Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NrtR - Mycobacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 18 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Mycobacterium leprae TN 4 2
Mycobacterium marinum M 4 2
Mycobacterium smegmatis str. MC2 155 4 2
Mycobacterium sp. JLS 4 2
Mycobacterium tuberculosis H37Rv 4 2
Mycobacterium vanbaalenii PYR-1 4 2
Mycobacterium flavescens PYR-GCK 4 2
Mycobacterium avium 104 4 2
Mycobacterium abscessus ATCC 19977 4 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
nadA
*
Mycobacterium leprae TN

Site:
position = -46
score = 7.55121
sequence = GTTTTCGATTATAAGTCGAAAAC

Gene: ML1225: Quinolinate synthetase (EC 4.1.99.-)
*
Mycobacterium marinum M

Site:
position = -47
score = 7.4627
sequence = GTTTTCGATTGTAAGTCGAAAAC

Gene: MMAR_2391: Quinolinate synthetase (EC 4.1.99.-)
*
Mycobacterium smegmatis str. MC2 155

Site:
position = -46
score = 7.55121
sequence = GTTTTCGATTATAAGTCGAAAAC

Gene: MSMEG_3199: Quinolinate synthetase (EC 4.1.99.-)
*
Mycobacterium sp. JLS

Site:
position = -46
score = 7.4627
sequence = GTTTTCGATTGTAAGTCGAAAAC

Gene: Mjls_3085: Quinolinate synthetase (EC 4.1.99.-)
*
Mycobacterium tuberculosis H37Rv

Site:
position = -48
score = 7.55121
sequence = GTTTTCGATTATAAGTCGAAAAC

Gene: Rv1594: Quinolinate synthetase (EC 4.1.99.-)
*
Mycobacterium vanbaalenii PYR-1

Site:
position = -47
score = 7.4627
sequence = GTTTTCGATTGTAAGTCGAAAAC

Gene: Mvan_2798: Quinolinate synthetase (EC 4.1.99.-)
*
Mycobacterium flavescens PYR-GCK

Site:
position = -47
score = 7.4627
sequence = GTTTTCGATTGTAAGTCGAAAAC

Gene: Mflv_3619: Quinolinate synthetase (EC 4.1.99.-)
*
Mycobacterium avium 104

Site:
position = -46
score = 7.55121
sequence = GTTTTCGATTATAAGTCGAAAAC

Gene: MAV_3191: Quinolinate synthetase (EC 4.1.99.-)
*
Mycobacterium abscessus ATCC 19977

Site:
position = -82
score = 7.05437
sequence = GTTTTCGATCATAAGTCGAAAAC

Gene: MAB_2674c: Quinolinate synthetase (EC 4.1.99.-)
Quinolinate synthetase (EC 4.1.99.-)
nadB
 
Mycobacterium leprae TN

Gene: ML1226: L-aspartate oxidase (EC 1.4.3.16)
 
Mycobacterium marinum M

Gene: MMAR_2392: L-aspartate oxidase (EC 1.4.3.16)
 
Mycobacterium smegmatis str. MC2 155

Gene: MSMEG_3200: L-aspartate oxidase (EC 1.4.3.16)
 
Mycobacterium sp. JLS

Gene: Mjls_3084: L-aspartate oxidase (EC 1.4.3.16)
 
Mycobacterium tuberculosis H37Rv

Gene: Rv1595: L-aspartate oxidase (EC 1.4.3.16)
 
Mycobacterium vanbaalenii PYR-1

Gene: Mvan_2799: L-aspartate oxidase (EC 1.4.3.16)
 
Mycobacterium flavescens PYR-GCK

Gene: Mflv_3618: L-aspartate oxidase (EC 1.4.3.16)
 
Mycobacterium avium 104

Gene: MAV_3190: L-aspartate oxidase (EC 1.4.3.16)
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_2673c: L-aspartate oxidase (EC 1.4.3.16)
L-aspartate oxidase (EC 1.4.3.16)
nadC
 
Mycobacterium leprae TN

Gene: ML1227: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Mycobacterium marinum M

Gene: MMAR_2393: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Mycobacterium smegmatis str. MC2 155

Gene: MSMEG_3201: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Mycobacterium sp. JLS

Gene: Mjls_3083: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Mycobacterium tuberculosis H37Rv

Gene: Rv1596: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Mycobacterium vanbaalenii PYR-1

Gene: Mvan_2800: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Mycobacterium flavescens PYR-GCK

Gene: Mflv_3617: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Mycobacterium avium 104

Gene: MAV_3189: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_2672c: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
CRON 2.
nrtR
*
Mycobacterium leprae TN

Site:
position = -23
score = 7.55121
sequence = GTTTTCGACTTATAATCGAAAAC

Gene: ML1224: Nudix-related transcriptional regulator NrtR
*
Mycobacterium marinum M

Site:
position = -23
score = 7.4627
sequence = GTTTTCGACTTACAATCGAAAAC

Gene: MMAR_2390: Nudix-related transcriptional regulator NrtR
*
Mycobacterium smegmatis str. MC2 155

Site:
position = -50
score = 7.55121
sequence = GTTTTCGACTTATAATCGAAAAC

Gene: MSMEG_3198: Nudix-related transcriptional regulator NrtR
*
Mycobacterium sp. JLS

Site:
position = -23
score = 7.4627
sequence = GTTTTCGACTTACAATCGAAAAC

Gene: Mjls_3086: Nudix-related transcriptional regulator NrtR
*
Mycobacterium tuberculosis H37Rv

Site:
position = -23
score = 7.55121
sequence = GTTTTCGACTTATAATCGAAAAC

Gene: Rv1593c: Nudix-related transcriptional regulator NrtR
*
Mycobacterium vanbaalenii PYR-1

Site:
position = -23
score = 7.4627
sequence = GTTTTCGACTTACAATCGAAAAC

Gene: Mvan_2797: Nudix-related transcriptional regulator NrtR
*
Mycobacterium flavescens PYR-GCK

Site:
position = -23
score = 7.4627
sequence = GTTTTCGACTTACAATCGAAAAC

Gene: Mflv_3620: Nudix-related transcriptional regulator NrtR
*
Mycobacterium avium 104

Site:
position = -62
score = 7.55121
sequence = GTTTTCGACTTATAATCGAAAAC

Gene: MAV_3192: Nudix-related transcriptional regulator NrtR
*
Mycobacterium abscessus ATCC 19977

Site:
position = -23
score = 7.05437
sequence = GTTTTCGACTTATGATCGAAAAC

Gene: MAB_2675: Nudix-related transcriptional regulator NrtR
Nudix-related transcriptional regulator NrtR
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD