Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur - Lactobacillaceae

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 43 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactobacillus acidophilus NCFM
Lactobacillus brevis ATCC 367 5 3
Lactobacillus casei ATCC 334 6 5
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Lactobacillus fermentum IFO 3956 5 3
Lactobacillus helveticus DPC 4571
Lactobacillus johnsonii NCC 533
Lactobacillus plantarum WCFS1 7 6
Lactobacillus reuteri JCM 1112 3 2
Lactobacillus rhamnosus GG 5 4
Lactobacillus sakei subsp. sakei 23K 3 1
Lactobacillus salivarius subsp. salivarius UCC118 6 3
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 4 2
Oenococcus oeni PSU-1 4 3
Pediococcus pentosaceus ATCC 25745 4 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
zur
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367

Gene: LVIS_1778: Zinc homeostasis transcriptional regulator Zur, Fur family
*
Lactobacillus casei ATCC 334

Site:
position = -69
score = 6.48354
sequence = TTAATCGTAATCAATACGATTTA

Gene: LSEI_2025: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
*
Lactobacillus fermentum IFO 3956

Site:
position = -37
score = 5.82657
sequence = AAAAACGTAATCATTACTAAAAA

Gene: LAF_1665: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
*
Lactobacillus plantarum WCFS1

Site:
position = -56
score = 6.89101
sequence = TAAATAGTAATGATTATGATTTA

Gene: lp_0868: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Lactobacillus reuteri JCM 1112

Gene: LAR_1528: Zinc homeostasis transcriptional regulator Zur, Fur family
*
Lactobacillus rhamnosus GG

Site:
position = -70
score = 5.3752
sequence = CTAATCGTAACCAGTACGATTTG

Gene: LGG_02012: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA0109: Zinc homeostasis transcriptional regulator Zur, Fur family
*
Lactobacillus salivarius subsp. salivarius UCC118

Site:
position = -35
score = 6.56728
sequence = TAGAAAGTAAAGATTACTATTTA

Gene: LSL_1450: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0802: Zinc homeostasis transcriptional regulator Zur, Fur family
*
Oenococcus oeni PSU-1

Site:
position = -95
score = 5.39986
sequence = TTAATGGTAAATATTACTTTTAC

Site:
position = -53
score = 6.00086
sequence = TACTTAGTAATGATTACTTGTTA

Gene: OEOE_1189: Zinc homeostasis transcriptional regulator Zur, Fur family
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -36
score = 7.28434
sequence = TAAAACGTAATGATTACTATTTA

Gene: PEPE_0386: Zinc homeostasis transcriptional regulator Zur, Fur family
Zinc homeostasis transcriptional regulator Zur, Fur family
 
CRON 2.
znuA
 
Lactobacillus acidophilus NCFM
*2
Lactobacillus brevis ATCC 367

Site:
position = -46
score = 6.55558
sequence = TAAACGGTAATCATTACTGTTTA

Gene: LVIS_0470: Zinc ABC transporter, substrate-binding protein

Site:
position = -41
score = 6.84989
sequence = TAAATAGTAATAATTACCATTTA

Gene: LVIS_0566: Zinc ABC transporter, substrate-binding protein
*
Lactobacillus casei ATCC 334

Site:
position = -183
score = 6.96151
sequence = TAATTCGTAATCATTACTATTTA

Site:
position = -40
score = 6.72859
sequence = TAAATCGTAATTATTACGTTTTG

Gene: LSEI_2427: Zinc ABC transporter, substrate-binding protein
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
*
Lactobacillus fermentum IFO 3956

Site:
position = -48
score = 6.7073
sequence = TTAATCGTAAGGATTACGATTTA

Gene: LAF_0191: Zinc ABC transporter, substrate-binding protein
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
*2
Lactobacillus plantarum WCFS1

Site:
position = -44
score = 6.63799
sequence = TTAACAGTAATGGTTACGATTTA

Gene: lp_3302: Zinc ABC transporter, substrate-binding protein

Site:
position = -88
score = 6.81674
sequence = TAAAACGTAAATATTACTATTTA

Site:
position = -39
score = 7.28434
sequence = TAAAACGTAATGATTACTATTTA

Gene: lp_3018: Zinc ABC transporter, substrate-binding protein
*
Lactobacillus reuteri JCM 1112

Site:
position = -36
score = 6.75528
sequence = TAAATAGTAACGATTACGATTAA

Gene: LAR_0207: Zinc ABC transporter, substrate-binding protein
*
Lactobacillus rhamnosus GG

Site:
position = -181
score = 6.73087
sequence = TAAATCGTAATCATTACGCTTAA

Site:
position = -40
score = 6.87575
sequence = TAAATCGTAATGATTACGTTTTG

Gene: LGG_02423: Zinc ABC transporter, substrate-binding protein
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = -37
score = 6.51111
sequence = TAAAGCGTAACTATTACGATTTA

Gene: LSA0282: Zinc ABC transporter, substrate-binding protein
*
Lactobacillus salivarius subsp. salivarius UCC118

Site:
position = -40
score = 6.96151
sequence = TAAAAAGTAATGATTACTATATA

Gene: LSL_1587: Zinc ABC transporter, substrate-binding protein
*2
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Site:
position = -171
score = 6.21331
sequence = TTTAAAGTAATCATTACTTTTTG

Site:
position = -142
score = 6.18857
sequence = TTAATAGTAATGATTACTATAAT

Gene: LEUM_0803: Zinc ABC transporter, substrate-binding protein

Gene: LEUM_1611: Zinc ABC transporter, substrate-binding protein
*
Oenococcus oeni PSU-1

Site:
position = -76
score = 5.5295
sequence = GTAAAAGTAATATTTACCATTAA

Site:
position = -118
score = 6.01278
sequence = TAACAAGTAATCATTACTAAGTA

Gene: OEOE_1188: Zinc ABC transporter, substrate-binding protein
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -33
score = 6.92786
sequence = TAAATAGTAATTATTACTCTTTA

Gene: PEPE_0289: Zinc ABC transporter, substrate-binding protein
Zinc ABC transporter, substrate-binding protein
znuC
 
Lactobacillus acidophilus NCFM

Gene: LBA1772: Zinc ABC transporter, ATP-binding protein
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0471: Zinc ABC transporter, ATP-binding protein
*
Lactobacillus casei ATCC 334

Site:
position = -39
score = 6.38872
sequence = TAAACCGTAATCGTTACCGTTTA

Gene: LSEI_0242: Zinc ABC transporter, ATP-binding protein
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_1884: Zinc ABC transporter, ATP-binding protein
 
Lactobacillus fermentum IFO 3956

Gene: LAF_0192: Zinc ABC transporter, ATP-binding protein
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533

Gene: LJ0578: Zinc ABC transporter, ATP-binding protein
*
Lactobacillus plantarum WCFS1

Site:
position = -51
score = 6.85012
sequence = AAAATAGTAATCATTACGATTTA

Gene: lp_0463: Zinc ABC transporter, ATP-binding protein
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0208: Zinc ABC transporter, ATP-binding protein
*
Lactobacillus rhamnosus GG

Site:
position = -39
score = 6.35616
sequence = TAAATCGTAATCGTTACCGTTTG

Gene: LGG_00285: Zinc ABC transporter, ATP-binding protein
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA0283: Zinc ABC transporter, ATP-binding protein
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1586: Zinc ABC transporter, ATP-binding protein
 2
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0804: Zinc ABC transporter, ATP-binding protein

Gene: LEUM_1610: Zinc ABC transporter, ATP-binding protein
 
Oenococcus oeni PSU-1

Gene: OEOE_1187: Zinc ABC transporter, ATP-binding protein
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0290: Zinc ABC transporter, ATP-binding protein
Zinc ABC transporter, ATP-binding protein
znuB
 
Lactobacillus acidophilus NCFM

Gene: LBA1771: Zinc ABC transporter, permease protein
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0472: Zinc ABC transporter, permease protein
 
Lactobacillus casei ATCC 334

Gene: LSEI_0243: Zinc ABC transporter, permease protein
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_1883: Zinc ABC transporter, permease protein
 
Lactobacillus fermentum IFO 3956

Gene: LAF_0193: Zinc ABC transporter, permease protein
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533

Gene: LJ0579: Zinc ABC transporter, permease protein
 
Lactobacillus plantarum WCFS1

Gene: lp_0464: Zinc ABC transporter, permease protein
*
Lactobacillus reuteri JCM 1112

Site:
position = -9
score = 5.32352
sequence = TAAAAAGTAATGTTAACTTTAAG

Gene: LAR_0209: Zinc ABC transporter, permease protein
 
Lactobacillus rhamnosus GG

Gene: LGG_00286: Zinc ABC transporter, permease protein
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA0284: Zinc ABC transporter, permease protein
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1585: Zinc ABC transporter, permease protein
 2
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_1609: Zinc ABC transporter, permease protein

Gene: LEUM_0805: Zinc ABC transporter, permease protein
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0291: Zinc ABC transporter, permease protein
Zinc ABC transporter, permease protein
 
CRON 3.
rpsN2
 
Lactobacillus acidophilus NCFM
*
Lactobacillus brevis ATCC 367

Site:
position = -37
score = 5.92368
sequence = TAAAGCGTAATAATTACTATCAA

Gene: LVIS_0360: Small subunit ribosomal protein S14, zinc-independent
*2
Lactobacillus casei ATCC 334

Site:
position = -248
score = 6.89799
sequence = TAAATAGTAATGATTACGAATTA

Gene: LSEI_2425: Small subunit ribosomal protein S14, zinc-independent

Gene: LSEI_0910: Small subunit ribosomal protein S14, zinc-independent
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
*
Lactobacillus fermentum IFO 3956

Site:
position = -82
score = 6.49412
sequence = TAAATGGTAATAATTACTATTTG

Gene: LAF_1127: Small subunit ribosomal protein S14, zinc-independent
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533

Gene: LJ0166: Small subunit ribosomal protein S14, zinc-independent
*
Lactobacillus plantarum WCFS1

Site:
position = -125
score = 5.58235
sequence = AAAATAGTAGCTGTTACGATTTA

Gene: lp_2216: Small subunit ribosomal protein S14, zinc-independent
 
Lactobacillus reuteri JCM 1112

Gene: LAR_1024: Small subunit ribosomal protein S14, zinc-independent
*2
Lactobacillus rhamnosus GG

Site:
position = -243
score = 6.77833
sequence = TTAAGCGTAATGATTACGATTTA

Gene: LGG_02422: Small subunit ribosomal protein S14, zinc-independent

Gene: LGG_00873: Small subunit ribosomal protein S14, zinc-independent
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA0266: Small subunit ribosomal protein S14, zinc-independent
*
Lactobacillus salivarius subsp. salivarius UCC118

Site:
position = -42
score = 7.2976
sequence = TAAAAAGTAATGATTACTATTTA

Site:
position = -63
score = 5.72721
sequence = TAAATCGTAATTGATATCATTTA

Gene: LSL_1944: Small subunit ribosomal protein S14, zinc-independent
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_1360: Small subunit ribosomal protein S14, zinc-independent
 
Oenococcus oeni PSU-1

Gene: OEOE_1030: Small subunit ribosomal protein S14, zinc-independent
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0222: Small subunit ribosomal protein S14, zinc-independent
Small subunit ribosomal protein S14, zinc-independent
lp_0947
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
*
Lactobacillus casei ATCC 334

Site:
position = -183
score = 6.37437
sequence = CAAAACGTAATAATTACGATTTA

Site:
position = -40
score = 6.89799
sequence = TAAATAGTAATGATTACGAATTA

Gene: LSEI_2426: Conserved hypothetical protein
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
*
Lactobacillus plantarum WCFS1

Site:
position = -36
score = 6.72556
sequence = TAAATGGTAATAATTACTATTTA

Gene: lp_0947: Conserved hypothetical protein
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1943: Conserved hypothetical protein
*
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Site:
position = -65
score = 6.079
sequence = TAAATAGTAATAATTACTATAAT

Site:
position = -43
score = 6.67214
sequence = TTAAAAGTAATTGTTACTATTTA

Gene: LEUM_0082: Conserved hypothetical protein
*
Oenococcus oeni PSU-1

Site:
position = -42
score = 6.6146
sequence = TAAATAGTAATAATTACTTTTAA

Gene: OEOE_0084: Conserved hypothetical protein
 
Pediococcus pentosaceus ATCC 25745
Conserved hypothetical protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD