Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur - Mycobacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 70 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Mycobacterium abscessus ATCC 19977 11 4
Mycobacterium avium 104 11 6
Mycobacterium flavescens PYR-GCK 9 4
Mycobacterium leprae TN 4 1
Mycobacterium marinum M 22 5
Mycobacterium smegmatis str. MC2 155 15 6
Mycobacterium sp. JLS 14 6
Mycobacterium tuberculosis H37Rv 21 6
Mycobacterium vanbaalenii PYR-1 18 9
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
yciC3
 
Mycobacterium abscessus ATCC 19977
*
Mycobacterium avium 104

Site:
position = -81
score = 5.54983
sequence = AGATGAAAACGATTACCAATA

Site:
position = -136
score = 5.80851
sequence = TATTGAAAATCATTTTCGACA

Gene: MAV_4874: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*
Mycobacterium flavescens PYR-GCK

Site:
position = -87
score = 5.80851
sequence = TATTGAAAATCATTTTCGACA

Site:
position = -32
score = 5.30713
sequence = TATTGAAGATCATTCCCATTA

Gene: Mflv_1313: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Mycobacterium leprae TN
 
Mycobacterium marinum M
 
Mycobacterium smegmatis str. MC2 155
 
Mycobacterium sp. JLS
 
Mycobacterium tuberculosis H37Rv
*
Mycobacterium vanbaalenii PYR-1

Site:
position = -90
score = 5.54213
sequence = TATTGGAAATCGTTTTCGACA

Site:
position = -35
score = 5.79585
sequence = TATTGGAAATCATTCCCATTA

Gene: Mvan_5488: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
CRON 2.
Rv0282
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_2234c: Conserved hypothetical protein (AAA ATPase?)
*
Mycobacterium avium 104

Site:
position = -232
score = 6.21615
sequence = TAATGAAAATGATTTTCAGTA

Gene: MAV_4871: Conserved hypothetical protein (AAA ATPase?)
 
Mycobacterium flavescens PYR-GCK

Gene: Mflv_0329: Conserved hypothetical protein (AAA ATPase?)
*
Mycobacterium leprae TN

Site:
position = -153
score = 4.8334
sequence = ATATGATAATCGTATTCAGTA

Gene: ML2537: Conserved hypothetical protein (AAA ATPase?)
*
Mycobacterium marinum M

Site:
position = -265
score = 5.61682
sequence = TAATGAAAATCATGTTCACTA

Gene: MMAR_0541: Conserved hypothetical protein (AAA ATPase?)
 
Mycobacterium smegmatis str. MC2 155

Gene: MSMEG_0615: Conserved hypothetical protein (AAA ATPase?)
 
Mycobacterium sp. JLS

Gene: Mjls_0359: Conserved hypothetical protein (AAA ATPase?)
*
Mycobacterium tuberculosis H37Rv

Site:
position = -186
score = 5.66883
sequence = TAATGAAAATCATGTTCAGTA

Gene: Rv0282: Conserved hypothetical protein (AAA ATPase?)
 
Mycobacterium vanbaalenii PYR-1

Gene: Mvan_0411: Conserved hypothetical protein (AAA ATPase?)
Conserved hypothetical protein (AAA ATPase?)
Rv0283
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_2233c: hypothetical protein Rv0283
 
Mycobacterium avium 104

Gene: MAV_4870: hypothetical protein Rv0283
 
Mycobacterium flavescens PYR-GCK

Gene: Mflv_0328: hypothetical protein Rv0283
 
Mycobacterium leprae TN

Gene: ML2536: hypothetical protein Rv0283
 
Mycobacterium marinum M

Gene: MMAR_0542: hypothetical protein Rv0283
 
Mycobacterium smegmatis str. MC2 155

Gene: MSMEG_0616: hypothetical protein Rv0283
 
Mycobacterium sp. JLS

Gene: Mjls_0360: hypothetical protein Rv0283
 
Mycobacterium tuberculosis H37Rv

Gene: Rv0283: hypothetical protein Rv0283
 
Mycobacterium vanbaalenii PYR-1

Gene: Mvan_0412: hypothetical protein Rv0283
hypothetical protein Rv0283
Rv0284
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_2232c: conserved hypothetical protein
 
Mycobacterium avium 104
 
Mycobacterium flavescens PYR-GCK

Gene: Mflv_0327: conserved hypothetical protein
 
Mycobacterium leprae TN

Gene: ML2535: conserved hypothetical protein
 
Mycobacterium marinum M

Gene: MMAR_0543: conserved hypothetical protein
 
Mycobacterium smegmatis str. MC2 155

Gene: MSMEG_0617: conserved hypothetical protein
 
Mycobacterium sp. JLS

Gene: Mjls_0361: conserved hypothetical protein
 
Mycobacterium tuberculosis H37Rv

Gene: Rv0284: conserved hypothetical protein
 
Mycobacterium vanbaalenii PYR-1

Gene: Mvan_0413: conserved hypothetical protein
conserved hypothetical protein
Rv0285
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_2231c: PE domain-containing protein
 
Mycobacterium avium 104

Gene: MAV_4868: PE domain-containing protein
 
Mycobacterium flavescens PYR-GCK

Gene: Mflv_0326: PE domain-containing protein
 
Mycobacterium leprae TN

Gene: ML2534: PE domain-containing protein
 
Mycobacterium marinum M

Gene: MMAR_0544: PE domain-containing protein
 
Mycobacterium smegmatis str. MC2 155

Gene: MSMEG_0618: PE domain-containing protein
 
Mycobacterium sp. JLS

Gene: Mjls_0362: PE domain-containing protein
 
Mycobacterium tuberculosis H37Rv

Gene: Rv0285: PE domain-containing protein
 
Mycobacterium vanbaalenii PYR-1

Gene: Mvan_0414: PE domain-containing protein
PE domain-containing protein
Rv0286
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_2230c: PPE protein
 
Mycobacterium avium 104

Gene: MAV_4867: PPE protein
 
Mycobacterium flavescens PYR-GCK

Gene: Mflv_0325: PPE protein
 
Mycobacterium leprae TN
 
Mycobacterium marinum M

Gene: MMAR_0545: PPE protein
 
Mycobacterium smegmatis str. MC2 155

Gene: MSMEG_0619: PPE protein
 
Mycobacterium sp. JLS

Gene: Mjls_0363: PPE protein
 
Mycobacterium tuberculosis H37Rv

Gene: Rv0286: PPE protein
 
Mycobacterium vanbaalenii PYR-1

Gene: Mvan_0415: PPE protein
PPE protein
Rv0287
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_2229c: PE family protein
 
Mycobacterium avium 104

Gene: MAV_4866: PE family protein
 
Mycobacterium flavescens PYR-GCK

Gene: Mflv_0324: PE family protein
 
Mycobacterium leprae TN
 
Mycobacterium marinum M

Gene: MMAR_0546: PE family protein
 
Mycobacterium smegmatis str. MC2 155

Gene: MSMEG_0620: PE family protein
 
Mycobacterium sp. JLS

Gene: Mjls_0364: PE family protein
 
Mycobacterium tuberculosis H37Rv

Gene: Rv0287: PE family protein
 
Mycobacterium vanbaalenii PYR-1

Gene: Mvan_0417: PE family protein
PE family protein
Rv0288
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_2228c: hypothetical protein Rv0288
 
Mycobacterium avium 104

Gene: MAV_4865: hypothetical protein Rv0288
 
Mycobacterium flavescens PYR-GCK

Gene: Mflv_0323: hypothetical protein Rv0288
 
Mycobacterium leprae TN
 
Mycobacterium marinum M

Gene: MMAR_0547: hypothetical protein Rv0288
 
Mycobacterium smegmatis str. MC2 155

Gene: MSMEG_0621: hypothetical protein Rv0288
 
Mycobacterium sp. JLS

Gene: Mjls_0365: hypothetical protein Rv0288
 
Mycobacterium tuberculosis H37Rv

Gene: Rv0288: hypothetical protein Rv0288
 
Mycobacterium vanbaalenii PYR-1

Gene: Mvan_0418: hypothetical protein Rv0288
hypothetical protein Rv0288
Rv0289
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_2227c: hypothetical protein Rv0289
 
Mycobacterium avium 104

Gene: MAV_4864: hypothetical protein Rv0289
 
Mycobacterium flavescens PYR-GCK

Gene: Mflv_0322: hypothetical protein Rv0289
 
Mycobacterium leprae TN

Gene: ML2530: hypothetical protein Rv0289
 
Mycobacterium marinum M

Gene: MMAR_0548: hypothetical protein Rv0289
 
Mycobacterium smegmatis str. MC2 155

Gene: MSMEG_0622: hypothetical protein Rv0289
 
Mycobacterium sp. JLS

Gene: Mjls_0366: hypothetical protein Rv0289
 
Mycobacterium tuberculosis H37Rv

Gene: Rv0289: hypothetical protein Rv0289
 
Mycobacterium vanbaalenii PYR-1

Gene: Mvan_0419: hypothetical protein Rv0289
hypothetical protein Rv0289
Rv0290
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_2226c: hypothetical protein Rv0290
 
Mycobacterium avium 104

Gene: MAV_4863: hypothetical protein Rv0290
 
Mycobacterium flavescens PYR-GCK

Gene: Mflv_0321: hypothetical protein Rv0290
 
Mycobacterium leprae TN

Gene: ML2529: hypothetical protein Rv0290
 
Mycobacterium marinum M

Gene: MMAR_0549: hypothetical protein Rv0290
 
Mycobacterium smegmatis str. MC2 155

Gene: MSMEG_0623: hypothetical protein Rv0290
 
Mycobacterium sp. JLS

Gene: Mjls_0367: hypothetical protein Rv0290
 
Mycobacterium tuberculosis H37Rv

Gene: Rv0290: hypothetical protein Rv0290
 
Mycobacterium vanbaalenii PYR-1

Gene: Mvan_0420: hypothetical protein Rv0290
hypothetical protein Rv0290
Rv0291
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_2225c: Extracellular subtilisin-like protease precursor (EC 3.4.21.-)
 
Mycobacterium avium 104

Gene: MAV_4862: Extracellular subtilisin-like protease precursor (EC 3.4.21.-)
 
Mycobacterium flavescens PYR-GCK

Gene: Mflv_0320: Extracellular subtilisin-like protease precursor (EC 3.4.21.-)
 
Mycobacterium leprae TN

Gene: ML2528: Extracellular subtilisin-like protease precursor (EC 3.4.21.-)
 
Mycobacterium marinum M

Gene: MMAR_0550: Extracellular subtilisin-like protease precursor (EC 3.4.21.-)
 
Mycobacterium smegmatis str. MC2 155

Gene: MSMEG_0624: Extracellular subtilisin-like protease precursor (EC 3.4.21.-)
 
Mycobacterium sp. JLS

Gene: Mjls_0368: Extracellular subtilisin-like protease precursor (EC 3.4.21.-)
 
Mycobacterium tuberculosis H37Rv

Gene: Rv0291: Extracellular subtilisin-like protease precursor (EC 3.4.21.-)
 
Mycobacterium vanbaalenii PYR-1

Gene: Mvan_0421: Extracellular subtilisin-like protease precursor (EC 3.4.21.-)
Extracellular subtilisin-like protease precursor (EC 3.4.21.-)
Rv0292
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_2224c: hypothetical protein Rv0292
 
Mycobacterium avium 104

Gene: MAV_4860: hypothetical protein Rv0292
 
Mycobacterium flavescens PYR-GCK

Gene: Mflv_0319: hypothetical protein Rv0292
 
Mycobacterium leprae TN

Gene: ML2527: hypothetical protein Rv0292
 
Mycobacterium marinum M

Gene: MMAR_0551: hypothetical protein Rv0292
 
Mycobacterium smegmatis str. MC2 155

Gene: MSMEG_0626: hypothetical protein Rv0292
 
Mycobacterium sp. JLS

Gene: Mjls_0369: hypothetical protein Rv0292
 
Mycobacterium tuberculosis H37Rv

Gene: Rv0292: hypothetical protein Rv0292
 
Mycobacterium vanbaalenii PYR-1

Gene: Mvan_0422: hypothetical protein Rv0292
hypothetical protein Rv0292
 
CRON 3.
znuA
*
Mycobacterium abscessus ATCC 19977

Site:
position = -43
score = 6.45345
sequence = TAATGAAAATCGTTTTCATTA

Gene: MAB_0577c: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Mycobacterium avium 104

Site:
position = -63
score = 6.25081
sequence = TAATGGAAACGATTTTCATTA

Gene: MAV_0583: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Mycobacterium flavescens PYR-GCK

Site:
position = -2
score = 5.28781
sequence = TAATGAAAACGGTTATCGTAT

Gene: Mflv_1454: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Mycobacterium leprae TN

Gene: ML0337: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Mycobacterium marinum M

Site:
position = -32
score = 6.05626
sequence = TAATGGAAACGGTTGTCATTA

Gene: MMAR_5071: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Mycobacterium smegmatis str. MC2 155

Site:
position = -90
score = 6.09939
sequence = TATCGAAAATGATTTTCAATA

Site:
position = -44
score = 5.34837
sequence = TAATGCAAACGGTTATCGTTA

Gene: MSMEG_6047: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Mycobacterium sp. JLS

Site:
position = -88
score = 5.53056
sequence = AAATGCAAACCGTTATCATTA

Gene: Mjls_5104: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Mycobacterium tuberculosis H37Rv

Site:
position = -85
score = 5.80851
sequence = TATTGAAAATCATTTTCGACA

Site:
position = -30
score = 5.55538
sequence = TAATGAAAACTGTTATCGATA

Gene: Rv2059: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Mycobacterium vanbaalenii PYR-1

Site:
position = -81
score = 6.31201
sequence = TAATGATAATCATTTTCAATA

Site:
position = -25
score = 5.24684
sequence = TAATGAAAACGGTTATCGTTG

Gene: Mvan_5320: Zinc ABC transporter, periplasmic-binding protein ZnuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_0576c: Zinc ABC transporter, ATP-binding protein ZnuC
 
Mycobacterium avium 104

Gene: MAV_0582: Zinc ABC transporter, ATP-binding protein ZnuC
 
Mycobacterium flavescens PYR-GCK

Gene: Mflv_1455: Zinc ABC transporter, ATP-binding protein ZnuC
 
Mycobacterium leprae TN

Gene: ML0336: Zinc ABC transporter, ATP-binding protein ZnuC
 
Mycobacterium marinum M

Gene: MMAR_5072: Zinc ABC transporter, ATP-binding protein ZnuC
 
Mycobacterium smegmatis str. MC2 155

Gene: MSMEG_6046: Zinc ABC transporter, ATP-binding protein ZnuC
 
Mycobacterium sp. JLS

Gene: Mjls_5103: Zinc ABC transporter, ATP-binding protein ZnuC
 
Mycobacterium tuberculosis H37Rv
 
Mycobacterium vanbaalenii PYR-1

Gene: Mvan_5319: Zinc ABC transporter, ATP-binding protein ZnuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_0575c: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Mycobacterium avium 104

Gene: MAV_0581: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Mycobacterium flavescens PYR-GCK

Gene: Mflv_1456: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Mycobacterium leprae TN

Gene: ML0335: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Mycobacterium marinum M

Gene: MMAR_5073: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Mycobacterium smegmatis str. MC2 155

Gene: MSMEG_6045: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Mycobacterium sp. JLS

Gene: Mjls_5102: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Mycobacterium tuberculosis H37Rv

Gene: Rv2060: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Mycobacterium vanbaalenii PYR-1

Gene: Mvan_5318: Zinc ABC transporter, inner membrane permease protein ZnuB
Zinc ABC transporter, inner membrane permease protein ZnuB
lamB
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_0574c: Conserved hypothetical protein (LamB/YcsF)
 
Mycobacterium avium 104

Gene: MAV_0580: Conserved hypothetical protein (LamB/YcsF)
 
Mycobacterium flavescens PYR-GCK

Gene: Mflv_1451: Conserved hypothetical protein (LamB/YcsF)
 
Mycobacterium leprae TN

Gene: ML0333: Conserved hypothetical protein (LamB/YcsF)
 
Mycobacterium marinum M
 
Mycobacterium smegmatis str. MC2 155

Gene: MSMEG_6054: Conserved hypothetical protein (LamB/YcsF)
 
Mycobacterium sp. JLS

Gene: Mjls_5112: Conserved hypothetical protein (LamB/YcsF)
 
Mycobacterium tuberculosis H37Rv
 
Mycobacterium vanbaalenii PYR-1

Gene: Mvan_5327: Conserved hypothetical protein (LamB/YcsF)
Conserved hypothetical protein (LamB/YcsF)
znuC2
 
Mycobacterium abscessus ATCC 19977
 
Mycobacterium avium 104
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium leprae TN
 
Mycobacterium marinum M
*
Mycobacterium smegmatis str. MC2 155

Site:
position = -31
score = 5.92825
sequence = TAATGATAATCGTTTTCAAAA

Gene: MSMEG_6052: Zinc ABC transporter, ATP-binding protein ZnuC
*
Mycobacterium sp. JLS

Site:
position = -2
score = 6.21096
sequence = TAATGAAAATCATTTTCAACA

Gene: Mjls_5111: Zinc ABC transporter, ATP-binding protein ZnuC
 
Mycobacterium tuberculosis H37Rv
*
Mycobacterium vanbaalenii PYR-1

Site:
position = -2
score = 6.37103
sequence = TAATGACAATCATTTTCAATA

Gene: Mvan_5326: Zinc ABC transporter, ATP-binding protein ZnuC
Zinc ABC transporter, ATP-binding protein ZnuC
bluB
 
Mycobacterium abscessus ATCC 19977
 
Mycobacterium avium 104
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium leprae TN
 
Mycobacterium marinum M
 
Mycobacterium smegmatis str. MC2 155

Gene: MSMEG_6053: Cobalamin biosynthesis protein BluB @ 5,6-dimethylbenzimidazole synthase, flavin destructase family
 
Mycobacterium sp. JLS
 
Mycobacterium tuberculosis H37Rv
 
Mycobacterium vanbaalenii PYR-1
Putative nitroreductase
yciC
*
Mycobacterium abscessus ATCC 19977

Site:
position = -106
score = 5.32049
sequence = TAATGGGAATCATTTTCGACA

Site:
position = -51
score = 5.78413
sequence = TAATGAAAATCGTTTGCATTT

Gene: MAB_0335: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Mycobacterium avium 104
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium leprae TN
*
Mycobacterium marinum M

Site:
position = -51
score = 6.43811
sequence = TAATGAAAATCGTTTTCAATA

Site:
position = -107
score = 5.80851
sequence = TATTGAAAATCATTTTCGACA

Gene: MMAR_0293: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*
Mycobacterium smegmatis str. MC2 155

Site:
position = -54
score = 6.3073
sequence = TAATGACAATCGTTTTCAATA

Gene: MSMEG_6069: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*
Mycobacterium sp. JLS

Site:
position = -88
score = 5.74477
sequence = TATTGAAAACCATTTTCGACA

Site:
position = -33
score = 5.70036
sequence = TATTGACAATCGTTCTCAACA

Gene: Mjls_5117: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*
Mycobacterium tuberculosis H37Rv

Site:
position = -31
score = 6.16839
sequence = TAATGGCAATCATTTTCAATA

Site:
position = -85
score = 5.21184
sequence = TGTTGAAAATAGTTTTCGACA

Gene: Rv0106: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*
Mycobacterium vanbaalenii PYR-1

Site:
position = -31
score = 5.92742
sequence = TAATGGAAATGATTTTCGTTA

Gene: Mvan_5332: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
rpmE2
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_0336: 50S ribosomal protein L31
 
Mycobacterium avium 104
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium leprae TN
 
Mycobacterium marinum M

Gene: MMAR_0294: 50S ribosomal protein L31
 
Mycobacterium smegmatis str. MC2 155

Gene: MSMEG_6070: 50S ribosomal protein L31
 
Mycobacterium sp. JLS
 
Mycobacterium tuberculosis H37Rv
*
Mycobacterium vanbaalenii PYR-1

Site:
position = -40
score = 6.23547
sequence = TAATGGAAATGGTTTTCAATA

Gene: Mvan_5333: 50S ribosomal protein L31
50S ribosomal protein L31
 
CRON 4.
znuB2
 
Mycobacterium abscessus ATCC 19977
 
Mycobacterium avium 104
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium leprae TN
 
Mycobacterium marinum M
 
Mycobacterium smegmatis str. MC2 155
*2
Mycobacterium sp. JLS

Gene: Mjls_5109: Zinc ABC transporter, inner membrane permease protein ZnuB

Site:
position = -90
score = 6.21096
sequence = TGTTGAAAATGATTTTCATTA

Gene: Mjls_5110: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Mycobacterium tuberculosis H37Rv
*
Mycobacterium vanbaalenii PYR-1

Site:
position = -39
score = 6.37103
sequence = TATTGAAAATGATTGTCATTA

Gene: Mvan_5325: Zinc ABC transporter, inner membrane permease protein ZnuB
Zinc ABC transporter, inner membrane permease protein ZnuB
znuA2
 
Mycobacterium abscessus ATCC 19977
 
Mycobacterium avium 104
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium leprae TN
 
Mycobacterium marinum M
 
Mycobacterium smegmatis str. MC2 155

Gene: MSMEG_6050: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Mycobacterium sp. JLS

Gene: Mjls_5108: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Mycobacterium tuberculosis H37Rv
 
Mycobacterium vanbaalenii PYR-1

Gene: Mvan_5324: Zinc ABC transporter, periplasmic-binding protein ZnuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
Mflv_3560
 
Mycobacterium abscessus ATCC 19977
 
Mycobacterium avium 104
*
Mycobacterium flavescens PYR-GCK

Site:
position = -39
score = 6.051
sequence = TTTTGACAATGATTTTCATTA

Gene: Mflv_3560: putative secreted protein
 
Mycobacterium leprae TN
 
Mycobacterium marinum M
 
Mycobacterium smegmatis str. MC2 155

Gene: MSMEG_6049: putative secreted protein
 
Mycobacterium sp. JLS

Gene: Mjls_5107: putative secreted protein
 
Mycobacterium tuberculosis H37Rv
 
Mycobacterium vanbaalenii PYR-1

Gene: Mvan_5323: putative secreted protein
putative secreted protein
 
CRON 5.
yciC2
*
Mycobacterium abscessus ATCC 19977

Site:
position = -19
score = 4.69736
sequence = TAATGGTTATCATTATCATGT

Site:
position = -25
score = 6.07378
sequence = TAATGATAATGGTTATCATTA

Gene: MAB_1046c: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Mycobacterium avium 104
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium leprae TN
 
Mycobacterium marinum M
*
Mycobacterium smegmatis str. MC2 155

Site:
position = -76
score = 5.34837
sequence = TAACGATAACCGTTTGCATTA

Site:
position = -30
score = 6.09939
sequence = TATTGAAAATCATTTTCGATA

Gene: MSMEG_6048: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Mycobacterium sp. JLS
 
Mycobacterium tuberculosis H37Rv
*
Mycobacterium vanbaalenii PYR-1

Site:
position = -8
score = 6.31201
sequence = TATTGAAAATGATTATCATTA

Site:
position = -64
score = 5.24684
sequence = CAACGATAACCGTTTTCATTA

Gene: Mvan_5321: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
CRON 6.
znr
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_1679c: Zinc homeostasis transcriptional regulator Znr, ArsR family
 
Mycobacterium avium 104

Gene: MAV_2037: Zinc homeostasis transcriptional regulator Znr, ArsR family
 
Mycobacterium flavescens PYR-GCK

Gene: Mflv_2718: Zinc homeostasis transcriptional regulator Znr, ArsR family
 
Mycobacterium leprae TN

Gene: ML0825: Zinc homeostasis transcriptional regulator Znr, ArsR family
 
Mycobacterium marinum M

Gene: MMAR_3668: Zinc homeostasis transcriptional regulator Znr, ArsR family
*
Mycobacterium smegmatis str. MC2 155

Site:
position = -20
score = 6.03054
sequence = TAATGAAAACGATTTCCAATT

Gene: MSMEG_4486: Zinc homeostasis transcriptional regulator Znr, ArsR family
*
Mycobacterium sp. JLS

Site:
position = -2
score = 5.65889
sequence = TAATGAAAATCGTTTCCAGCA

Gene: Mjls_3457: Zinc homeostasis transcriptional regulator Znr, ArsR family
 
Mycobacterium tuberculosis H37Rv

Gene: Rv2358: Zinc homeostasis transcriptional regulator Znr, ArsR family
*
Mycobacterium vanbaalenii PYR-1

Site:
position = -2
score = 5.88604
sequence = TAATGAAAACGGTTTCCAGTA

Gene: Mvan_3819: Zinc homeostasis transcriptional regulator Znr, ArsR family
Zinc homeostasis transcriptional regulator Znr, ArsR family
zur
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_1678c: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Mycobacterium avium 104

Gene: MAV_2036: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Mycobacterium flavescens PYR-GCK

Gene: Mflv_2717: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Mycobacterium leprae TN

Gene: ML0824: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Mycobacterium marinum M

Gene: MMAR_3669: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Mycobacterium smegmatis str. MC2 155

Gene: MSMEG_4487: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Mycobacterium sp. JLS

Gene: Mjls_3458: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Mycobacterium tuberculosis H37Rv

Gene: Rv2359: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Mycobacterium vanbaalenii PYR-1

Gene: Mvan_3820: Zinc homeostasis transcriptional regulator Zur, Fur family
Zinc homeostasis transcriptional regulator Zur, Fur family
 
CRON 7.
ppe3
 
Mycobacterium abscessus ATCC 19977
*2
Mycobacterium avium 104

Site:
position = -69
score = 4.39248
sequence = GGTTGATAACGATAATCATTT

Site:
position = -63
score = 5.94023
sequence = TAACGATAATCATTTTCATTA

Gene: MAV_4879: PPE family protein, PPE3

Site:
position = -71
score = 4.67271
sequence = TGCTGATAACGATAATCATTT

Site:
position = -65
score = 5.38226
sequence = TAACGATAATCATTTTCACTT

Gene: MAV_4349: PPE family protein, PPE3
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium leprae TN
*
Mycobacterium marinum M

Site:
position = -36
score = 5.28633
sequence = TAATGACAATCATATTCATCT

Gene: MMAR_0538: PPE family protein, PPE3
 
Mycobacterium smegmatis str. MC2 155
 
Mycobacterium sp. JLS
*
Mycobacterium tuberculosis H37Rv

Site:
position = -43
score = 5.67898
sequence = TAATGAAAATCATGTTCATCA

Gene: Rv0280: PPE family protein, PPE3
 
Mycobacterium vanbaalenii PYR-1
PPE family protein, PPE3
Rv0281
 
Mycobacterium abscessus ATCC 19977
 
Mycobacterium avium 104
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium leprae TN
 
Mycobacterium marinum M

Gene: MMAR_0539: hypothetical protein Rv0281
 
Mycobacterium smegmatis str. MC2 155
 
Mycobacterium sp. JLS
 
Mycobacterium tuberculosis H37Rv

Gene: Rv0281: hypothetical protein Rv0281
 
Mycobacterium vanbaalenii PYR-1
hypothetical protein Rv0281
 
CRON 8.
rpmB1
*
Mycobacterium abscessus ATCC 19977

Site:
position = -35
score = 5.32049
sequence = TGTCGAAAATGATTCCCATTA

Site:
position = -90
score = 5.78413
sequence = AAATGCAAACGATTTTCATTA

Gene: MAB_0334c: 50S ribosomal protein L28
*
Mycobacterium avium 104

Site:
position = -38
score = 5.80851
sequence = TGTCGAAAATGATTTTCAATA

Site:
position = -93
score = 5.54983
sequence = TATTGGTAATCGTTTTCATCT

Gene: MAV_4875: 50S ribosomal protein L28
*
Mycobacterium flavescens PYR-GCK

Site:
position = -99
score = 5.30713
sequence = TAATGGGAATGATCTTCAATA

Site:
position = -44
score = 5.80851
sequence = TGTCGAAAATGATTTTCAATA

Gene: Mflv_1312: 50S ribosomal protein L28
 
Mycobacterium leprae TN
*
Mycobacterium marinum M

Site:
position = -43
score = 5.80851
sequence = TGTCGAAAATGATTTTCAATA

Site:
position = -99
score = 6.43811
sequence = TATTGAAAACGATTTTCATTA

Gene: MMAR_0292: 50S ribosomal protein L28
*
Mycobacterium smegmatis str. MC2 155

Site:
position = -55
score = 6.3073
sequence = TATTGAAAACGATTGTCATTA

Gene: MSMEG_6068: 50S ribosomal protein L28
*
Mycobacterium sp. JLS

Site:
position = -34
score = 5.74477
sequence = TGTCGAAAATGGTTTTCAATA

Site:
position = -89
score = 5.70036
sequence = TGTTGAGAACGATTGTCAATA

Gene: Mjls_5116: 50S ribosomal protein L28
*2
Mycobacterium tuberculosis H37Rv

Site:
position = -103
score = 5.55538
sequence = TATCGATAACAGTTTTCATTA

Site:
position = -48
score = 5.80851
sequence = TGTCGAAAATGATTTTCAATA

Gene: Rv2058c: 50S ribosomal protein L28

Site:
position = -99
score = 6.16839
sequence = TATTGAAAATGATTGCCATTA

Site:
position = -45
score = 5.21184
sequence = TGTCGAAAACTATTTTCAACA

Gene: Rv0105c: 50S ribosomal protein L28
*
Mycobacterium vanbaalenii PYR-1

Site:
position = -33
score = 5.54213
sequence = TGTCGAAAACGATTTCCAATA

Site:
position = -88
score = 5.79585
sequence = TAATGGGAATGATTTCCAATA

Gene: Mvan_5489: 50S ribosomal protein L28
50S ribosomal protein L28
rpmG1
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_0333c: 50S ribosomal protein L33
 
Mycobacterium avium 104

Gene: MAV_4876: 50S ribosomal protein L33
 
Mycobacterium flavescens PYR-GCK

Gene: Mflv_1311: 50S ribosomal protein L33
 
Mycobacterium leprae TN
 
Mycobacterium marinum M

Gene: MMAR_0291: 50S ribosomal protein L33
 
Mycobacterium smegmatis str. MC2 155

Gene: MSMEG_6067: 50S ribosomal protein L33
 
Mycobacterium sp. JLS

Gene: Mjls_5115: 50S ribosomal protein L33
 
Mycobacterium tuberculosis H37Rv

Gene: Rv2057c: 50S ribosomal protein L33
 
Mycobacterium vanbaalenii PYR-1

Gene: Mvan_5490: 50S ribosomal protein L33
50S ribosomal protein L33
rpsN2
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_0332c: SSU ribosomal protein S14p
 
Mycobacterium avium 104
 
Mycobacterium flavescens PYR-GCK

Gene: Mflv_1310: SSU ribosomal protein S14p
 
Mycobacterium leprae TN
 
Mycobacterium marinum M

Gene: MMAR_0290: SSU ribosomal protein S14p
 
Mycobacterium smegmatis str. MC2 155

Gene: MSMEG_6066: SSU ribosomal protein S14p
 
Mycobacterium sp. JLS
 
Mycobacterium tuberculosis H37Rv

Gene: Rv2056c: SSU ribosomal protein S14p
 
Mycobacterium vanbaalenii PYR-1

Gene: Mvan_5491: SSU ribosomal protein S14p
SSU ribosomal protein S14p
rpsR1
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_0331c: 30S ribosomal protein S18
 
Mycobacterium avium 104
 
Mycobacterium flavescens PYR-GCK

Gene: Mflv_1309: 30S ribosomal protein S18
 
Mycobacterium leprae TN
 
Mycobacterium marinum M

Gene: MMAR_0289: 30S ribosomal protein S18
 
Mycobacterium smegmatis str. MC2 155

Gene: MSMEG_6065: 30S ribosomal protein S18
 
Mycobacterium sp. JLS
 
Mycobacterium tuberculosis H37Rv

Gene: Rv2055c: 30S ribosomal protein S18
 
Mycobacterium vanbaalenii PYR-1

Gene: Mvan_5492: 30S ribosomal protein S18
30S ribosomal protein S18
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD