Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RbsR2 - Streptococcaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactococcus lactis subsp. cremoris SK11 4 1
Lactococcus lactis subsp. lactis Il1403 6 1
Streptococcus agalactiae 2603V/R 6 1
Streptococcus dysgalactiae subsp. equisimilis GGS_124 5 1
Streptococcus equi subsp. zooepidemicus MGCS10565 6 1
Streptococcus gallolyticus UCN34
Streptococcus gordonii str. Challis substr. CH1
Streptococcus mitis B6
Streptococcus mutans UA159
Streptococcus pneumoniae TIGR4
Streptococcus pyogenes M1 GAS 1 1
Streptococcus sanguinis SK36
Streptococcus suis 05ZYH33
Streptococcus thermophilus CNRZ1066
Streptococcus uberis 0140J 6 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rbsR2
*
Lactococcus lactis subsp. cremoris SK11

Site:
position = -66
score = 6.02234
sequence = AAATGAAAACGGATACAATC

Gene: LACR_1803: Transcriptional repressor of ribose utilization RbsR2, LacI family
*
Lactococcus lactis subsp. lactis Il1403

Site:
position = -66
score = 6.20633
sequence = TAATGAAAACGGATACAATT

Gene: L0145: Transcriptional repressor of ribose utilization RbsR2, LacI family
*
Streptococcus agalactiae 2603V/R

Site:
position = -38
score = 5.37924
sequence = TTGTGAAACCGTTTCCACAA

Gene: SAG0119: Transcriptional repressor of ribose utilization RbsR2, LacI family
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -67
score = 6.04811
sequence = AAAAGAAAACGGTTACAACA

Site:
position = -43
score = 5.40656
sequence = ACGTGAGAACGGTTCCACAA

Gene: SDEG_1537: Transcriptional repressor of ribose utilization RbsR2, LacI family
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -62
score = 6.27021
sequence = TTTAGAAAACGGTTACAATA

Site:
position = -39
score = 5.5586
sequence = ACATGAGAACGGTTCCACAA

Gene: Sez_0468: Transcriptional repressor of ribose utilization RbsR2, LacI family
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
*
Streptococcus pyogenes M1 GAS

Site:
position = -367
score = 3.69238
sequence = CATAAAAAACGGTTGAACCA

Gene: SPy1535: Transcriptional repressor of ribose utilization RbsR2, LacI family
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
*
Streptococcus uberis 0140J

Site:
position = -47
score = 6.67471
sequence = TAAAGAAAACGGTTACAATA

Gene: SUB1312: Transcriptional repressor of ribose utilization RbsR2, LacI family
Transcriptional repressor of ribose utilization RbsR2, LacI family
rbsK
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_1802: Ribokinase (EC 2.7.1.15)
 
Lactococcus lactis subsp. lactis Il1403

Gene: L86157: Ribokinase (EC 2.7.1.15)
 
Streptococcus agalactiae 2603V/R

Gene: SAG0118: Ribokinase (EC 2.7.1.15)
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1536: Ribokinase (EC 2.7.1.15)
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_0469: Ribokinase (EC 2.7.1.15)
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB1311: Ribokinase (EC 2.7.1.15)
Ribokinase (EC 2.7.1.15)
rbsD
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_1801: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Lactococcus lactis subsp. lactis Il1403

Gene: L85737: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Streptococcus agalactiae 2603V/R

Gene: SAG0117: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1535: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_0470: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB1310: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsA
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_1800: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Lactococcus lactis subsp. lactis Il1403

Gene: L84240: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Streptococcus agalactiae 2603V/R

Gene: SAG0116: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1534: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_0471: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB1309: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
rbsC
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403

Gene: L83296: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Streptococcus agalactiae 2603V/R

Gene: SAG0115: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_0472: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB1308: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
rbsB
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403

Gene: L82310: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Streptococcus agalactiae 2603V/R

Gene: SAG0114: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1533: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_0473: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB1307: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD