584: Homocysteine S-methyltransferase (EC 2.1.1.10)
 
Streptococcus uberis 0140J
Homocysteine S-methyltransferase (EC 2.1.1.10)
 
CRON 6.
yvdE
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R

Gene: SAG1643: Predicted glutamine amidotransferase, class I
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
*
Streptococcus gallolyticus UCN34

Site:
position = -61
score = 5.01704
sequence = AGGATAGAATAATCTTATCAC

Site:
position = -98
score = 5.18707
sequence = GTGATAAAAAAAATCTATTGG

Gene: GALLO_1848: Predicted glutamine amidotransferase, class I
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -97
score = 5.52483
sequence = TTGATAAAAAATTTTTATAAG

Gene: SGO_0167: Predicted glutamine amidotransferase, class I
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
*
Streptococcus pneumoniae TIGR4

Site:
position = -64
score = 5.20372
sequence = TCCATAAAAAATGTTTATCAC

Gene: SP_2072: Predicted glutamine amidotransferase, class I
 
Streptococcus pyogenes M1 GAS
*
Streptococcus sanguinis SK36

Site:
position = -100
score = 5.76257
sequence = CTGATAAAAAATTTTTATAAC

Gene: SSA_2164: Predicted glutamine amidotransferase, class I
*
Streptococcus suis 05ZYH33

Site:
position = -95
score = 5.26709
sequence = CTGATAGTTATTTTTTATCAA

Gene: SSU05_1773: Predicted glutamine amidotransferase, class I
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Predicted glutamine amidotransferase, class I
gshT
*
Lactococcus lactis subsp. cremoris SK11

Site:
position = -136
score = 4.4642
sequence = ATCATAAATCTTTTTTATGGT

Gene: LACR_2344: Predicted glutathione ABC transporter, substrate-binding protein
*
Lactococcus lactis subsp. lactis Il1403

Site:
position = -136
score = 4.70194
sequence = GTCATAAATCTTTTTTATGGT

Gene: L121253: Predicted glutathione ABC transporter, substrate-binding protein
 
Streptococcus agalactiae 2603V/R

Gene: SAG1642: Predicted glutathione ABC transporter, substrate-binding protein
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -75
score = 4.98272
sequence = TTGATAGGAATTAATTATTAG

Gene: SDEG_0381: Predicted glutathione ABC transporter, substrate-binding protein
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -41
score = 4.97954
sequence = ATGATAAACTAATCTTATGAA

Gene: Sez_1680: Predicted glutathione ABC transporter, substrate-binding protein
*2
Streptococcus gallolyticus UCN34

Gene: GALLO_1847: Predicted glutathione ABC transporter, substrate-binding protein

Site:
position = -122
score = 5.9614
sequence = GTGATAAGTTTTATTTATCAC

Gene: GALLO_1845: Predicted glutathione ABC transporter, substrate-binding protein
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -85
score = 4.72336
sequence = GCAATAAATAAAATTTATACC

Gene: SGO_0457: Predicted glutathione ABC transporter, substrate-binding protein
*3
Streptococcus mitis B6

Site:
position = -101
score = 5.07671
sequence = ATGATTAAGTTTTTTTATCAC

Gene: smi_1579: Predicted glutathione ABC transporter, substrate-binding protein

Site:
position = -99
score = 5.12134
sequence = GCCATAAAGAAAACCTATCAC

Gene: smi_1946: Predicted glutathione ABC transporter, substrate-binding protein

Site:
position = -99
score = 5.12134
sequence = GCCATAAAGAAAACCTATCAC

Gene: smi_1945: Predicted glutathione ABC transporter, substrate-binding protein
*
Streptococcus mutans UA159

Site:
position = -76
score = 4.57855
sequence = GTGATAGAAATTATATAATAG

Site:
position = -98
score = 5.95948
sequence = GTGATAGAATTTTCTTATCAC

Gene: SMU.1942c: Predicted glutathione ABC transporter, substrate-binding protein
*2
Streptococcus pneumoniae TIGR4

Site:
position = -100
score = 4.9204
sequence = ATGATTAAGTTTTTCTATCAC

Gene: SP_0620: Predicted glutathione ABC transporter, substrate-binding protein

Site:
position = -99
score = 5.26901
sequence = CCCATAAAAAAAACTTATCAC

Gene: SP_0148: Predicted glutathione ABC transporter, substrate-binding protein
*
Streptococcus pyogenes M1 GAS

Site:
position = -75
score = 4.49716
sequence = TTGATAGGAATCAATTATTAG

Gene: SPy0317: Predicted glutathione ABC transporter, substrate-binding protein
*
Streptococcus sanguinis SK36

Site:
position = -100
score = 4.8219
sequence = CTGATAAAGAAAAGCTATCAC

Gene: SSA_0588: Predicted glutathione ABC transporter, substrate-binding protein
 
Streptococcus suis 05ZYH33
*2
Streptococcus thermophilus CNRZ1066

Site:
position = -98
score = 5.74466
sequence = GTGATAGTATTTTCTTATCAC

Gene: str0296: Predicted glutathione ABC transporter, substrate-binding protein

Site:
position = -101
score = 5.19132
sequence = TTGATAGATATTGTTTATCAG

Gene: str0908: Predicted glutathione ABC transporter, substrate-binding protein
*
Streptococcus uberis 0140J

Site:
position = -93
score = 4.86736
sequence = GTGATAGAGAACTATTATCAT

Site:
position = -71
score = 4.22533
sequence = GCGATAGTGAATCACTATTAG

Gene: SUB0365: Predicted glutathione ABC transporter, substrate-binding protein
Predicted glutathione ABC transporter, substrate-binding protein
 
CRON 7.
tcyD
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
*
Streptococcus gallolyticus UCN34

Site:
position = -104
score = 4.90252
sequence = GCTATAAGCAAATCTTATGGC

Gene: GALLO_1275: Predicted uroporphyrinogen-III decarboxylase
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
*
Streptococcus mutans UA159

Site:
position = -168
score = 4.98933
sequence = GTGATAACTTTTTCTTATGGC

Site:
position = -103
score = 5.30886
sequence = GTCATAAATAAAATTTATAGC

Gene: SMU.932: Predicted uroporphyrinogen-III decarboxylase
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
*2
Streptococcus sanguinis SK36

Site:
position = -194
score = 5.25904
sequence = TTGATAAAAATTACCTATCTC

Site:
position = -59
score = 5.0691
sequence = TTGATAAATATTTTTAATCAG

Gene: SSA_2105: Predicted uroporphyrinogen-III decarboxylase

Gene: SSA_2102: Predicted uroporphyrinogen-III decarboxylase
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Predicted uroporphyrinogen-III decarboxylase
SSA_2103
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36

Gene: SSA_2103: Hypothetical protein
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Hypothetical protein
tcyE
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1274: Predicted cysteine ABC transporter, substrate-binding protein
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159

Gene: SMU.933: Predicted cysteine ABC transporter, substrate-binding protein
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36

Gene: SSA_2101: Predicted cysteine ABC transporter, substrate-binding protein
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Predicted cysteine ABC transporter, substrate-binding protein
tcyF
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1273: Predicted cysteine ABC transporter, permease protein 1
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159

Gene: SMU.934: Predicted cysteine ABC transporter, permease protein 1
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36

Gene: SSA_2099: Predicted cysteine ABC transporter, permease protein 1
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Predicted cysteine ABC transporter, permease protein 1
tcyG
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1272: Predicted cysteine ABC transporter, permease protein 2
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159

Gene: SMU.935: Predicted cysteine ABC transporter, permease protein 2
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36

Gene: SSA_2098: Predicted cysteine ABC transporter, permease protein 2
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Predicted cysteine ABC transporter, permease protein 2
tcyH
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1271: Predicted cysteine ABC transporter, ATP-binding protein
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159

Gene: SMU.936: Predicted cysteine ABC transporter, ATP-binding protein
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36

Gene: SSA_2097: Predicted cysteine ABC transporter, ATP-binding protein
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Predicted cysteine ABC transporter, ATP-binding protein
 
CRON 8.
homR
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
*
Streptococcus gallolyticus UCN34

Site:
position = -113
score = 5.9252
sequence = GTTATAAAAAAATCTTATCAC

Site:
position = -175
score = 4.36234
sequence = ATAATCTAAATTTTTTATTAT

Gene: GALLO_1277: Homocysteine biosynthesis transcriptional regulato HomR, LysR family
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
*
Streptococcus mutans UA159

Site:
position = -110
score = 4.98933
sequence = GCCATAAGAAAAAGTTATCAC

Site:
position = -175
score = 5.30886
sequence = GCTATAAATTTTATTTATGAC

Gene: SMU.930c: Homocysteine biosynthesis transcriptional regulato HomR, LysR family
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
*
Streptococcus thermophilus CNRZ1066

Site:
position = -108
score = 5.27337
sequence = TTTATAAAAATTTCATATCAG

Gene: str0452: Homocysteine biosynthesis transcriptional regulato HomR, LysR family
 
Streptococcus uberis 0140J
Homocysteine biosynthesis transcriptional regulato HomR, LysR family
 
CRON 9.
str1582
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
*
Streptococcus gallolyticus UCN34

Site:
position = -96
score = 5.2609
sequence = GCTATAAAAATTATTTATGGC

Gene: GALLO_1237: Predicted polar amino acid ABC transporter, permease protein 1
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -139
score = 5.1766
sequence = CTTATAAATTTTTTCTATCAG

Site:
position = -117
score = 4.85418
sequence = CCGATAAAATATACATATTAT

Gene: SGO_0985: Predicted polar amino acid ABC transporter, permease protein 1
*
Streptococcus mitis B6

Site:
position = -80
score = 4.43512
sequence = GCAATAAAAAATAGATATTAT

Site:
position = -102
score = 5.50008
sequence = ATGATAAAAAATCCTTATAAC

Gene: smi_1436: Predicted polar amino acid ABC transporter, permease protein 1
 
Streptococcus mutans UA159
*
Streptococcus pneumoniae TIGR4

Site:
position = -140
score = 4.43512
sequence = GCAATAAAAAATAGATATTAT

Gene: SP_0711: Predicted polar amino acid ABC transporter, permease protein 1
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
*
Streptococcus thermophilus CNRZ1066

Site:
position = -215
score = 5.17228
sequence = TTGATAAAAAATACATATTAT

Site:
position = -237
score = 4.84379
sequence = GTTATATCTTTTCTTTATCAC

Gene: str1582: Predicted polar amino acid ABC transporter, permease protein 1
 
Streptococcus uberis 0140J
Predicted polar amino acid ABC transporter, permease protein 1
str1581
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1236: Predicted polar amino acid ABC transporter, permease protein 2
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0984: Predicted polar amino acid ABC transporter, permease protein 2
 
Streptococcus mitis B6

Gene: smi_1437: Predicted polar amino acid ABC transporter, permease protein 2
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_0710: Predicted polar amino acid ABC transporter, permease protein 2
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066

Gene: str1581: Predicted polar amino acid ABC transporter, permease protein 2
 
Streptococcus uberis 0140J
Predicted polar amino acid ABC transporter, permease protein 2
str1580
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1235: Predicted polar amino acid ABC transporter, ATP-binding protein
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0983: Predicted polar amino acid ABC transporter, ATP-binding protein
 
Streptococcus mitis B6

Gene: smi_1438: Predicted polar amino acid ABC transporter, ATP-binding protein
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_0709: Predicted polar amino acid ABC transporter, ATP-binding protein
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066

Gene: str1580: Predicted polar amino acid ABC transporter, ATP-binding protein
 
Streptococcus uberis 0140J
Predicted polar amino acid ABC transporter, ATP-binding protein
str1579
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1234: Predicted polar amino acid ABC transporter, substrate-binding protein
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0982: Predicted polar amino acid ABC transporter, substrate-binding protein
 
Streptococcus mitis B6

Gene: smi_1439: Predicted polar amino acid ABC transporter, substrate-binding protein
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066

Gene: str1579: Predicted polar amino acid ABC transporter, substrate-binding protein
 
Streptococcus uberis 0140J
Predicted polar amino acid ABC transporter, substrate-binding protein
 
CRON 10.
tcyA
*
Lactococcus lactis subsp. cremoris SK11

Site:
position = -77
score = 5.1493
sequence = GCTATAAGTTTTTTTTATGGC

Gene: LACR_1009: Cystine ABC transporter, substrate-binding protein
*
Lactococcus lactis subsp. lactis Il1403

Site:
position = -77
score = 5.1493
sequence = GCTATAAGTTTTTTTTATGGC

Gene: L162009: Cystine ABC transporter, substrate-binding protein
*
Streptococcus agalactiae 2603V/R

Site:
position = -75
score = 4.7161
sequence = CTGATAAGGAAATACTATTAT

Site:
position = -96
score = 5.50597
sequence = TTGATATAAAATCTTTATCAC

Gene: SAG0290: Cystine ABC transporter, substrate-binding protein
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1720: Cystine ABC transporter, substrate-binding protein
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -98
score = 4.7192
sequence = TTGATACTATTTTCTTATTGC

Site:
position = -76
score = 4.2288
sequence = TTGATAGAGAAATGATATTAT

Gene: Sez_1582: Cystine ABC transporter, substrate-binding protein
*
Streptococcus gallolyticus UCN34

Site:
position = -100
score = 5.15548
sequence = CTGATAGTTTTTTCTTATCAA

Gene: GALLO_0414: Cystine ABC transporter, substrate-binding protein
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
*
Streptococcus mutans UA159

Site:
position = -102
score = 5.77804
sequence = GTGATAGAAAAATATTATCAC

Site:
position = -80
score = 5.02244
sequence = GTGATAGGAAAAAACTATTAT

Gene: SMU.459: Cystine ABC transporter, substrate-binding protein
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066

Gene: str1654: Cystine ABC transporter, substrate-binding protein
*
Streptococcus uberis 0140J

Site:
position = -76
score = 4.22281
sequence = TTGATAGAAAAATGGTATTAT

Site:
position = -98
score = 4.49505
sequence = GTCATATAAATAGCTAATTAC

Gene: SUB1416: Cystine ABC transporter, substrate-binding protein
Cystine ABC transporter, substrate-binding protein
tcyB
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_1010: Cystine ABC transporter, permease protein
 
Lactococcus lactis subsp. lactis Il1403

Gene: L163056: Cystine ABC transporter, permease protein
 
Streptococcus agalactiae 2603V/R

Gene: SAG0291: Cystine ABC transporter, permease protein
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -99
score = 5.26026
sequence = GTGATAAGTTTTGCTTATTGC

Gene: SDEG_1719: Cystine ABC transporter, permease protein
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -106
score = 4.99102
sequence = GCGATAGGCTTTTCTTATCGT

Gene: Sez_1580: Cystine ABC transporter, permease protein
 
Streptococcus gallolyticus UCN34

Gene: GALLO_0415: Cystine ABC transporter, permease protein
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -170
score = 4.71616
sequence = GTCATAAAATTTGCTTATACC

Site:
position = -148
score = 4.33024
sequence = TTGATAAATAATTTATACTGT

Gene: SGO_0578: Cystine ABC transporter, permease protein
*
Streptococcus mitis B6

Site:
position = -164
score = 4.66282
sequence = GAGATAGTTTTTACTTATCTC

Site:
position = -142
score = 4.9887
sequence = TTGATAGATAAAATATATAGC

Gene: smi_1382: Cystine ABC transporter, permease protein
 
Streptococcus mutans UA159

Gene: SMU.460: Cystine ABC transporter, permease protein
*
Streptococcus pneumoniae TIGR4

Site:
position = -164
score = 4.28892
sequence = GAAATAGTTTTTATCTATCTC

Site:
position = -142
score = 5.19207
sequence = TTGATAGATAAAATATATAAC

Gene: SP_1461: Cystine ABC transporter, permease protein
 
Streptococcus pyogenes M1 GAS

Gene: SPy1658: Cystine ABC transporter, permease protein
*
Streptococcus sanguinis SK36

Site:
position = -228
score = 5.2953
sequence = GTGATAAGAAAAATATATTAG

Site:
position = -250
score = 5.40375
sequence = GTGATATACTTTTCTTATCGC

Gene: SSA_1868: Cystine ABC transporter, permease protein
 
Streptococcus suis 05ZYH33
*
Streptococcus thermophilus CNRZ1066

Site:
position = -217
score = 5.78713
sequence = GTGATATGATTTACTTATCAC

Gene: str1653: Cystine ABC transporter, permease protein
*
Streptococcus uberis 0140J

Site:
position = -80
score = 4.76621
sequence = GTGATAGGCTTTAACTATTGC

Gene: SUB1415: Cystine ABC transporter, permease protein
Cystine ABC transporter, permease protein
tcyC
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_1011: Cystine ABC transporter, ATP-binding protein
 
Lactococcus lactis subsp. lactis Il1403

Gene: L164012: Cystine ABC transporter, ATP-binding protein
 
Streptococcus agalactiae 2603V/R

Gene: SAG0292: Cystine ABC transporter, ATP-binding protein
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1718: Cystine ABC transporter, ATP-binding protein
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1579: Cystine ABC transporter, ATP-binding protein
 
Streptococcus gallolyticus UCN34

Gene: GALLO_0416: Cystine ABC transporter, ATP-binding protein
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0579: Cystine ABC transporter, ATP-binding protein
 
Streptococcus mitis B6

Gene: smi_1381: Cystine ABC transporter, ATP-binding protein
 
Streptococcus mutans UA159

Gene: SMU.461: Cystine ABC transporter, ATP-binding protein
 
Streptococcus pneumoniae TIGR4

Gene: SP_1460: Cystine ABC transporter, ATP-binding protein
 
Streptococcus pyogenes M1 GAS

Gene: SPy1657: Cystine ABC transporter, ATP-binding protein
 
Streptococcus sanguinis SK36

Gene: SSA_1867: Cystine ABC transporter, ATP-binding protein
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066

Gene: str1652: Cystine ABC transporter, ATP-binding protein
 
Streptococcus uberis 0140J

Gene: SUB1414: Cystine ABC transporter, ATP-binding protein
Cystine ABC transporter, ATP-binding protein
 
CRON 11.
COG1739
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_1191: Conserved hypothetical protein
 
Lactococcus lactis subsp. lactis Il1403

Gene: L98095: Conserved hypothetical protein
 
Streptococcus agalactiae 2603V/R

Gene: SAG0335: Conserved hypothetical protein
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1684: Conserved hypothetical protein
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1548: Conserved hypothetical protein
 
Streptococcus gallolyticus UCN34

Gene: GALLO_0501: Conserved hypothetical protein
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0607: Conserved hypothetical protein
 
Streptococcus mitis B6

Gene: smi_2059: Conserved hypothetical protein
 
Streptococcus mutans UA159

Gene: SMU.497c: Conserved hypothetical protein
 
Streptococcus pneumoniae TIGR4

Gene: SP_2209: Conserved hypothetical protein
 
Streptococcus pyogenes M1 GAS

Gene: SPy1617: Conserved hypothetical protein
 
Streptococcus sanguinis SK36

Gene: SSA_1837: Conserved hypothetical protein
 
Streptococcus suis 05ZYH33

Gene: SSU05_0436: Conserved hypothetical protein
*
Streptococcus thermophilus CNRZ1066

Site:
position = -16
score = 5.17835
sequence = ATGATAAAATTTTTTTATGGA

Gene: str0367: Conserved hypothetical protein
 
Streptococcus uberis 0140J

Gene: SUB1378: Conserved hypothetical protein
Conserved hypothetical protein
cysK
 2
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_0832: Cysteine synthase (EC 2.5.1.47)

Gene: LACR_0537: Cysteine synthase (EC 2.5.1.47)
*2
Lactococcus lactis subsp. lactis Il1403

Gene: L0089: Cysteine synthase (EC 2.5.1.47)

Site:
position = -87
score = 4.47627
sequence = ATCATAAATTTTTTTTAGAGC

Gene: L0088: Cysteine synthase (EC 2.5.1.47)
 
Streptococcus agalactiae 2603V/R

Gene: SAG0334: Cysteine synthase (EC 2.5.1.47)
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1685: Cysteine synthase (EC 2.5.1.47)
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1549: Cysteine synthase (EC 2.5.1.47)
 
Streptococcus gallolyticus UCN34

Gene: GALLO_0500: Cysteine synthase (EC 2.5.1.47)
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0606: Cysteine synthase (EC 2.5.1.47)
*
Streptococcus mitis B6

Site:
position = -98
score = 5.30517
sequence = GATATAAAAAAATCCTATCAC

Gene: smi_2060: Cysteine synthase (EC 2.5.1.47)
 
Streptococcus mutans UA159

Gene: SMU.496: Cysteine synthase (EC 2.5.1.47)
 
Streptococcus pneumoniae TIGR4

Gene: SP_2210: Cysteine synthase (EC 2.5.1.47)
 
Streptococcus pyogenes M1 GAS

Gene: SPy1618: Cysteine synthase (EC 2.5.1.47)
 
Streptococcus sanguinis SK36

Gene: SSA_1839: Cysteine synthase (EC 2.5.1.47)
 
Streptococcus suis 05ZYH33

Gene: SSU05_0435: Cysteine synthase (EC 2.5.1.47)
 2
Streptococcus thermophilus CNRZ1066

Gene: str0366: Cysteine synthase (EC 2.5.1.47)

Gene: str0846: Cysteine synthase (EC 2.5.1.47)
*
Streptococcus uberis 0140J

Site:
position = -104
score = 5.05278
sequence = ATGATAAGCCTTTCCTATCAC

Gene: SUB1379: Cysteine synthase (EC 2.5.1.47)
Cysteine synthase (EC 2.5.1.47)
metB2
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_0831: Cystathionine gamma-lyase (EC 4.4.1.1)
*
Lactococcus lactis subsp. lactis Il1403

Site:
position = -79
score = 5.32787
sequence = GCTATAAAAAAATCTTATAGC

Gene: L0181: Cystathionine gamma-lyase (EC 4.4.1.1)
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066

Gene: str0847: Cystathionine gamma-lyase (EC 4.4.1.1)
 
Streptococcus uberis 0140J
Cystathionine gamma-lyase (EC 4.4.1.1)
 
CRON 12.
metE
*
Lactococcus lactis subsp. cremoris SK11

Site:
position = -39
score = 4.69923
sequence = TTGATAAGATAGACCTATTAA

Gene: LACR_1368: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
*
Lactococcus lactis subsp. lactis Il1403

Site:
position = -76
score = 4.13098
sequence = ATCATATTAAAAATGTATTAT

Site:
position = -39
score = 4.69923
sequence = TTGATAAGATAGACCTATTAA

Gene: L0100: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
*
Streptococcus agalactiae 2603V/R

Site:
position = -109
score = 4.11009
sequence = GCTAAAAATATAAAATATTAA

Gene: SAG2049: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
*
Streptococcus gallolyticus UCN34

Site:
position = -172
score = 4.63362
sequence = GTTATAGTTAAAAACTATAAT

Site:
position = -221
score = 4.23548
sequence = ATAATAAATTTTATTAATCTA

Gene: GALLO_1316: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -182
score = 4.18778
sequence = GTTATAGTTTTTGATTATACC

Gene: SGO_0310: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
 
Streptococcus mitis B6

Gene: smi_1600: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
*
Streptococcus mutans UA159

Site:
position = -188
score = 4.60062
sequence = GTTATAGATGAAAACTATAAC

Gene: SMU.873: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
*
Streptococcus pneumoniae TIGR4

Site:
position = -218
score = 4.8589
sequence = CTTATAAGAATTACTAATAAC

Gene: SP_0585: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
 
Streptococcus pyogenes M1 GAS
*
Streptococcus sanguinis SK36

Site:
position = -182
score = 4.34545
sequence = GTCATAATTTCTACCTATAGC

Gene: SSA_0416: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
*
Streptococcus suis 05ZYH33

Site:
position = -237
score = 4.33539
sequence = TTCATAGATAAAATCTATACC

Gene: SSU05_1774: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
*
Streptococcus thermophilus CNRZ1066

Site:
position = -119
score = 4.17431
sequence = GCTATACAAATATCTAATTAA

Gene: str0785: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
 
Streptococcus uberis 0140J
5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
metF
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_1367: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Lactococcus lactis subsp. lactis Il1403

Gene: L0099: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0311: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Streptococcus mitis B6

Gene: smi_1599: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_0586: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36

Gene: SSA_0417: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Streptococcus suis 05ZYH33

Gene: SSU05_1775: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Streptococcus thermophilus CNRZ1066

Gene: str0786: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Streptococcus uberis 0140J
5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
metH
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R

Gene: SAG2048: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) / Homolog of homocysteine-binding domain
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1315: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) / Homolog of homocysteine-binding domain
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159

Gene: SMU.874: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) / Homolog of homocysteine-binding domain
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) / Homolog of homocysteine-binding domain
 
CRON 13.
metB
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403

Gene: L0102: Cystathionine gamma-synthase (EC 2.5.1.48)
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
*
Streptococcus gallolyticus UCN34

Site:
position = -142
score = 5.00573
sequence = GTTATAGTTTTTACTTATAGC

Gene: GALLO_1768: Cystathionine gamma-synthase (EC 2.5.1.48)
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1636: Cystathionine gamma-synthase (EC 2.5.1.48)
 
Streptococcus mitis B6

Gene: smi_1508: Cystathionine gamma-synthase (EC 2.5.1.48)
*
Streptococcus mutans UA159

Site:
position = -110
score = 4.28317
sequence = CTTATAGTTTCTTTTTATAGC

Gene: SMU.1675: Cystathionine gamma-synthase (EC 2.5.1.48)
 
Streptococcus pneumoniae TIGR4

Gene: SP_1525: Cystathionine gamma-synthase (EC 2.5.1.48)
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36

Gene: SSA_1737: Cystathionine gamma-synthase (EC 2.5.1.48)
*
Streptococcus suis 05ZYH33

Site:
position = -120
score = 5.05408
sequence = GTTATAAAGAAAAACTATAAC

Gene: SSU05_1562: Cystathionine gamma-synthase (EC 2.5.1.48)
*
Streptococcus thermophilus CNRZ1066

Site:
position = -132
score = 4.48483
sequence = GTTATAGTAATAAACTATATC

Gene: str0352: Cystathionine gamma-synthase (EC 2.5.1.48)
 
Streptococcus uberis 0140J
Cystathionine gamma-synthase (EC 2.5.1.48)
metC
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_2187: L-cysteine desulfhydrase
 
Lactococcus lactis subsp. lactis Il1403

Gene: L177593: L-cysteine desulfhydrase
*
Streptococcus agalactiae 2603V/R

Site:
position = -152
score = 4.46656
sequence = ATGATAAATTAAAATAATAAA

Gene: SAG1587: L-cysteine desulfhydrase
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1767: L-cysteine desulfhydrase
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1635: L-cysteine desulfhydrase
 
Streptococcus mitis B6

Gene: smi_1507: L-cysteine desulfhydrase
 
Streptococcus mutans UA159

Gene: SMU.1674: L-cysteine desulfhydrase
 
Streptococcus pneumoniae TIGR4

Gene: SP_1524: L-cysteine desulfhydrase
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36

Gene: SSA_1736: L-cysteine desulfhydrase
 
Streptococcus suis 05ZYH33

Gene: SSU05_1561: L-cysteine desulfhydrase
 
Streptococcus thermophilus CNRZ1066

Gene: str0353: L-cysteine desulfhydrase
 
Streptococcus uberis 0140J

Gene: SUB0427: L-cysteine desulfhydrase
L-cysteine desulfhydrase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD