Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RegR - Streptococcaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Hyaluronate utilization
Effector: Hyaluronate oligosaccharide phosphate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 27 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactococcus lactis subsp. cremoris SK11
Lactococcus lactis subsp. lactis Il1403
Streptococcus agalactiae 2603V/R 12 3
Streptococcus dysgalactiae subsp. equisimilis GGS_124 6 2
Streptococcus equi subsp. zooepidemicus MGCS10565 10 2
Streptococcus gallolyticus UCN34
Streptococcus gordonii str. Challis substr. CH1
Streptococcus mitis B6
Streptococcus mutans UA159
Streptococcus pneumoniae TIGR4 15 3
Streptococcus pyogenes M1 GAS 12 3
Streptococcus sanguinis SK36
Streptococcus suis 05ZYH33 14 2
Streptococcus thermophilus CNRZ1066
Streptococcus uberis 0140J
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
hylD
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
*
Streptococcus agalactiae 2603V/R

Site:
position = -32
score = 5.12804
sequence = AAAGTAAACCGGTAAACTCA

Site:
position = -251
score = 5.09009
sequence = GAAGTAAACCTGTTTACATG

Site:
position = -222
score = 5.85934
sequence = AAAGTAAACCGGTTTTGTCA

Gene: SAG1902: PTS system, hyaluronate-oligosaccharide-specific IIA component (EC 2.7.1.69)
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -33
score = 5.3494
sequence = TAAGTAAACCGGTAAACTAA

Site:
position = -280
score = 5.11186
sequence = AAAGTAAACTAGTTTTGTCA

Gene: SDEG_0648: PTS system, hyaluronate-oligosaccharide-specific IIA component (EC 2.7.1.69)
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -281
score = 6.0807
sequence = TAAGTAAACCTGTTTACCAA

Site:
position = -33
score = 5.3494
sequence = TAAGTAAACCGGTAAACTAA

Gene: Sez_1304: PTS system, hyaluronate-oligosaccharide-specific IIA component (EC 2.7.1.69)
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
*
Streptococcus pneumoniae TIGR4

Site:
position = -219
score = 5.62835
sequence = CTAGTAAACCGGTTTTGTCA

Site:
position = -37
score = 5.03919
sequence = AAAGTAAACCGGTAAACCTA

Gene: SP_0321: PTS system, hyaluronate-oligosaccharide-specific IIA component (EC 2.7.1.69)
*
Streptococcus pyogenes M1 GAS

Site:
position = -33
score = 4.6043
sequence = TGAGTAAACCGGTAAACCGA

Site:
position = -281
score = 5.11186
sequence = AAAGTAAACTAGTTTTGTCA

Gene: SPy0634: PTS system, hyaluronate-oligosaccharide-specific IIA component (EC 2.7.1.69)
 
Streptococcus sanguinis SK36
*
Streptococcus suis 05ZYH33

Site:
position = -33
score = 4.91289
sequence = TAGGTAAACCGGTAAAGTTA

Gene: SSU05_1221: PTS system, hyaluronate-oligosaccharide-specific IIA component (EC 2.7.1.69)
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
PTS system, hyaluronate-oligosaccharide-specific IIA component (EC 2.7.1.69)
ugl
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R

Gene: SAG1901: Unsaturated glucuronyl hydrolase (EC 3.2.1.-)
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_0647: Unsaturated glucuronyl hydrolase (EC 3.2.1.-)
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1305: Unsaturated glucuronyl hydrolase (EC 3.2.1.-)
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_0322: Unsaturated glucuronyl hydrolase (EC 3.2.1.-)
 
Streptococcus pyogenes M1 GAS

Gene: SPy0632: Unsaturated glucuronyl hydrolase (EC 3.2.1.-)
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33

Gene: SSU05_1220: Unsaturated glucuronyl hydrolase (EC 3.2.1.-)
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Unsaturated glucuronyl hydrolase (EC 3.2.1.-)
hylE
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R

Gene: SAG1900: PTS system, hyaluronate-oligosaccharide-specific IIB component (EC 2.7.1.69)
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_0646: PTS system, hyaluronate-oligosaccharide-specific IIB component (EC 2.7.1.69)
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1306: PTS system, hyaluronate-oligosaccharide-specific IIB component (EC 2.7.1.69)
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_0323: PTS system, hyaluronate-oligosaccharide-specific IIB component (EC 2.7.1.69)
 
Streptococcus pyogenes M1 GAS

Gene: SPy0631: PTS system, hyaluronate-oligosaccharide-specific IIB component (EC 2.7.1.69)
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33

Gene: SSU05_1219: PTS system, hyaluronate-oligosaccharide-specific IIB component (EC 2.7.1.69)
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
PTS system, hyaluronate-oligosaccharide-specific IIB component (EC 2.7.1.69)
hylF
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R

Gene: SAG1899: PTS system, hyaluronate-oligosaccharide-specific IIC component (EC 2.7.1.69)
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_0645: PTS system, hyaluronate-oligosaccharide-specific IIC component (EC 2.7.1.69)
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1307: PTS system, hyaluronate-oligosaccharide-specific IIC component (EC 2.7.1.69)
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_0324: PTS system, hyaluronate-oligosaccharide-specific IIC component (EC 2.7.1.69)
 
Streptococcus pyogenes M1 GAS

Gene: SPy0630: PTS system, hyaluronate-oligosaccharide-specific IIC component (EC 2.7.1.69)
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33

Gene: SSU05_1218: PTS system, hyaluronate-oligosaccharide-specific IIC component (EC 2.7.1.69)
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
PTS system, hyaluronate-oligosaccharide-specific IIC component (EC 2.7.1.69)
hylG
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R

Gene: SAG1898: PTS system, hyaluronate-oligosaccharide-specific IID component (EC 2.7.1.69)
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_0644: PTS system, hyaluronate-oligosaccharide-specific IID component (EC 2.7.1.69)
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1308: PTS system, hyaluronate-oligosaccharide-specific IID component (EC 2.7.1.69)
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_0325: PTS system, hyaluronate-oligosaccharide-specific IID component (EC 2.7.1.69)
 
Streptococcus pyogenes M1 GAS

Gene: SPy0629: PTS system, hyaluronate-oligosaccharide-specific IID component (EC 2.7.1.69)
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33

Gene: SSU05_1217: PTS system, hyaluronate-oligosaccharide-specific IID component (EC 2.7.1.69)
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
PTS system, hyaluronate-oligosaccharide-specific IID component (EC 2.7.1.69)
yajC
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_0326: Preprotein translocase subunit YajC (TC 3.A.5.1.1)
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33

Gene: SSU05_1216: Preprotein translocase subunit YajC (TC 3.A.5.1.1)
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Preprotein translocase subunit YajC (TC 3.A.5.1.1)
ohl
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R

Gene: SAG1897: Oligohyaluronate lyase (EC 4.2.2.-)
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_0643: Oligohyaluronate lyase (EC 4.2.2.-)
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 2
Streptococcus pneumoniae TIGR4

Gene: SP_0327: Oligohyaluronate lyase (EC 4.2.2.-)

Gene: SP_0329: Oligohyaluronate lyase (EC 4.2.2.-)
 
Streptococcus pyogenes M1 GAS

Gene: SPy0628: Oligohyaluronate lyase (EC 4.2.2.-)
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33

Gene: SSU05_1211: Oligohyaluronate lyase (EC 4.2.2.-)
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Oligohyaluronate lyase (EC 4.2.2.-)
SP_1439
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_0328: IS1380-Spn1, transposase
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
IS1380-Spn1, transposase
regR
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R

Gene: SAG1896: Transcriptional regulator of hyaluronate and KDG utilization, LacI family
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_0642: Transcriptional regulator of hyaluronate and KDG utilization, LacI family
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1309: Transcriptional regulator of hyaluronate and KDG utilization, LacI family
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_0330: Transcriptional regulator of hyaluronate and KDG utilization, LacI family
 
Streptococcus pyogenes M1 GAS

Gene: SPy0627: Transcriptional regulator of hyaluronate and KDG utilization, LacI family
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33

Gene: SSU05_1210: Transcriptional regulator of hyaluronate and KDG utilization, LacI family
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Transcriptional regulator of hyaluronate and KDG utilization, LacI family
hyl
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
*
Streptococcus agalactiae 2603V/R

Site:
position = -42
score = 5.03814
sequence = AGGAAAAACCGGTTTACAAT

Gene: SAG1197: Hyaluronate lyase precursor (EC 4.2.2.1)
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_0654: Hyaluronate lyase precursor (EC 4.2.2.1)
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1299: Hyaluronate lyase precursor (EC 4.2.2.1)
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
*
Streptococcus pneumoniae TIGR4

Site:
position = -89
score = 6.23897
sequence = TAATTAAACCGGTTTACTTA

Gene: SP_0314: Hyaluronate lyase precursor (EC 4.2.2.1)
*
Streptococcus pyogenes M1 GAS

Site:
position = -54
score = 5.45941
sequence = TTAGTAAATCAATTTACTTT

Gene: SPy1032: Hyaluronate lyase precursor (EC 4.2.2.1)
 
Streptococcus sanguinis SK36
 4
Streptococcus suis 05ZYH33

Gene: SSU05_1214: Hyaluronate lyase precursor (EC 4.2.2.1)

Gene: SSU05_1215: Hyaluronate lyase precursor (EC 4.2.2.1)

Gene: SSU05_1212: Hyaluronate lyase precursor (EC 4.2.2.1)

Gene: SSU05_1213: Hyaluronate lyase precursor (EC 4.2.2.1)
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Hyaluronate lyase precursor (EC 4.2.2.1)
kduD
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
*
Streptococcus agalactiae 2603V/R

Site:
position = -265
score = 5.12804
sequence = TGAGTTTACCGGTTTACTTT

Site:
position = -46
score = 5.09009
sequence = CATGTAAACAGGTTTACTTC

Site:
position = -75
score = 5.85934
sequence = TGACAAAACCGGTTTACTTT

Gene: SAG1904: 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase (EC 1.1.1.127)
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -74
score = 5.11186
sequence = TGACAAAACTAGTTTACTTT

Site:
position = -45
score = 6.0807
sequence = TTGGTAAACAGGTTTACTTA

Gene: SDEG_0650: 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase (EC 1.1.1.127)
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -293
score = 5.3494
sequence = TTAGTTTACCGGTTTACTTA

Site:
position = -45
score = 6.0807
sequence = TTGGTAAACAGGTTTACTTA

Gene: Sez_1303: 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase (EC 1.1.1.127)
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
*
Streptococcus pneumoniae TIGR4

Site:
position = -253
score = 5.03919
sequence = TAGGTTTACCGGTTTACTTT

Site:
position = -71
score = 5.62835
sequence = TGACAAAACCGGTTTACTAG

Gene: SP_0320: 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase (EC 1.1.1.127)
*
Streptococcus pyogenes M1 GAS

Site:
position = -45
score = 6.0807
sequence = TTGGTAAACAGGTTTACTTA

Site:
position = -74
score = 5.11186
sequence = TGACAAAACTAGTTTACTTT

Gene: SPy0636: 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase (EC 1.1.1.127)
 
Streptococcus sanguinis SK36
*
Streptococcus suis 05ZYH33

Site:
position = -75
score = 5.82847
sequence = TGACAAAACCGGTTTACTAT

Gene: SSU05_1225: 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase (EC 1.1.1.127)
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase (EC 1.1.1.127)
kduI
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R

Gene: SAG1905: 5-keto-4-deoxyuronate isomerase (EC 5.3.1.17)
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_0651: 5-keto-4-deoxyuronate isomerase (EC 5.3.1.17)
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1302: 5-keto-4-deoxyuronate isomerase (EC 5.3.1.17)
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_0319: 5-keto-4-deoxyuronate isomerase (EC 5.3.1.17)
 
Streptococcus pyogenes M1 GAS

Gene: SPy0637: 5-keto-4-deoxyuronate isomerase (EC 5.3.1.17)
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33

Gene: SSU05_1224: 5-keto-4-deoxyuronate isomerase (EC 5.3.1.17)
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
5-keto-4-deoxyuronate isomerase (EC 5.3.1.17)
kdgK
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R

Gene: SAG1906: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_0652: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1301: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_0318: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
 
Streptococcus pyogenes M1 GAS

Gene: SPy0638: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33

Gene: SSU05_1223: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
kdgA
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R

Gene: SAG1907: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_0653: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1300: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_0317: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
 
Streptococcus pyogenes M1 GAS

Gene: SPy0639: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33

Gene: SSU05_1222: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD