Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Lactobacillaceae

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 69 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactobacillus acidophilus NCFM 10 6
Lactobacillus brevis ATCC 367 7 3
Lactobacillus casei ATCC 334 9 5
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 9 5
Lactobacillus fermentum IFO 3956 8 4
Lactobacillus helveticus DPC 4571 6 5
Lactobacillus johnsonii NCC 533 10 6
Lactobacillus plantarum WCFS1 7 3
Lactobacillus reuteri JCM 1112 8 4
Lactobacillus rhamnosus GG 9 5
Lactobacillus sakei subsp. sakei 23K 8 4
Lactobacillus salivarius subsp. salivarius UCC118 6 2
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 8 4
Oenococcus oeni PSU-1
Pediococcus pentosaceus ATCC 25745 7 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
groS
*
Lactobacillus acidophilus NCFM

Site:
position = -159
score = 7.57035
sequence = TTAGCACTTTTTTATAAAGAGTGCTAA

Site:
position = -84
score = 6.77276
sequence = TTAGCACTTAACTAAAAGGAGTGCTAA

Gene: LBA0405: Heat shock protein 60 family co-chaperone GroES
*
Lactobacillus brevis ATCC 367

Site:
position = -62
score = 6.38314
sequence = TTAGCACTTATGTTAGTCAAGTGCTAA

Gene: LVIS_0617: Heat shock protein 60 family co-chaperone GroES
*
Lactobacillus casei ATCC 334

Site:
position = -56
score = 6.69177
sequence = TTAGCACTTAGACATAACGAGTGCTAA

Gene: LSEI_2239: Heat shock protein 60 family co-chaperone GroES
*
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Site:
position = -140
score = 6.47748
sequence = TTAGCACTCTCGACTAAAAAGTGCTAT

Site:
position = -65
score = 6.74171
sequence = TTAGCACTTGATCAAGATGAGTGCTAA

Gene: LBUL_1497: Heat shock protein 60 family co-chaperone GroES
*
Lactobacillus fermentum IFO 3956

Site:
position = -87
score = 5.68261
sequence = TTAGCACTTGAGGGGGTTGAGTGCTAG

Gene: LAF_0325: Heat shock protein 60 family co-chaperone GroES
*
Lactobacillus helveticus DPC 4571

Site:
position = -159
score = 6.93654
sequence = TTAGCACTATTTGTAAAAAAGTGCTAA

Site:
position = -85
score = 7.10963
sequence = TTAGCACTTAAGAAATAAGAGTGCTAA

Gene: lhv_0425: Heat shock protein 60 family co-chaperone GroES
*
Lactobacillus johnsonii NCC 533

Site:
position = -70
score = 6.99581
sequence = TTAGCACTTATAATATATGAGTGCTAA

Site:
position = -155
score = 6.90348
sequence = TTAGCACTCTGATGATAAAAGTGCTAA

Gene: LJ0460: Heat shock protein 60 family co-chaperone GroES
*
Lactobacillus plantarum WCFS1

Site:
position = -51
score = 6.44742
sequence = TTAGCACTTGAGGTTGAGGAGTGCTAA

Gene: lp_0727: Heat shock protein 60 family co-chaperone GroES
*
Lactobacillus reuteri JCM 1112

Site:
position = -61
score = 6.54297
sequence = TTAGCACTTGAAGAGTTTGAGTGCTAA

Gene: LAR_0342: Heat shock protein 60 family co-chaperone GroES
*
Lactobacillus rhamnosus GG

Site:
position = -56
score = 6.58813
sequence = TTAGCACTTAGACACAACGAGTGCTAA

Gene: LGG_02240: Heat shock protein 60 family co-chaperone GroES
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = -55
score = 6.80435
sequence = TTAGCACTTGAGTGTTTAGAGTGCTAA

Gene: LSA0358: Heat shock protein 60 family co-chaperone GroES
*
Lactobacillus salivarius subsp. salivarius UCC118

Site:
position = -61
score = 7.04627
sequence = TTAGCACTCAAGAGTTGAGAGTGCTAA

Site:
position = -135
score = 6.44129
sequence = TTAGCACTCTAATGTGTCGAGTGATAA

Gene: LSL_1212: Heat shock protein 60 family co-chaperone GroES
*
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Site:
position = -54
score = 7.52017
sequence = TTAGCACTCACGTTTAAAGAGTGCTAA

Gene: LEUM_1763: Heat shock protein 60 family co-chaperone GroES
 
Oenococcus oeni PSU-1

Gene: OEOE_1397: Heat shock protein 60 family co-chaperone GroES
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -65
score = 6.34116
sequence = TTAGCACTTAGAGATGACGAGTGCTAA

Gene: PEPE_0420: Heat shock protein 60 family co-chaperone GroES
Heat shock protein 60 family co-chaperone GroES
groL
 
Lactobacillus acidophilus NCFM

Gene: LBA0406: Heat shock protein 60 family chaperone GroEL
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0618: Heat shock protein 60 family chaperone GroEL
 
Lactobacillus casei ATCC 334

Gene: LSEI_2238: Heat shock protein 60 family chaperone GroEL
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_1496: Heat shock protein 60 family chaperone GroEL
 
Lactobacillus fermentum IFO 3956

Gene: LAF_0326: Heat shock protein 60 family chaperone GroEL
 
Lactobacillus helveticus DPC 4571

Gene: lhv_0426: Heat shock protein 60 family chaperone GroEL
 
Lactobacillus johnsonii NCC 533

Gene: LJ0461: Heat shock protein 60 family chaperone GroEL
 
Lactobacillus plantarum WCFS1

Gene: lp_0728: Heat shock protein 60 family chaperone GroEL
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0343: Heat shock protein 60 family chaperone GroEL
 
Lactobacillus rhamnosus GG

Gene: LGG_02239: Heat shock protein 60 family chaperone GroEL
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA0359: Heat shock protein 60 family chaperone GroEL
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1211: Heat shock protein 60 family chaperone GroEL
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_1762: Heat shock protein 60 family chaperone GroEL
 
Oenococcus oeni PSU-1

Gene: OEOE_1396: Heat shock protein 60 family chaperone GroEL
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0421: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
 
CRON 2.
clpL
*
Lactobacillus acidophilus NCFM

Site:
position = -70
score = 6.79138
sequence = TTAGCACTTGACTACCAAGAGTGCTAA

Gene: LBA0638: ATP-dependent Clp protease, ATP-binding subunit
*
Lactobacillus brevis ATCC 367

Site:
position = -205
score = 6.39825
sequence = TTAGCATTCTATTGACGAGAGTGCTAG

Gene: LVIS_1554: ATP-dependent Clp protease, ATP-binding subunit
*
Lactobacillus casei ATCC 334

Site:
position = -257
score = 5.94618
sequence = TTAGCACTCTTAGTGGCAGAGTGCTTG

Gene: LSEI_1762: ATP-dependent Clp protease, ATP-binding subunit
*
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Site:
position = -201
score = 6.86013
sequence = TTAGCACTTGACTAACTAGAGTGCTAA

Gene: LBUL_0510: ATP-dependent Clp protease, ATP-binding subunit
*
Lactobacillus fermentum IFO 3956

Site:
position = -190
score = 5.61671
sequence = TTAGCATTAGTTGCCAATCAGTGCTAA

Gene: LAF_1388: ATP-dependent Clp protease, ATP-binding subunit
*
Lactobacillus helveticus DPC 4571

Site:
position = -71
score = 6.73825
sequence = TTAGCACTTGACTACTAAGAGTGCTAA

Gene: lhv_0683: ATP-dependent Clp protease, ATP-binding subunit
*
Lactobacillus johnsonii NCC 533

Site:
position = -70
score = 7.62086
sequence = TTAGCACTCATATATCAAGAGTGCTAA

Gene: LJ0815: ATP-dependent Clp protease, ATP-binding subunit
 
Lactobacillus plantarum WCFS1

Gene: lp_1269: ATP-dependent Clp protease, ATP-binding subunit
*
Lactobacillus reuteri JCM 1112

Site:
position = -211
score = 6.88088
sequence = TTAGCATTCATGGCTAAAGAGTGCTAA

Gene: LAR_1257: ATP-dependent Clp protease, ATP-binding subunit
*
Lactobacillus rhamnosus GG

Site:
position = -128
score = 6.21242
sequence = TTAGCACTCTTGCGGTTAGAGTGCTTG

Gene: LGG_01823: ATP-dependent Clp protease, ATP-binding subunit
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA1465: ATP-dependent Clp protease, ATP-binding subunit
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_0386: ATP-dependent Clp protease, ATP-binding subunit
*
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Site:
position = -151
score = 7.56854
sequence = TTAGCACTCTACTTTAAAGAGTGCTAA

Gene: LEUM_0571: ATP-dependent Clp protease, ATP-binding subunit
 
Oenococcus oeni PSU-1

Gene: OEOE_0640: ATP-dependent Clp protease, ATP-binding subunit
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0607: ATP-dependent Clp protease, ATP-binding subunit
ATP-dependent Clp protease, ATP-binding subunit
 
CRON 3.
hsp
*
Lactobacillus acidophilus NCFM

Site:
position = -126
score = 7.14589
sequence = TTAGCACTAAATATTAAAGAGTGCTAA

Gene: LBA0205: Small heat shock protein
 
Lactobacillus brevis ATCC 367
*
Lactobacillus casei ATCC 334

Site:
position = -97
score = 6.68345
sequence = TTAGCACTCGACGTTTGCGAGTGCTAA

Gene: LSEI_2800: Small heat shock protein
*
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Site:
position = -154
score = 6.02903
sequence = TTAGCAGTCAAAAAAGCTGAATGCTAA

Gene: LBUL_0243: Small heat shock protein
 
Lactobacillus fermentum IFO 3956

Gene: LAF_1369: Small heat shock protein
*
Lactobacillus helveticus DPC 4571

Site:
position = -130
score = 6.10771
sequence = TTAGCACTATATGCTTTTGAATGCTAA

Gene: lhv_0222: Small heat shock protein
*
Lactobacillus johnsonii NCC 533

Site:
position = -78
score = 5.89737
sequence = TTAGCACCGTTCTAATTAGTGTGCTAA

Gene: LJ0181: Small heat shock protein
*
Lactobacillus plantarum WCFS1

Site:
position = -149
score = 7.51584
sequence = TTAGCACTCGAGTTAAACGAGTGCTAA

Gene: lp_0129: Small heat shock protein
 
Lactobacillus reuteri JCM 1112

Gene: LAR_1239: Small heat shock protein
*
Lactobacillus rhamnosus GG

Site:
position = -97
score = 7.12193
sequence = TTAGCACTCTAACATGACGAGTGCTAA

Gene: LGG_02804: Small heat shock protein
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = -96
score = 7.72943
sequence = TTAGCACTCGTGATAAAAGAGTGCTAA

Gene: LSA0050: Small heat shock protein
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1

Gene: OEOE_0289: Small heat shock protein
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_1643: Small heat shock protein
Small heat shock protein
 
CRON 4.
clpP
*
Lactobacillus acidophilus NCFM

Site:
position = -59
score = 6.14018
sequence = TTAGCACAGTACTTGTATGAGTGCTAA

Gene: LBA0694: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0654: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
*
Lactobacillus casei ATCC 334

Site:
position = -51
score = 6.90671
sequence = TTAGCACTGTACTTTTAAGAGTGCTAA

Gene: LSEI_0963: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
*
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Site:
position = -49
score = 7.12972
sequence = TTAGCACTGTATCTAAATGAGTGCTAA

Gene: LBUL_0559: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
*
Lactobacillus fermentum IFO 3956

Site:
position = -44
score = 5.54311
sequence = TTAGCAAACAGTACTAACTAGTGCTAA

Gene: LAF_0360: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
*
Lactobacillus helveticus DPC 4571

Site:
position = -60
score = 6.56372
sequence = TTAGCACAGTACTTAAAAGAGTGCTAA

Gene: lhv_0735: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
*
Lactobacillus johnsonii NCC 533

Site:
position = -49
score = 6.87183
sequence = TTAGCACTGTACTTATTAGAGTGCTAA

Gene: LJ0869: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
 
Lactobacillus plantarum WCFS1

Gene: lp_0786: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
*
Lactobacillus reuteri JCM 1112

Site:
position = -47
score = 5.75988
sequence = TTAGCATATAAGACTAACGAGTGCTAA

Gene: LAR_0379: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
*
Lactobacillus rhamnosus GG

Site:
position = -54
score = 7.03837
sequence = TTAGCACTGTACTTTAAAGAGTGCTAA

Gene: LGG_00931: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA0531: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1168: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
*
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Site:
position = -81
score = 6.36407
sequence = TTAGCACTCTCGTCTCTAATGTGCTAA

Gene: LEUM_0396: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
 
Oenococcus oeni PSU-1

Gene: OEOE_0570: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0455: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
 
CRON 5.
clpC
*
Lactobacillus acidophilus NCFM

Site:
position = -57
score = 6.94857
sequence = TTAGCACTCAACGCACTAGAGTGCTAA

Gene: LBA1910: ATP-dependent Clp protease ATP-binding subunit ClpA
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_2048: ATP-dependent Clp protease ATP-binding subunit ClpA
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_1944: ATP-dependent Clp protease ATP-binding subunit ClpA
 
Lactobacillus fermentum IFO 3956

Gene: LAF_0033: ATP-dependent Clp protease ATP-binding subunit ClpA
*
Lactobacillus helveticus DPC 4571

Site:
position = -59
score = 5.91198
sequence = TTAGCACTTGAAGGCTTTAAGTGCTAA

Gene: lhv_2043: ATP-dependent Clp protease ATP-binding subunit ClpA
*
Lactobacillus johnsonii NCC 533

Site:
position = -58
score = 6.7485
sequence = TTAGCACTTATAACTTATGAGTGCTAA

Gene: LJ1775: ATP-dependent Clp protease ATP-binding subunit ClpA
 
Lactobacillus plantarum WCFS1

Gene: lp_3583: ATP-dependent Clp protease ATP-binding subunit ClpA
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0043: ATP-dependent Clp protease ATP-binding subunit ClpA
 
Lactobacillus rhamnosus GG

Gene: LGG_02035: ATP-dependent Clp protease ATP-binding subunit ClpA
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = -121
score = 5.92811
sequence = GTGGCACTTTTCTTGCTAGAGTGCTAA

Gene: LSA0207: ATP-dependent Clp protease ATP-binding subunit ClpA
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_0059: ATP-dependent Clp protease ATP-binding subunit ClpA
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0150: ATP-dependent Clp protease ATP-binding subunit ClpA
 
Oenococcus oeni PSU-1

Gene: OEOE_0572: ATP-dependent Clp protease ATP-binding subunit ClpA
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -122
score = 6.93594
sequence = TTAGCACTTTACTTAACAGAGTGCTAA

Gene: PEPE_0976: ATP-dependent Clp protease ATP-binding subunit ClpA
ATP-dependent Clp protease ATP-binding subunit ClpA
 
CRON 6.
hrcA
*
Lactobacillus acidophilus NCFM

Site:
position = -93
score = 6.11494
sequence = TTAGCACTCAGGTTGCATTATTGCTAA

Site:
position = -45
score = 6.05514
sequence = TTAGCACCTGATAGATGTGAGTGCTAA

Gene: LBA1249: Heat shock response transcriptional regulator HrcA, HrcA family
*
Lactobacillus brevis ATCC 367

Site:
position = -43
score = 6.85471
sequence = TTAGCACTTGTGTTGTTTGAGTGCTAA

Site:
position = -127
score = 6.12175
sequence = TTAGCACTTAATTACGTTGATTGCTAA

Gene: LVIS_1331: Heat shock response transcriptional regulator HrcA, HrcA family
*
Lactobacillus casei ATCC 334

Site:
position = -42
score = 7.58073
sequence = TTAGCACTCATATAAAACGAGTGCTAA

Gene: LSEI_1567: Heat shock response transcriptional regulator HrcA, HrcA family
*
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Site:
position = -92
score = 5.68638
sequence = TTAGCATTCTCCTTGACTAACTGCTAA

Gene: LBUL_1229: Heat shock response transcriptional regulator HrcA, HrcA family
*
Lactobacillus fermentum IFO 3956

Site:
position = -33
score = 6.38838
sequence = TTAGCACTTAGATGGCCAGAGTGCTAA

Gene: LAF_0749: Heat shock response transcriptional regulator HrcA, HrcA family
 
Lactobacillus helveticus DPC 4571
*
Lactobacillus johnsonii NCC 533

Site:
position = -91
score = 6.37663
sequence = TTAGCACTCTACTTGAACAATTGCTAA

Site:
position = -43
score = 6.26953
sequence = TTAGCACAGAAGAAAGAAGAGTGCTAA

Gene: LJ1481: Heat shock response transcriptional regulator HrcA, HrcA family
*
Lactobacillus plantarum WCFS1

Site:
position = -191
score = 7.14508
sequence = TTAGCACTCGTAAGTAAGGAGTGCTAA

Site:
position = -36
score = 6.67783
sequence = TTAGCACTCCATTAAGTTAAGTGCTAA

Gene: lp_2029: Heat shock response transcriptional regulator HrcA, HrcA family
*
Lactobacillus reuteri JCM 1112

Site:
position = -45
score = 6.49439
sequence = TTAGCACTTGACCCTAATGAGTGCTAA

Gene: LAR_0677: Heat shock response transcriptional regulator HrcA, HrcA family
*
Lactobacillus rhamnosus GG

Site:
position = -42
score = 7.61077
sequence = TTAGCACTCGTGTAAAACGAGTGCTAA

Gene: LGG_01606: Heat shock response transcriptional regulator HrcA, HrcA family
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = -41
score = 6.98636
sequence = TTAGCACTCGTAATAATCAAGTGCTAA

Gene: LSA1238: Heat shock response transcriptional regulator HrcA, HrcA family
*
Lactobacillus salivarius subsp. salivarius UCC118

Site:
position = -41
score = 6.58277
sequence = TTAGCACTCTAATGTGTTAAGTGCTAA

Gene: LSL_0576: Heat shock response transcriptional regulator HrcA, HrcA family
*
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Site:
position = -41
score = 6.31919
sequence = TTAGCAGTTAGATATAGTGAGTGCTAA

Site:
position = -110
score = 7.38035
sequence = TTGGCACTCTTATAAAAAGAGTGCTAA

Gene: LEUM_1349: Heat shock response transcriptional regulator HrcA, HrcA family
 
Oenococcus oeni PSU-1
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -41
score = 6.35998
sequence = TTAGCACTCCAACTTTCTAAGTGCTAA

Gene: PEPE_0894: Heat shock response transcriptional regulator HrcA, HrcA family
Heat shock response transcriptional regulator HrcA, HrcA family
grpE
 
Lactobacillus acidophilus NCFM

Gene: LBA1248: Heat shock protein GrpE
 
Lactobacillus brevis ATCC 367

Gene: LVIS_1330: Heat shock protein GrpE
 
Lactobacillus casei ATCC 334

Gene: LSEI_1566: Heat shock protein GrpE
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_1228: Heat shock protein GrpE
 
Lactobacillus fermentum IFO 3956

Gene: LAF_0750: Heat shock protein GrpE
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533

Gene: LJ1480: Heat shock protein GrpE
 
Lactobacillus plantarum WCFS1

Gene: lp_2028: Heat shock protein GrpE
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0678: Heat shock protein GrpE
 
Lactobacillus rhamnosus GG

Gene: LGG_01605: Heat shock protein GrpE
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA1237: Heat shock protein GrpE
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_0577: Heat shock protein GrpE
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_1348: Heat shock protein GrpE
 
Oenococcus oeni PSU-1

Gene: OEOE_1310: Heat shock protein GrpE
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0895: Heat shock protein GrpE
Heat shock protein GrpE
dnaK
 
Lactobacillus acidophilus NCFM

Gene: LBA1247: Chaperone protein DnaK
 
Lactobacillus brevis ATCC 367

Gene: LVIS_1329: Chaperone protein DnaK
 
Lactobacillus casei ATCC 334

Gene: LSEI_1565: Chaperone protein DnaK
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_1227: Chaperone protein DnaK
 
Lactobacillus fermentum IFO 3956

Gene: LAF_0751: Chaperone protein DnaK
 
Lactobacillus helveticus DPC 4571

Gene: lhv_1336: Chaperone protein DnaK
 
Lactobacillus johnsonii NCC 533

Gene: LJ1479: Chaperone protein DnaK
 
Lactobacillus plantarum WCFS1

Gene: lp_2027: Chaperone protein DnaK
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0679: Chaperone protein DnaK
 
Lactobacillus rhamnosus GG

Gene: LGG_01604: Chaperone protein DnaK
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA1236: Chaperone protein DnaK
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_0578: Chaperone protein DnaK
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_1347: Chaperone protein DnaK
 
Oenococcus oeni PSU-1

Gene: OEOE_1309: Chaperone protein DnaK
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0896: Chaperone protein DnaK
Chaperone protein DnaK
dnaJ
 
Lactobacillus acidophilus NCFM

Gene: LBA1246: Chaperone protein DnaJ
 
Lactobacillus brevis ATCC 367

Gene: LVIS_1328: Chaperone protein DnaJ
 
Lactobacillus casei ATCC 334

Gene: LSEI_1563: Chaperone protein DnaJ
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_1226: Chaperone protein DnaJ
 
Lactobacillus fermentum IFO 3956

Gene: LAF_0752: Chaperone protein DnaJ
 
Lactobacillus helveticus DPC 4571

Gene: lhv_1335: Chaperone protein DnaJ
 
Lactobacillus johnsonii NCC 533

Gene: LJ1478: Chaperone protein DnaJ
 
Lactobacillus plantarum WCFS1

Gene: lp_2026: Chaperone protein DnaJ
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0680: Chaperone protein DnaJ
 
Lactobacillus rhamnosus GG

Gene: LGG_01603: Chaperone protein DnaJ
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA1235: Chaperone protein DnaJ
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_0579: Chaperone protein DnaJ
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_1346: Chaperone protein DnaJ
 
Oenococcus oeni PSU-1

Gene: OEOE_1308: Chaperone protein DnaJ
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0897: Chaperone protein DnaJ
Chaperone protein DnaJ
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD