Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur - Actinobacteria

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 69 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acidothermus cellulolyticus 11B 4 1
Actinosynnema mirum DSM 43827 20 7
Arthrobacter sp. FB24 4 2
Bifidobacterium longum subsp. infantis ATCC 15697 6 4
Brachybacterium faecium DSM 4810 5 2
Brevibacterium linens BL2 7 5
Clavibacter michiganensis subsp. michiganensis NCPPB 382 12 6
Frankia sp. EAN1pec 5 2
Janibacter sp. HTCC2649 4 1
Kocuria rhizophila DC2201 8 3
Kytococcus sedentarius DSM 20547 4 1
Leifsonia xyli subsp. xyli str. CTCB07 5 2
Nakamurella multipartita DSM 44233 5 3
Nocardioides sp. JS614 4 1
Propionibacterium acnes KPA171202 13 4
Rhodococcus sp. RHA1 16 7
Saccharomonospora viridis DSM 43017 3 1
Saccharopolyspora erythraea NRRL 2338 11 4
Streptomyces coelicolor A3(2) 16 5
Tropheryma whipplei str. Twist
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Arth_3252
 
Acidothermus cellulolyticus 11B
 
Actinosynnema mirum DSM 43827
*
Arthrobacter sp. FB24

Site:
position = -2
score = 5.18588
sequence = AAATGAGAATGATTCTCATAT

Gene: Arth_3252: hypothetical protein
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Frankia sp. EAN1pec
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Nakamurella multipartita DSM 44233
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
 
Rhodococcus sp. RHA1
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
 
Streptomyces coelicolor A3(2)
 
Tropheryma whipplei str. Twist
hypothetical protein
Arth_3253
 
Acidothermus cellulolyticus 11B
 
Actinosynnema mirum DSM 43827
 
Arthrobacter sp. FB24

Gene: Arth_3253: hypothetical protein
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Frankia sp. EAN1pec
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Nakamurella multipartita DSM 44233
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
 
Rhodococcus sp. RHA1
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
 
Streptomyces coelicolor A3(2)
 
Tropheryma whipplei str. Twist
hypothetical protein
rpmJ2
 
Acidothermus cellulolyticus 11B
 
Actinosynnema mirum DSM 43827
 
Arthrobacter sp. FB24

Gene: Arth_3254: 50S ribosomal protein L36
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_1969: 50S ribosomal protein L36
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Site:
position = -34
score = 4.95748
sequence = TATTGAGAACCGTTCTCGTGA

Gene: CMM_0025: 50S ribosomal protein L36
 
Frankia sp. EAN1pec
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201

Gene: KRH_23160: 50S ribosomal protein L36
 
Kytococcus sedentarius DSM 20547
*
Leifsonia xyli subsp. xyli str. CTCB07

Site:
position = -34
score = 5.39758
sequence = TAATGATAATCTTTCTCAGTA

Gene: Lxx20595: 50S ribosomal protein L36
 
Nakamurella multipartita DSM 44233
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
 
Rhodococcus sp. RHA1
 
Saccharomonospora viridis DSM 43017
*
Saccharopolyspora erythraea NRRL 2338

Site:
position = -64
score = 4.86747
sequence = TAACGATAATCATTATCGTCT

Site:
position = -70
score = 4.75576
sequence = AGTTGGTAACGATAATCATTA

Gene: SACE_4627: 50S ribosomal protein L36
 
Streptomyces coelicolor A3(2)
 
Tropheryma whipplei str. Twist
50S ribosomal protein L36
 
CRON 2.
sapD
 
Acidothermus cellulolyticus 11B
*
Actinosynnema mirum DSM 43827

Site:
position = -61
score = 5.57305
sequence = TATTGAAAATGATTGTCCTTT

Gene: Amir_4776: Conserved hypothetical protein CHP03773, ABC transporter-like
 
Arthrobacter sp. FB24
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Frankia sp. EAN1pec
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07

Gene: Lxx20520: Conserved hypothetical protein CHP03773, ABC transporter-like
 
Nakamurella multipartita DSM 44233
 
Nocardioides sp. JS614
*
Propionibacterium acnes KPA171202

Site:
position = -49
score = 5.29179
sequence = AATCGATAACCGTTCTCATTA

Gene: PPA1500: Conserved hypothetical protein CHP03773, ABC transporter-like
 
Rhodococcus sp. RHA1
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
 
Streptomyces coelicolor A3(2)
 
Tropheryma whipplei str. Twist
Conserved hypothetical protein CHP03773, ABC transporter-like
troA
 
Acidothermus cellulolyticus 11B
*
Actinosynnema mirum DSM 43827

Site:
position = -79
score = 5.0856
sequence = GATTGAAAACGGTTGTCGTTT

Gene: Amir_4768: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Arthrobacter sp. FB24
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Frankia sp. EAN1pec
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Nakamurella multipartita DSM 44233
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202

Gene: PPA1501: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Rhodococcus sp. RHA1
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
 
Streptomyces coelicolor A3(2)
 
Tropheryma whipplei str. Twist
Zinc ABC transporter, periplasmic-binding protein ZnuA
DIP0439
 
Acidothermus cellulolyticus 11B
 
Actinosynnema mirum DSM 43827
 
Arthrobacter sp. FB24
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Frankia sp. EAN1pec
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07

Gene: Lxx20480: Surface-anchored repeat, actinobacteria
 
Nakamurella multipartita DSM 44233
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202

Gene: PPA1502: Surface-anchored repeat, actinobacteria
 
Rhodococcus sp. RHA1
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
 
Streptomyces coelicolor A3(2)
 
Tropheryma whipplei str. Twist
Surface-anchored repeat, actinobacteria
DIP0440
 
Acidothermus cellulolyticus 11B
 
Actinosynnema mirum DSM 43827

Gene: Amir_4770: Zinc ABC transporter, ATP-binding protein ZnuC
 
Arthrobacter sp. FB24
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Frankia sp. EAN1pec
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Nakamurella multipartita DSM 44233
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202

Gene: PPA1503: Zinc ABC transporter, ATP-binding protein ZnuC
 
Rhodococcus sp. RHA1
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
 
Streptomyces coelicolor A3(2)
 
Tropheryma whipplei str. Twist
Zinc ABC transporter, ATP-binding protein ZnuC
DIP0441
 
Acidothermus cellulolyticus 11B
 
Actinosynnema mirum DSM 43827

Gene: Amir_4771: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Arthrobacter sp. FB24
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Frankia sp. EAN1pec
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07

Gene: Lxx20450: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Nakamurella multipartita DSM 44233
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202

Gene: PPA1504: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Rhodococcus sp. RHA1
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
 
Streptomyces coelicolor A3(2)
 
Tropheryma whipplei str. Twist
Zinc ABC transporter, inner membrane permease protein ZnuB
Amir_3101
 
Acidothermus cellulolyticus 11B
*2
Actinosynnema mirum DSM 43827

Gene: Amir_4775: hypothetical protein

Site:
position = -66
score = 5.54283
sequence = AGTTGAAAACCGTTGTCATTT

Gene: Amir_3101: hypothetical protein
 
Arthrobacter sp. FB24
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Frankia sp. EAN1pec
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Nakamurella multipartita DSM 44233
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
 
Rhodococcus sp. RHA1
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
 
Streptomyces coelicolor A3(2)
 
Tropheryma whipplei str. Twist
hypothetical protein
Amir_4774
 
Acidothermus cellulolyticus 11B
 
Actinosynnema mirum DSM 43827

Gene: Amir_4774: protein of unknown function DUF916 cell surface putative
 
Arthrobacter sp. FB24
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Frankia sp. EAN1pec
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Nakamurella multipartita DSM 44233
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
 
Rhodococcus sp. RHA1
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
 
Streptomyces coelicolor A3(2)
 
Tropheryma whipplei str. Twist
protein of unknown function DUF916 cell surface putative
yciC3
 
Acidothermus cellulolyticus 11B
 
Actinosynnema mirum DSM 43827

Gene: Amir_4773: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Arthrobacter sp. FB24
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Frankia sp. EAN1pec
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Nakamurella multipartita DSM 44233
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
*
Rhodococcus sp. RHA1

Site:
position = -25
score = 5.75291
sequence = TAATGAAAACAGTTATCATTT

Gene: RHA1_ro05533: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
 
Streptomyces coelicolor A3(2)
 
Tropheryma whipplei str. Twist
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Amir_4769
 
Acidothermus cellulolyticus 11B
 
Actinosynnema mirum DSM 43827

Gene: Amir_4769: hypothetical protein
 
Arthrobacter sp. FB24
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Frankia sp. EAN1pec
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Nakamurella multipartita DSM 44233
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
 
Rhodococcus sp. RHA1
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
 
Streptomyces coelicolor A3(2)
 
Tropheryma whipplei str. Twist
hypothetical protein
 
CRON 3.
KRH_17300
 
Acidothermus cellulolyticus 11B
 
Actinosynnema mirum DSM 43827
 
Arthrobacter sp. FB24
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Frankia sp. EAN1pec
 
Janibacter sp. HTCC2649
*
Kocuria rhizophila DC2201

Site:
position = -120
score = 5.30713
sequence = TAACGAGAACCGTTATCATTT

Gene: KRH_17300: hypothetical protein
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Nakamurella multipartita DSM 44233
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
 
Rhodococcus sp. RHA1
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
 
Streptomyces coelicolor A3(2)
 
Tropheryma whipplei str. Twist
hypothetical protein
KRH_17290
 
Acidothermus cellulolyticus 11B
 
Actinosynnema mirum DSM 43827
 
Arthrobacter sp. FB24
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Frankia sp. EAN1pec
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201

Gene: KRH_17290: hypothetical protein
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Nakamurella multipartita DSM 44233
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
 
Rhodococcus sp. RHA1
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
 
Streptomyces coelicolor A3(2)
 
Tropheryma whipplei str. Twist
hypothetical protein
yciC2
 
Acidothermus cellulolyticus 11B
 
Actinosynnema mirum DSM 43827
 
Arthrobacter sp. FB24
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Brachybacterium faecium DSM 4810
*
Brevibacterium linens BL2

Site:
position = -56
score = 4.76076
sequence = TATTGAGAACGAGTATTATTA

Gene: BlinB01002697: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*2
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Site:
position = -31
score = 4.95748
sequence = TCACGAGAACGGTTCTCAATA

Gene: CMM_0026: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family

Site:
position = -32
score = 4.20362
sequence = AGATGAGAACGGTTCTCTTCT

Gene: CMM_0314: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Frankia sp. EAN1pec
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201

Gene: KRH_17280: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Nakamurella multipartita DSM 44233
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
 
Rhodococcus sp. RHA1
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
 
Streptomyces coelicolor A3(2)
 
Tropheryma whipplei str. Twist
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
CRON 4.
yciC4
 
Acidothermus cellulolyticus 11B
 
Actinosynnema mirum DSM 43827

Gene: Amir_1028: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Arthrobacter sp. FB24
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Brachybacterium faecium DSM 4810
*
Brevibacterium linens BL2

Site:
position = -60
score = 5.73295
sequence = TAATGAAAAACGTTACCATTA

Gene: BlinB01002695: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Frankia sp. EAN1pec

Gene: Franean1_6990: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201

Gene: KRH_15130: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Nakamurella multipartita DSM 44233
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
 
Rhodococcus sp. RHA1

Gene: RHA1_ro06423: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338

Gene: SACE_3297: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Streptomyces coelicolor A3(2)

Gene: SCO5835: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Tropheryma whipplei str. Twist
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
CRON 5.
znuA4
 
Acidothermus cellulolyticus 11B
 
Actinosynnema mirum DSM 43827
 
Arthrobacter sp. FB24
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -113
score = 5.56432
sequence = AAATGATAATAATTCTCAATA

Gene: Blon_1963: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Frankia sp. EAN1pec
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Nakamurella multipartita DSM 44233
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
 
Rhodococcus sp. RHA1
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
 
Streptomyces coelicolor A3(2)
 
Tropheryma whipplei str. Twist
Zinc ABC transporter, periplasmic-binding protein ZnuA
 
CRON 6.
znuC4
 
Acidothermus cellulolyticus 11B
 
Actinosynnema mirum DSM 43827
 
Arthrobacter sp. FB24
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Site:
position = -37
score = 4.43656
sequence = GAATGAGAATGCTTATCAACT

Gene: CMM_0174: Zinc ABC transporter, ATP-binding protein ZnuC
 
Frankia sp. EAN1pec
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Nakamurella multipartita DSM 44233
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
*
Rhodococcus sp. RHA1

Site:
position = -8
score = 5.10227
sequence = TAACGATAATGATTGTCGTAA

Gene: RHA1_ro02545: Zinc ABC transporter, ATP-binding protein ZnuC
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
 
Streptomyces coelicolor A3(2)
 
Tropheryma whipplei str. Twist
Zinc ABC transporter, ATP-binding protein ZnuC
 
CRON 7.
znuB2
 
Acidothermus cellulolyticus 11B
 
Actinosynnema mirum DSM 43827
 
Arthrobacter sp. FB24
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Brachybacterium faecium DSM 4810
*
Brevibacterium linens BL2

Site:
position = -25
score = 4.70085
sequence = TAACAATAATGGTTATCATCA

Gene: BlinB01002692: Zinc ABC transporter, inner membrane permease protein ZnuB
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Site:
position = -40
score = 4.43656
sequence = AGTTGATAAGCATTCTCATTC

Gene: CMM_0175: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Frankia sp. EAN1pec
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Nakamurella multipartita DSM 44233

Gene: Namu_1073: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
*
Rhodococcus sp. RHA1

Site:
position = -31
score = 5.10227
sequence = TTACGACAATCATTATCGTTA

Gene: RHA1_ro02546: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
*
Streptomyces coelicolor A3(2)

Site:
position = -34
score = 5.09772
sequence = TGTTGAACATGATTTTCATTG

Gene: SCO0475: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Tropheryma whipplei str. Twist
Zinc ABC transporter, inner membrane permease protein ZnuB
SCO00474
 
Acidothermus cellulolyticus 11B
 
Actinosynnema mirum DSM 43827
 
Arthrobacter sp. FB24
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Brachybacterium faecium DSM 4810
*
Brevibacterium linens BL2

Site:
position = -31
score = 5.38164
sequence = CAATGAGAACCATTATCAATA

Gene: BlinB01002691: WD40/YVTN repeat-like-containing domain
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Gene: CMM_0176: WD40/YVTN repeat-like-containing domain
 
Frankia sp. EAN1pec
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Nakamurella multipartita DSM 44233
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
 
Rhodococcus sp. RHA1

Gene: RHA1_ro02547: WD40/YVTN repeat-like-containing domain
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
 
Streptomyces coelicolor A3(2)

Gene: SCO0474: WD40/YVTN repeat-like-containing domain
 
Tropheryma whipplei str. Twist
WD40/YVTN repeat-like-containing domain
znuA2
 
Acidothermus cellulolyticus 11B
 
Actinosynnema mirum DSM 43827
 
Arthrobacter sp. FB24
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2

Gene: BlinB01002690: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Gene: CMM_0177: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Frankia sp. EAN1pec

Site:
position = -26
score = 5.0856
sequence = CATCGACAACCGTTTTCATTT

Gene: Franean1_7253: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Nakamurella multipartita DSM 44233

Gene: Namu_1071: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
 
Rhodococcus sp. RHA1

Gene: RHA1_ro02548: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
 
Streptomyces coelicolor A3(2)

Gene: SCO0473: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Tropheryma whipplei str. Twist
Zinc ABC transporter, periplasmic-binding protein ZnuA
SCO0472
 
Acidothermus cellulolyticus 11B
 
Actinosynnema mirum DSM 43827
*
Arthrobacter sp. FB24

Site:
position = -26
score = 5.23059
sequence = TAATGAGAATGACTATCATTT

Gene: Arth_4108: WD40/YVTN repeat-like-containing domain
 
Bifidobacterium longum subsp. infantis ATCC 15697
*
Brachybacterium faecium DSM 4810

Site:
position = -62
score = 4.70167
sequence = AGATGCGAACGATTATCAGTA

Site:
position = -17
score = 5.36976
sequence = TGATGAGAACGGTTTTCATGA

Gene: Bfae_30770: WD40/YVTN repeat-like-containing domain
 
Brevibacterium linens BL2

Gene: BlinB01002689: WD40/YVTN repeat-like-containing domain
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Gene: CMM_0178: WD40/YVTN repeat-like-containing domain
 
Frankia sp. EAN1pec
 
Janibacter sp. HTCC2649
*2
Kocuria rhizophila DC2201

Gene: KRH_00830: WD40/YVTN repeat-like-containing domain

Site:
position = -83
score = 4.46619
sequence = AGATAAAAACGATTCTCATCT

Gene: KRH_00820: WD40/YVTN repeat-like-containing domain
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Nakamurella multipartita DSM 44233

Gene: Namu_1070: WD40/YVTN repeat-like-containing domain
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
*
Rhodococcus sp. RHA1

Site:
position = -47
score = 4.87787
sequence = CTTTGACAACCGTTTGCAATA

Gene: RHA1_ro02549: WD40/YVTN repeat-like-containing domain
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
 
Streptomyces coelicolor A3(2)

Gene: SCO0472: WD40/YVTN repeat-like-containing domain
 
Tropheryma whipplei str. Twist
WD40/YVTN repeat-like-containing domain
Franean1_7254
 
Acidothermus cellulolyticus 11B
 
Actinosynnema mirum DSM 43827
 
Arthrobacter sp. FB24
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Frankia sp. EAN1pec

Gene: Franean1_7254: ABC transporter related
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Nakamurella multipartita DSM 44233
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
 
Rhodococcus sp. RHA1
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
 
Streptomyces coelicolor A3(2)
 
Tropheryma whipplei str. Twist
ABC transporter related
Franean1_7255
 
Acidothermus cellulolyticus 11B
 
Actinosynnema mirum DSM 43827
 
Arthrobacter sp. FB24
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Frankia sp. EAN1pec

Gene: Franean1_7255: ABC-3 protein
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Nakamurella multipartita DSM 44233
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
 
Rhodococcus sp. RHA1
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
 
Streptomyces coelicolor A3(2)
 
Tropheryma whipplei str. Twist
ABC-3 protein
Franean1_7256
 
Acidothermus cellulolyticus 11B
 
Actinosynnema mirum DSM 43827
 
Arthrobacter sp. FB24
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Frankia sp. EAN1pec

Gene: Franean1_7256: ABC-3 protein
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Nakamurella multipartita DSM 44233
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
 
Rhodococcus sp. RHA1
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
 
Streptomyces coelicolor A3(2)
 
Tropheryma whipplei str. Twist
ABC-3 protein
Namu_1072
 
Acidothermus cellulolyticus 11B
 
Actinosynnema mirum DSM 43827
 
Arthrobacter sp. FB24
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Frankia sp. EAN1pec
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
*
Nakamurella multipartita DSM 44233

Site:
position = -28
score = 5.10015
sequence = TAACGAGAACCGTTCTCAGTA

Gene: Namu_1072: hypothetical protein
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
 
Rhodococcus sp. RHA1
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
 
Streptomyces coelicolor A3(2)
 
Tropheryma whipplei str. Twist
hypothetical protein
 
CRON 8.
znuA
*
Acidothermus cellulolyticus 11B

Site:
position = -8
score = 4.67891
sequence = TACTTGCAATGATTTCCAACA

Gene: Acel_2086: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Actinosynnema mirum DSM 43827

Site:
position = -50
score = 4.26476
sequence = ACTCGACAACGGTTACCATTC

Gene: Amir_0352: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Arthrobacter sp. FB24

Gene: Arth_2641: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Bifidobacterium longum subsp. infantis ATCC 15697
*
Brachybacterium faecium DSM 4810

Site:
position = -8
score = 4.80844
sequence = TGGTGAGAATGATTGTCATGT

Gene: Bfae_17080: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Brevibacterium linens BL2

Gene: BlinB01001749: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Site:
position = -37
score = 5.10264
sequence = TAGTGAGACTGGTTATCAATA

Gene: CMM_2941: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Frankia sp. EAN1pec
*
Janibacter sp. HTCC2649

Site:
position = -39
score = 5.06336
sequence = AGTTGACAATCATTCTCAACT

Site:
position = -17
score = 5.14615
sequence = AGTTGAGAATGATTGTCATGA

Gene: JNB_04825: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Kocuria rhizophila DC2201

Site:
position = -63
score = 4.44609
sequence = TGATGACACTGATTCTCATCG

Gene: KRH_09480: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Kytococcus sedentarius DSM 20547

Site:
position = -17
score = 4.15706
sequence = ACCTGAGAATCATTGTCATGC

Gene: Ksed_11830: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Leifsonia xyli subsp. xyli str. CTCB07

Site:
position = -86
score = 5.55494
sequence = TTTTGACAATCATTATCAACA

Gene: Lxx25040: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Nakamurella multipartita DSM 44233

Gene: Namu_4923: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Nocardioides sp. JS614

Site:
position = -30
score = 4.6031
sequence = GTTTGACAATCATTCTCAATC

Site:
position = -8
score = 4.32956
sequence = GGCTGAGAATGATTCTCATGA

Gene: Noca_1937: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Propionibacterium acnes KPA171202

Site:
position = -46
score = 4.66276
sequence = ATACGACAATGGTTATCACTT

Gene: PPA0617: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Rhodococcus sp. RHA1

Site:
position = -55
score = 4.82622
sequence = CAACGGTAACGGTTTCCAATA

Gene: RHA1_ro04479: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Saccharomonospora viridis DSM 43017

Site:
position = -90
score = 5.89675
sequence = TATCGAAAATCATTTCCAATA

Gene: Svir_35300: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Saccharopolyspora erythraea NRRL 2338

Site:
position = -69
score = 5.03586
sequence = ACATGACAACGGTTTCCGTTA

Gene: SACE_0453: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Streptomyces coelicolor A3(2)

Site:
position = -39
score = 5.22508
sequence = TGTTGACAACGGTTTCCATAT

Site:
position = -17
score = 5.15991
sequence = TGTTGAAAATGAGTGTCATGA

Gene: SCO2505: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Tropheryma whipplei str. Twist
Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC
 
Acidothermus cellulolyticus 11B

Gene: Acel_2087: Zinc ABC transporter, ATP-binding protein ZnuC
 
Actinosynnema mirum DSM 43827

Gene: Amir_0353: Zinc ABC transporter, ATP-binding protein ZnuC
 
Arthrobacter sp. FB24

Gene: Arth_2640: Zinc ABC transporter, ATP-binding protein ZnuC
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -43
score = 5.41467
sequence = TATTGAGAACGATTGTCAGCA

Gene: Blon_1757: Zinc ABC transporter, ATP-binding protein ZnuC
 
Brachybacterium faecium DSM 4810

Gene: Bfae_17090: Zinc ABC transporter, ATP-binding protein ZnuC
 
Brevibacterium linens BL2

Gene: BlinB01001750: Zinc ABC transporter, ATP-binding protein ZnuC
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Gene: CMM_2940: Zinc ABC transporter, ATP-binding protein ZnuC
 
Frankia sp. EAN1pec
 
Janibacter sp. HTCC2649

Gene: JNB_04830: Zinc ABC transporter, ATP-binding protein ZnuC
 
Kocuria rhizophila DC2201

Gene: KRH_09490: Zinc ABC transporter, ATP-binding protein ZnuC
 
Kytococcus sedentarius DSM 20547

Gene: Ksed_11820: Zinc ABC transporter, ATP-binding protein ZnuC
 
Leifsonia xyli subsp. xyli str. CTCB07

Gene: Lxx25025: Zinc ABC transporter, ATP-binding protein ZnuC
 
Nakamurella multipartita DSM 44233

Gene: Namu_4922: Zinc ABC transporter, ATP-binding protein ZnuC
 
Nocardioides sp. JS614

Gene: Noca_1936: Zinc ABC transporter, ATP-binding protein ZnuC
 
Propionibacterium acnes KPA171202

Gene: PPA0616: Zinc ABC transporter, ATP-binding protein ZnuC
 
Rhodococcus sp. RHA1

Gene: RHA1_ro04478: Zinc ABC transporter, ATP-binding protein ZnuC
 
Saccharomonospora viridis DSM 43017

Gene: Svir_35290: Zinc ABC transporter, ATP-binding protein ZnuC
 
Saccharopolyspora erythraea NRRL 2338

Gene: SACE_0452: Zinc ABC transporter, ATP-binding protein ZnuC
 
Streptomyces coelicolor A3(2)

Gene: SCO2506: Zinc ABC transporter, ATP-binding protein ZnuC
 
Tropheryma whipplei str. Twist
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
 
Acidothermus cellulolyticus 11B

Gene: Acel_2088: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Actinosynnema mirum DSM 43827

Gene: Amir_0354: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Arthrobacter sp. FB24

Gene: Arth_2639: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Brachybacterium faecium DSM 4810

Gene: Bfae_17100: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Brevibacterium linens BL2

Gene: BlinB01001751: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Gene: CMM_2939: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Frankia sp. EAN1pec
 
Janibacter sp. HTCC2649

Gene: JNB_04835: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Kocuria rhizophila DC2201

Gene: KRH_09500: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Kytococcus sedentarius DSM 20547

Gene: Ksed_11810: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Leifsonia xyli subsp. xyli str. CTCB07

Gene: Lxx25020: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Nakamurella multipartita DSM 44233

Gene: Namu_4921: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Nocardioides sp. JS614

Gene: Noca_1935: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Propionibacterium acnes KPA171202

Gene: PPA0615: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Rhodococcus sp. RHA1

Gene: RHA1_ro04477: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Saccharomonospora viridis DSM 43017

Gene: Svir_35280: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Saccharopolyspora erythraea NRRL 2338

Gene: SACE_0451: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Streptomyces coelicolor A3(2)

Gene: SCO2507: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Tropheryma whipplei str. Twist
Zinc ABC transporter, inner membrane permease protein ZnuB
zur
 
Acidothermus cellulolyticus 11B

Gene: Acel_2085: Zinc uptake regulation protein Zur
*2
Actinosynnema mirum DSM 43827

Gene: Amir_1261: Zinc uptake regulation protein Zur

Site:
position = -56
score = 5.30439
sequence = AATTGAAAACGATTGTCTTTT

Gene: Amir_4413: Zinc uptake regulation protein Zur
 
Arthrobacter sp. FB24

Gene: Arth_2638: Zinc uptake regulation protein Zur
*2
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -45
score = 5.13933
sequence = TAACGATAATGAATATCATTT

Gene: Blon_1974: Zinc uptake regulation protein Zur

Gene: Blon_1979: Zinc uptake regulation protein Zur
 
Brachybacterium faecium DSM 4810

Gene: Bfae_17110: Zinc uptake regulation protein Zur
*
Brevibacterium linens BL2

Site:
position = -94
score = 5.73295
sequence = TAATGGTAACGTTTTTCATTA

Gene: BlinB01002696: Zinc uptake regulation protein Zur
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Gene: CMM_2938: Zinc uptake regulation protein Zur
*
Frankia sp. EAN1pec

Site:
position = -135
score = 5.34162
sequence = AAATGAAAACCGATGTCAACA

Gene: Franean1_7263: Zinc uptake regulation protein Zur
 
Janibacter sp. HTCC2649

Gene: JNB_04840: Zinc uptake regulation protein Zur
 
Kocuria rhizophila DC2201

Gene: KRH_09520: Zinc uptake regulation protein Zur
 
Kytococcus sedentarius DSM 20547

Gene: Ksed_11800: Zinc uptake regulation protein Zur
 
Leifsonia xyli subsp. xyli str. CTCB07

Gene: Lxx25010: Zinc uptake regulation protein Zur
 
Nakamurella multipartita DSM 44233

Gene: Namu_0066: Zinc uptake regulation protein Zur
 
Nocardioides sp. JS614

Gene: Noca_1934: Zinc uptake regulation protein Zur
 
Propionibacterium acnes KPA171202

Gene: PPA0948: Zinc uptake regulation protein Zur
 
Rhodococcus sp. RHA1

Gene: RHA1_ro01222: Zinc uptake regulation protein Zur
 
Saccharomonospora viridis DSM 43017

Gene: Svir_13670: Zinc uptake regulation protein Zur
 
Saccharopolyspora erythraea NRRL 2338

Gene: SACE_1498: Zinc uptake regulation protein Zur
 
Streptomyces coelicolor A3(2)

Gene: SCO2508: Zinc uptake regulation protein Zur
 
Tropheryma whipplei str. Twist
Zinc uptake regulation protein Zur
znuB2
 
Acidothermus cellulolyticus 11B

Gene: Acel_2089: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Actinosynnema mirum DSM 43827
 
Arthrobacter sp. FB24
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_1758: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Frankia sp. EAN1pec
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Nakamurella multipartita DSM 44233
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
 
Rhodococcus sp. RHA1
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
 
Streptomyces coelicolor A3(2)
 
Tropheryma whipplei str. Twist
Zinc ABC transporter, inner membrane permease protein ZnuB
rpmB2
 
Acidothermus cellulolyticus 11B
*
Actinosynnema mirum DSM 43827

Site:
position = -40
score = 4.97159
sequence = AGGTGAAAATGATTGTCATTC

Gene: Amir_0607: LSU ribosomal protein L28p
 
Arthrobacter sp. FB24
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -37
score = 5.53349
sequence = ATTTGATAATGGTTATCATTA

Gene: Blon_1965: LSU ribosomal protein L28p
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Frankia sp. EAN1pec
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
*
Nakamurella multipartita DSM 44233

Site:
position = -127
score = 4.672
sequence = TAACGAGACCGATTCTCAGTA

Gene: Namu_3856: LSU ribosomal protein L28p
 
Nocardioides sp. JS614
*
Propionibacterium acnes KPA171202

Site:
position = -44
score = 4.97672
sequence = ATATGATAATGATTCTCATAT

Gene: PPA2158: LSU ribosomal protein L28p
*
Rhodococcus sp. RHA1

Site:
position = -63
score = 5.40215
sequence = TGTCGAAAATGATTGTCATCA

Site:
position = -117
score = 5.41032
sequence = TTTCGATAACGATTGTCATTA

Gene: RHA1_ro05617: LSU ribosomal protein L28p
 
Saccharomonospora viridis DSM 43017
*
Saccharopolyspora erythraea NRRL 2338

Site:
position = -35
score = 5.46565
sequence = TAATGAAAACGGATGTCGTTA

Gene: SACE_0754: LSU ribosomal protein L28p
*
Streptomyces coelicolor A3(2)

Site:
position = -62
score = 5.60737
sequence = TACTGAAAATGAATTCCATTA

Gene: SCO3429: LSU ribosomal protein L28p
 
Tropheryma whipplei str. Twist
LSU ribosomal protein L28p
rpmG2
 
Acidothermus cellulolyticus 11B
 
Actinosynnema mirum DSM 43827

Gene: Amir_0606: LSU ribosomal protein L33p
 
Arthrobacter sp. FB24
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_1966: LSU ribosomal protein L33p
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Frankia sp. EAN1pec
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
*
Nakamurella multipartita DSM 44233

Site:
position = -44
score = 4.672
sequence = TACTGAGAATCGGTCTCGTTA

Gene: Namu_3855: LSU ribosomal protein L33p
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202

Gene: PPA2160: LSU ribosomal protein L33p
 
Rhodococcus sp. RHA1

Gene: RHA1_ro05616: LSU ribosomal protein L33p
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338

Gene: SACE_0753: LSU ribosomal protein L33p
*
Streptomyces coelicolor A3(2)

Site:
position = -31
score = 5.60737
sequence = TAATGGAATTCATTTTCAGTA

Gene: SCO3428: LSU ribosomal protein L33p
 
Tropheryma whipplei str. Twist
LSU ribosomal protein L33p
rpsN2
 
Acidothermus cellulolyticus 11B
 
Actinosynnema mirum DSM 43827

Gene: Amir_0605: SSU ribosomal protein S14p (S29e)
 
Arthrobacter sp. FB24
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_1967: SSU ribosomal protein S14p (S29e)
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Frankia sp. EAN1pec
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Nakamurella multipartita DSM 44233
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202

Gene: PPA2161: SSU ribosomal protein S14p (S29e)
 
Rhodococcus sp. RHA1

Gene: RHA1_ro05615: SSU ribosomal protein S14p (S29e)
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338

Gene: SACE_0752: SSU ribosomal protein S14p (S29e)
 
Streptomyces coelicolor A3(2)

Gene: SCO3430: SSU ribosomal protein S14p (S29e)
 
Tropheryma whipplei str. Twist
SSU ribosomal protein S14p (S29e)
rpsR2
 
Acidothermus cellulolyticus 11B
 
Actinosynnema mirum DSM 43827

Gene: Amir_0604: SSU ribosomal protein S18p
 
Arthrobacter sp. FB24
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Frankia sp. EAN1pec
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Nakamurella multipartita DSM 44233
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
 
Rhodococcus sp. RHA1

Gene: RHA1_ro05614: SSU ribosomal protein S18p
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338

Gene: SACE_0751: SSU ribosomal protein S18p
 
Streptomyces coelicolor A3(2)

Gene: SCO3425: SSU ribosomal protein S18p
 
Tropheryma whipplei str. Twist
SSU ribosomal protein S18p
rpmF2
 
Acidothermus cellulolyticus 11B
 
Actinosynnema mirum DSM 43827

Gene: Amir_4414: LSU ribosomal protein L32p
 
Arthrobacter sp. FB24
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_1970: LSU ribosomal protein L32p
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Frankia sp. EAN1pec
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Nakamurella multipartita DSM 44233
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202

Gene: PPA2162: LSU ribosomal protein L32p
 
Rhodococcus sp. RHA1

Gene: RHA1_ro05620: LSU ribosomal protein L32p
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338

Gene: SACE_0757: LSU ribosomal protein L32p
*
Streptomyces coelicolor A3(2)

Site:
position = -56
score = 4.63956
sequence = ACATGAACATCGTTTTCATGT

Gene: SCO0436: LSU ribosomal protein L32p
 
Tropheryma whipplei str. Twist
LSU ribosomal protein L32p
rpmE2
 
Acidothermus cellulolyticus 11B
 
Actinosynnema mirum DSM 43827

Gene: Amir_4415: LSU ribosomal protein L31p
 
Arthrobacter sp. FB24
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_1968: LSU ribosomal protein L31p
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Frankia sp. EAN1pec
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Nakamurella multipartita DSM 44233
 
Nocardioides sp. JS614
*
Propionibacterium acnes KPA171202

Site:
position = -73
score = 4.97672
sequence = ATATGAGAATCATTATCATAT

Gene: PPA2157: LSU ribosomal protein L31p
 
Rhodococcus sp. RHA1

Gene: RHA1_ro05619: LSU ribosomal protein L31p
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338

Gene: SACE_0756: LSU ribosomal protein L31p
 
Streptomyces coelicolor A3(2)

Gene: SCO3427: LSU ribosomal protein L31p
 
Tropheryma whipplei str. Twist
LSU ribosomal protein L31p
yciC
 
Acidothermus cellulolyticus 11B
*
Actinosynnema mirum DSM 43827

Site:
position = -53
score = 5.52795
sequence = AAATGACAATCGTTTCCGTTA

Gene: Amir_4416: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Arthrobacter sp. FB24
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Frankia sp. EAN1pec
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Nakamurella multipartita DSM 44233
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
 
Rhodococcus sp. RHA1
 
Saccharomonospora viridis DSM 43017
*
Saccharopolyspora erythraea NRRL 2338

Site:
position = -12
score = 4.95307
sequence = AAATGAAAACCGTTGCCGACT

Site:
position = -66
score = 5.46565
sequence = TAACGACATCCGTTTTCATTA

Gene: SACE_0755: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Streptomyces coelicolor A3(2)

Gene: SCO3426: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Tropheryma whipplei str. Twist
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
SCE9.38
 
Acidothermus cellulolyticus 11B
 
Actinosynnema mirum DSM 43827
 
Arthrobacter sp. FB24
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Frankia sp. EAN1pec
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Nakamurella multipartita DSM 44233
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
 
Rhodococcus sp. RHA1
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
 
Streptomyces coelicolor A3(2)

Gene: SCO3431: possible membrane protein
 
Tropheryma whipplei str. Twist
possible membrane protein
RHA1_ro05618
 
Acidothermus cellulolyticus 11B
 
Actinosynnema mirum DSM 43827
 
Arthrobacter sp. FB24
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Frankia sp. EAN1pec
 
Janibacter sp. HTCC2649
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Nakamurella multipartita DSM 44233
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
*
Rhodococcus sp. RHA1

Site:
position = -29
score = 5.41032
sequence = TAATGACAATCGTTATCGAAA

Site:
position = -83
score = 5.40215
sequence = TGATGACAATCATTTTCGACA

Gene: RHA1_ro05618: hypothetical protein
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
 
Streptomyces coelicolor A3(2)
 
Tropheryma whipplei str. Twist
hypothetical protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD