Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Fur - Shewanellaceae

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 505 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Shewanella oneidensis MR-1 58 32
Shewanella putrefaciens CN-32 67 39
Shewanella sp W3-18-1 62 37
Shewanella sp ANA-3 65 36
Shewanella sp MR-4 58 35
Shewanella sp MR-7 58 35
Shewanella baltica OS155 60 36
Shewanella denitrificans OS217 58 22
Shewanella frigidimarina NCIMB 400 39 24
Shewanella amazonensis SB2B 43 24
Shewanella loihica PV-4 34 21
Shewanella pealeana ATCC 700345 46 26
Shewanella halifaxensis HAW-EB4 42 24
Shewanella piezotolerans WP3 70 33
Shewanella sediminis HAW-EB3 35 23
Shewanella woodyi ATCC 51908 48 29
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
tonB
*
Shewanella oneidensis MR-1

Site:
position = -97
score = 5.72154
sequence = AAATAGAAATCATTATCATTT

Gene: SO3670: TonB mediated energy transduction system, energy transducer component, TonB
*
Shewanella putrefaciens CN-32

Site:
position = -75
score = 6.0511
sequence = AAATGGTAATCATTATCATTT

Gene: Sputcn32_0965: TonB mediated energy transduction system, energy transducer component, TonB
*
Shewanella sp W3-18-1

Site:
position = -75
score = 6.0511
sequence = AAATGGTAATCATTATCATTT

Gene: Sputw3181_3202: TonB mediated energy transduction system, energy transducer component, TonB
*
Shewanella sp ANA-3

Site:
position = -98
score = 6.01763
sequence = AAATGGAAATCATTATCATTT

Gene: Shewana3_3236: TonB mediated energy transduction system, energy transducer component, TonB
 
Shewanella sp MR-4
 
Shewanella sp MR-7
*
Shewanella baltica OS155

Site:
position = -63
score = 6.10539
sequence = AAATGCAAATCATTATCATTT

Gene: Sbal_0951: TonB mediated energy transduction system, energy transducer component, TonB
*
Shewanella denitrificans OS217

Site:
position = -66
score = 6.468
sequence = AAATGAAAATCATTATCATTT

Gene: Sden_0789: TonB mediated energy transduction system, energy transducer component, TonB
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
*
Shewanella pealeana ATCC 700345

Site:
position = -206
score = 6.468
sequence = AAATGAAAATCATTATCATTT

Gene: Spea_3328: TonB mediated energy transduction system, energy transducer component, TonB
*
Shewanella halifaxensis HAW-EB4

Site:
position = -207
score = 6.468
sequence = AAATGAAAATCATTATCATTT

Gene: Shal_3400: TonB mediated energy transduction system, energy transducer component, TonB
*
Shewanella piezotolerans WP3

Site:
position = -183
score = 6.468
sequence = AAATGAAAATCATTATCATTT

Gene: swp_3979: TonB mediated energy transduction system, energy transducer component, TonB
 
Shewanella sediminis HAW-EB3
*
Shewanella woodyi ATCC 51908

Site:
position = -80
score = 6.468
sequence = AAATGAAAATCATTATCATTT

Gene: Swoo_4005: TonB mediated energy transduction system, energy transducer component, TonB
TonB mediated energy transduction system, energy transducer component, TonB
exbB
 
Shewanella oneidensis MR-1

Gene: SO3671: TonB mediated energy transduction system, inner membrane component, ExbB
*
Shewanella putrefaciens CN-32

Site:
position = -31
score = 5.18715
sequence = AAATGATAATTATCATGATTA

Gene: Sputcn32_0964: TonB mediated energy transduction system, inner membrane component, ExbB
*
Shewanella sp W3-18-1

Site:
position = -31
score = 5.18715
sequence = AAATGATAATTATCATGATTA

Gene: Sputw3181_3203: TonB mediated energy transduction system, inner membrane component, ExbB
 
Shewanella sp ANA-3

Gene: Shewana3_3237: TonB mediated energy transduction system, inner membrane component, ExbB
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155

Gene: Sbal_0950: TonB mediated energy transduction system, inner membrane component, ExbB
 
Shewanella denitrificans OS217

Gene: Sden_0788: TonB mediated energy transduction system, inner membrane component, ExbB
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345

Gene: Spea_3329: TonB mediated energy transduction system, inner membrane component, ExbB
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3401: TonB mediated energy transduction system, inner membrane component, ExbB
 
Shewanella piezotolerans WP3

Gene: swp_3980: TonB mediated energy transduction system, inner membrane component, ExbB
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908

Gene: Swoo_4006: TonB mediated energy transduction system, inner membrane component, ExbB
TonB mediated energy transduction system, inner membrane component, ExbB
exbD
 
Shewanella oneidensis MR-1

Gene: SO3672: TonB mediated energy transduction system, inner membrane component, ExbD
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0963: TonB mediated energy transduction system, inner membrane component, ExbD
 2
Shewanella sp W3-18-1

Gene: Sputw3181_3213: TonB mediated energy transduction system, inner membrane component, ExbD

Gene: Sputw3181_3204: TonB mediated energy transduction system, inner membrane component, ExbD
 
Shewanella sp ANA-3

Gene: Shewana3_3238: TonB mediated energy transduction system, inner membrane component, ExbD
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155

Gene: Sbal_0949: TonB mediated energy transduction system, inner membrane component, ExbD
 
Shewanella denitrificans OS217

Gene: Sden_0787: TonB mediated energy transduction system, inner membrane component, ExbD
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345

Gene: Spea_3330: TonB mediated energy transduction system, inner membrane component, ExbD
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3402: TonB mediated energy transduction system, inner membrane component, ExbD
 
Shewanella piezotolerans WP3

Gene: swp_3981: TonB mediated energy transduction system, inner membrane component, ExbD
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908

Gene: Swoo_4007: TonB mediated energy transduction system, inner membrane component, ExbD
TonB mediated energy transduction system, inner membrane component, ExbD
hmuB
 
Shewanella oneidensis MR-1

Gene: SO3673: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0962: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
 
Shewanella sp W3-18-1

Gene: Sputw3181_3214: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
 
Shewanella sp ANA-3

Gene: Shewana3_3239: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155

Gene: Sbal_0948: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
 
Shewanella denitrificans OS217

Gene: Sden_0786: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345

Gene: Spea_3331: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3403: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
 
Shewanella piezotolerans WP3

Gene: swp_3982: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908

Gene: Swoo_4008: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
hmuC
 
Shewanella oneidensis MR-1

Gene: SO3674: ABC hemin transporter, inner membrane subunit, HmuC
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0961: ABC hemin transporter, inner membrane subunit, HmuC
 
Shewanella sp W3-18-1

Gene: Sputw3181_3215: ABC hemin transporter, inner membrane subunit, HmuC
 
Shewanella sp ANA-3

Gene: Shewana3_3240: ABC hemin transporter, inner membrane subunit, HmuC
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155

Gene: Sbal_0947: ABC hemin transporter, inner membrane subunit, HmuC
 
Shewanella denitrificans OS217

Gene: Sden_0785: ABC hemin transporter, inner membrane subunit, HmuC
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345

Gene: Spea_3332: ABC hemin transporter, inner membrane subunit, HmuC
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3404: ABC hemin transporter, inner membrane subunit, HmuC
 
Shewanella piezotolerans WP3

Gene: swp_3983: ABC hemin transporter, inner membrane subunit, HmuC
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908

Gene: Swoo_4009: ABC hemin transporter, inner membrane subunit, HmuC
ABC hemin transporter, inner membrane subunit, HmuC
hmuD
 
Shewanella oneidensis MR-1

Gene: SO_3675: ABC hemin transporter, ATPase subunit, HmuD
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0960: ABC hemin transporter, ATPase subunit, HmuD
 
Shewanella sp W3-18-1

Gene: Sputw3181_3216: ABC hemin transporter, ATPase subunit, HmuD
 
Shewanella sp ANA-3

Gene: Shewana3_3241: ABC hemin transporter, ATPase subunit, HmuD
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155

Gene: Sbal_0946: ABC hemin transporter, ATPase subunit, HmuD
 
Shewanella denitrificans OS217

Gene: Sden_0784: ABC hemin transporter, ATPase subunit, HmuD
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345

Gene: Spea_3333: ABC hemin transporter, ATPase subunit, HmuD
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3405: ABC hemin transporter, ATPase subunit, HmuD
 
Shewanella piezotolerans WP3

Gene: swp_3984: ABC hemin transporter, ATPase subunit, HmuD
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908

Gene: Swoo_4010: ABC hemin transporter, ATPase subunit, HmuD
ABC hemin transporter, ATPase subunit, HmuD
 
CRON 2.
Shewmr4_0531
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
*
Shewanella sp MR-4

Site:
position = -145
score = 5.68847
sequence = AAATGATAATTATTTACATTA

Gene: Shewmr4_0531: TonB-dependent siderophore receptor
*
Shewanella sp MR-7

Site:
position = -145
score = 5.68847
sequence = AAATGATAATTATTTACATTA

Gene: Shewmr7_3500: TonB-dependent siderophore receptor
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
TonB-dependent siderophore receptor
 
CRON 3.
Shewmr4_0304
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
*
Shewanella sp ANA-3

Site:
position = -194
score = 5.62142
sequence = AATTAATAACAATTCTCAATT

Gene: Shewana3_0299: TonB-dependent siderophore receptor
*
Shewanella sp MR-4

Site:
position = -193
score = 5.05746
sequence = AATTAAGAACGATTCTCGATT

Gene: Shewmr4_0304: TonB-dependent siderophore receptor
*
Shewanella sp MR-7

Site:
position = -192
score = 5.05746
sequence = AATTAAGAACGATTCTCGATT

Gene: Shewmr7_3720: TonB-dependent siderophore receptor
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
TonB-dependent siderophore receptor
 
CRON 4.
Sputcn32_3636
 
Shewanella oneidensis MR-1
*
Shewanella putrefaciens CN-32

Site:
position = -77
score = 5.30052
sequence = TAATGTTAATCATTATCATTC

Gene: Sputcn32_3636: TonB-dependent receptor
*
Shewanella sp W3-18-1

Site:
position = -77
score = 5.30052
sequence = TAATGTTAATCATTATCATTC

Gene: Sputw3181_3776: TonB-dependent receptor
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
TonB-dependent receptor
 
CRON 5.
Sputcn32_3671
 
Shewanella oneidensis MR-1
*
Shewanella putrefaciens CN-32

Site:
position = -54
score = 5.65639
sequence = AATTGATAACTATTCTCATTG

Gene: Sputcn32_3671: TonB-dependent receptor
*
Shewanella sp W3-18-1

Site:
position = -53
score = 5.65639
sequence = AATTGATAACTATTCTCATTG

Gene: Sputw3181_3812: TonB-dependent receptor
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
TonB-dependent receptor
Sputcn32_3670
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3670: Transcriptional regulator, TetR family
 
Shewanella sp W3-18-1

Gene: Sputw3181_3811: Transcriptional regulator, TetR family
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Transcriptional regulator, TetR family
Sputcn32_3669
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3669: Ferric siderophore ABC transporter, permease protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_3810: Ferric siderophore ABC transporter, permease protein
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Ferric siderophore ABC transporter, permease protein
Sputcn32_3668
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3668: Ferric siderophore ABC transporter, permease protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_3809: Ferric siderophore ABC transporter, permease protein
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Ferric siderophore ABC transporter, permease protein
Sputcn32_3667
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3667: Ferric siderophore ABC transporter, ATP-binding protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_3808: Ferric siderophore ABC transporter, ATP-binding protein
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Ferric siderophore ABC transporter, ATP-binding protein
Sputcn32_3666
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3666: Putative iron transport protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_3807: Putative iron transport protein
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Putative iron transport protein
 
CRON 6.
Sputcn32_1590
 
Shewanella oneidensis MR-1
*
Shewanella putrefaciens CN-32

Site:
position = -101
score = 5.96727
sequence = AAATGAGAATTATTGTCATCT

Gene: Sputcn32_1590: TonB-dependent siderophore receptor
*
Shewanella sp W3-18-1

Site:
position = -101
score = 5.96727
sequence = AAATGAGAATTATTGTCATCT

Gene: Sputw3181_2432: TonB-dependent siderophore receptor
*
Shewanella sp ANA-3

Site:
position = -99
score = 5.96727
sequence = AAATGAGAATTATTGTCATCT

Gene: Shewana3_2551: TonB-dependent siderophore receptor
*
Shewanella sp MR-4

Site:
position = -98
score = 6.20627
sequence = AAATGAGAATTATTGTCATTT

Gene: Shewmr4_2386: TonB-dependent siderophore receptor
*
Shewanella sp MR-7

Site:
position = -98
score = 5.54419
sequence = AAATGAGAATTATTGTCACCT

Gene: Shewmr7_2458: TonB-dependent siderophore receptor
 
Shewanella baltica OS155

Gene: Sbal_1729: TonB-dependent siderophore receptor
 
Shewanella denitrificans OS217
*
Shewanella frigidimarina NCIMB 400

Site:
position = -75
score = 5.71032
sequence = AAATGAGAATAGTTTCCATTA

Gene: Sfri_0391: TonB-dependent siderophore receptor
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
TonB-dependent siderophore receptor
 
CRON 7.
Sputcn32_1841
 
Shewanella oneidensis MR-1
*
Shewanella putrefaciens CN-32

Site:
position = -85
score = 5.16415
sequence = TAATACGAATTGTTATCAATA

Site:
position = -59
score = 5.73917
sequence = TATTGATAATTGTTTTCAATT

Gene: Sputcn32_1841: TonB-dependent siderophore receptor
*
Shewanella sp W3-18-1

Site:
position = -85
score = 5.16415
sequence = TAATACGAATTGTTATCAATA

Site:
position = -59
score = 5.73917
sequence = TATTGATAATTGTTTTCAATT

Gene: Sputw3181_2168: TonB-dependent siderophore receptor
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
TonB-dependent siderophore receptor
 
CRON 8.
Sputcn32_3863
 
Shewanella oneidensis MR-1
*
Shewanella putrefaciens CN-32

Site:
position = -21
score = 5.286
sequence = AAATGAAAACTATTCGTAATA

Gene: Sputcn32_3863: TonB-dependent siderophore receptor
*
Shewanella sp W3-18-1

Site:
position = -21
score = 5.286
sequence = AAATGAAAACTATTCGTAATA

Gene: Sputw3181_0090: TonB-dependent siderophore receptor
*
Shewanella sp ANA-3

Site:
position = -63
score = 5.24651
sequence = AAATGCAAATCGTTCTCAATG

Gene: Shewana3_0952: TonB-dependent siderophore receptor
*
Shewanella sp MR-4

Site:
position = -57
score = 5.5683
sequence = AAATGCAAATCGTTCTCAATA

Gene: Shewmr4_0950: TonB-dependent siderophore receptor
*
Shewanella sp MR-7

Site:
position = -57
score = 5.5683
sequence = AAATGCAAATCGTTCTCAATA

Gene: Shewmr7_0988: TonB-dependent siderophore receptor
*
Shewanella baltica OS155

Site:
position = -63
score = 4.78537
sequence = AAATAAAAGTGATTCGCAATA

Gene: Sbal_2136: TonB-dependent siderophore receptor
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
TonB-dependent siderophore receptor
 
CRON 9.
Sputcn32_1826
 
Shewanella oneidensis MR-1
*
Shewanella putrefaciens CN-32

Site:
position = -48
score = 5.10801
sequence = CATTAAGAATAATTATCATTC

Gene: Sputcn32_1826: TonB-dependent receptor
*
Shewanella sp W3-18-1

Site:
position = -48
score = 5.10801
sequence = CATTAAGAATAATTATCATTC

Gene: Sputw3181_2183: TonB-dependent receptor
*
Shewanella sp ANA-3

Site:
position = -47
score = 5.20657
sequence = ATTTAAGAATAATTATCATTC

Gene: Shewana3_1861: TonB-dependent receptor
*
Shewanella sp MR-4

Site:
position = -47
score = 5.20657
sequence = ATTTAAGAATAATTATCATTC

Gene: Shewmr4_1806: TonB-dependent receptor
*
Shewanella sp MR-7

Site:
position = -47
score = 5.20657
sequence = ATTTAAGAATAATTATCATTC

Gene: Shewmr7_2171: TonB-dependent receptor
*
Shewanella baltica OS155

Site:
position = -47
score = 5.20657
sequence = ATTTAAGAATAATTATCATTC

Gene: Sbal_2423: TonB-dependent receptor
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
TonB-dependent receptor
 
CRON 10.
IucABC
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
*
Shewanella woodyi ATCC 51908

Site:
position = -62
score = 5.89912
sequence = TAATGGGAATAATTATCATTT

Gene: Swoo_0585: Aerobactin synthetase , IucABC
Aerobactin synthetase , IucABC
IucD
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0586: lysine N6-hydroxylase, IucD
lysine N6-hydroxylase, IucD
SO4423.1
*
Shewanella oneidensis MR-1

Site:
position = -98
score = 5.41089
sequence = TAATAAAAATCGTTACCATTT

Gene: SO4423.1: TonB-dependent ferric achromobactin receptor
*
Shewanella putrefaciens CN-32

Site:
position = -97
score = 5.61765
sequence = TAACGAAAATCGTTATCATTT

Gene: Sputcn32_0401: TonB-dependent ferric achromobactin receptor
*
Shewanella sp W3-18-1

Site:
position = -97
score = 5.61765
sequence = TAACGAAAATCGTTATCATTT

Gene: Sputw3181_0255: TonB-dependent ferric achromobactin receptor
*
Shewanella sp ANA-3

Site:
position = -98
score = 5.53949
sequence = CAATAAAAATCGTTATCATTT

Gene: Shewana3_0286: TonB-dependent ferric achromobactin receptor
*
Shewanella sp MR-4

Site:
position = -98
score = 5.53949
sequence = CAATAAAAATCGTTATCATTT

Gene: Shewmr4_0286: TonB-dependent ferric achromobactin receptor
*
Shewanella sp MR-7

Site:
position = -98
score = 5.53949
sequence = CAATAAAAATCGTTATCATTT

Gene: Shewmr7_3733: TonB-dependent ferric achromobactin receptor
*
Shewanella baltica OS155

Site:
position = -100
score = 5.60897
sequence = GAATAAAAATCGTTATCATTT

Gene: Sbal_0298: TonB-dependent ferric achromobactin receptor
 
Shewanella denitrificans OS217
*
Shewanella frigidimarina NCIMB 400

Site:
position = -54
score = 5.85542
sequence = TAATGATAATGAATATCATTA

Gene: Sfri_0392: TonB-dependent ferric achromobactin receptor
*
Shewanella amazonensis SB2B

Site:
position = -54
score = 5.01423
sequence = CATTGAGAGTAATTATCATTA

Gene: Sama_1394: TonB-dependent ferric achromobactin receptor
*
Shewanella loihica PV-4

Site:
position = -72
score = 4.9028
sequence = ATATGATAATCTATATCATTC

Gene: Shew_1688: TonB-dependent ferric achromobactin receptor
*
Shewanella pealeana ATCC 700345

Site:
position = -108
score = 5.30306
sequence = AAACACTAATCATTATCATTT

Gene: Spea_0977: TonB-dependent ferric achromobactin receptor
 
Shewanella halifaxensis HAW-EB4
*
Shewanella piezotolerans WP3

Site:
position = -108
score = 5.18857
sequence = CAACAATAATCATTATCATTT

Gene: swp_1134: TonB-dependent ferric achromobactin receptor
*
Shewanella sediminis HAW-EB3

Site:
position = -51
score = 4.93337
sequence = AATCGAGAATGGTTATCATCC

Gene: Ssed_1496: TonB-dependent ferric achromobactin receptor
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0587: TonB-dependent ferric achromobactin receptor
TonB-dependent ferric achromobactin receptor
 
CRON 11.
Sden_3064
 
Shewanella oneidensis MR-1
*
Shewanella putrefaciens CN-32

Site:
position = -91
score = 5.12315
sequence = AAATAACAATAACTATCATTA

Gene: Sputcn32_0603: TonB-dependent receptor
*
Shewanella sp W3-18-1

Site:
position = -91
score = 5.12315
sequence = AAATAACAATAACTATCATTA

Gene: Sputw3181_3569: TonB-dependent receptor
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
*
Shewanella denitrificans OS217

Site:
position = -122
score = 6.20539
sequence = AAATAATAATGATTATCATTT

Gene: Sden_3064: TonB-dependent receptor
*2
Shewanella frigidimarina NCIMB 400

Site:
position = -195
score = 5.00536
sequence = GATTGATAACGAATCTCAATA

Site:
position = -168
score = 5.46857
sequence = GAGTGATAATTATTATCAATT

Site:
position = -91
score = 5.61222
sequence = TAATGATAATCATTAGCAATA

Gene: Sfri_2549: TonB-dependent receptor

Site:
position = -90
score = 5.72154
sequence = AAATGATAATGATTTCTATTT

Gene: Sfri_3717: TonB-dependent receptor
*
Shewanella amazonensis SB2B

Site:
position = -65
score = 6.03039
sequence = TAATGATAATTATTTTTATTT

Gene: Sama_3412: TonB-dependent receptor
*
Shewanella loihica PV-4

Site:
position = -136
score = 5.88532
sequence = AAATGATAACCATTCCCATTT

Gene: Shew_3097: TonB-dependent receptor
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
TonB-dependent receptor
piuB
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217

Gene: Sden_3065: Uncharacterized iron-regulated membrane protein, PiuB
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_3413: Uncharacterized iron-regulated membrane protein, PiuB
*
Shewanella loihica PV-4

Site:
position = -108
score = 5.57299
sequence = GAATGAAATTAATTCTCATTA

Gene: Shew_1181: Uncharacterized iron-regulated membrane protein, PiuB
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Uncharacterized iron-regulated membrane protein, PiuB
 
CRON 12.
COG3182
 
Shewanella oneidensis MR-1
*
Shewanella putrefaciens CN-32

Site:
position = -90
score = 5.73917
sequence = AATTGAAAACAATTATCAATA

Site:
position = -64
score = 5.16415
sequence = TATTGATAACAATTCGTATTA

Gene: Sputcn32_1842: PepSY-associated TM helix domain-containing protein
*
Shewanella sp W3-18-1

Site:
position = -90
score = 5.73917
sequence = AATTGAAAACAATTATCAATA

Site:
position = -64
score = 5.16415
sequence = TATTGATAACAATTCGTATTA

Gene: Sputw3181_2167: PepSY-associated TM helix domain-containing protein
*
Shewanella sp ANA-3

Site:
position = -66
score = 5.46024
sequence = TATTGATAACAATTCGCATTA

Gene: Shewana3_2196: PepSY-associated TM helix domain-containing protein
*
Shewanella sp MR-4

Site:
position = -65
score = 5.46024
sequence = TATTGATAACAATTCGCATTA

Gene: Shewmr4_2076: PepSY-associated TM helix domain-containing protein
*
Shewanella sp MR-7

Site:
position = -65
score = 5.46024
sequence = TATTGATAACAATTCGCATTA

Gene: Shewmr7_1899: PepSY-associated TM helix domain-containing protein
*
Shewanella baltica OS155

Site:
position = -64
score = 5.43722
sequence = TATTGATAACAATTTGCATTA

Gene: Sbal_2134: PepSY-associated TM helix domain-containing protein
 
Shewanella denitrificans OS217
*
Shewanella frigidimarina NCIMB 400

Site:
position = -184
score = 5.61222
sequence = TATTGCTAATGATTATCATTA

Site:
position = -107
score = 5.46857
sequence = AATTGATAATAATTATCACTC

Site:
position = -80
score = 5.00536
sequence = TATTGAGATTCGTTATCAATC

Gene: Sfri_2548: PepSY-associated TM helix domain-containing protein
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
PepSY-associated TM helix domain-containing protein
Sfri_2547
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1843: Conserved hypothetical protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_2166: Conserved hypothetical protein
 
Shewanella sp ANA-3

Gene: Shewana3_2195: Conserved hypothetical protein
 
Shewanella sp MR-4

Gene: Shewmr4_2075: Conserved hypothetical protein
 
Shewanella sp MR-7

Gene: Shewmr7_1900: Conserved hypothetical protein
 
Shewanella baltica OS155

Gene: Sbal_2135: Conserved hypothetical protein
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2547: Conserved hypothetical protein
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Conserved hypothetical protein
 
CRON 13.
Sfri_0202
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
*
Shewanella frigidimarina NCIMB 400

Site:
position = -48
score = 5.95007
sequence = TAATGCAAATCATTATCATTT

Gene: Sfri_0202: Conserved hypothetical protein
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
*
Shewanella piezotolerans WP3

Site:
position = -124
score = 5.30114
sequence = AAATGATAATGATTGCTATTA

Site:
position = -44
score = 5.65398
sequence = AAATACAAATCGTTATCATTT

Gene: swp_4138: Conserved hypothetical protein
 
Shewanella sediminis HAW-EB3
*
Shewanella woodyi ATCC 51908

Site:
position = -25
score = 5.44456
sequence = AAATGATAATTATTTGTATAT

Gene: Swoo_1505: Conserved hypothetical protein
Conserved hypothetical protein
Sfri_0203
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0203: Hypothetical protein
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3

Gene: swp_4137: Hypothetical protein
 
Shewanella sediminis HAW-EB3
*
Shewanella woodyi ATCC 51908

Site:
position = -350
score = 5.44456
sequence = AAATGATAATTATTTGTATAT

Gene: Swoo_1506: Hypothetical protein
Hypothetical protein
puiB
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0204: Uncharacterized iron-regulated membrane protein, PiuB
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3

Gene: swp_4136: Uncharacterized iron-regulated membrane protein, PiuB
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1507: Uncharacterized iron-regulated membrane protein, PiuB
Uncharacterized iron-regulated membrane protein, PiuB
 
CRON 14.
Sfri_0810
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
*
Shewanella denitrificans OS217

Site:
position = -74
score = 5.80854
sequence = TAATGCAAATTGTTATCATTT

Gene: Sden_0721: Hypothetical protein
*
Shewanella frigidimarina NCIMB 400

Site:
position = -78
score = 5.60177
sequence = TAATGCGAATCGTTATCAATT

Gene: Sfri_0810: Hypothetical protein
 
Shewanella amazonensis SB2B
*
Shewanella loihica PV-4

Site:
position = -77
score = 5.95341
sequence = TAATGCAAATTATTCTCATTT

Gene: Shew_0675: Hypothetical protein
*
Shewanella pealeana ATCC 700345

Site:
position = -100
score = 5.66422
sequence = TAATGTAAATCATTCTCATTT

Gene: Spea_0670: Hypothetical protein
*
Shewanella halifaxensis HAW-EB4

Site:
position = -100
score = 5.66422
sequence = TAATGTAAATCATTCTCATTT

Gene: Shal_3528: Hypothetical protein
*
Shewanella piezotolerans WP3

Site:
position = -86
score = 5.78429
sequence = TAATGCAAATCGTTCTCATTT

Gene: swp_4049: Hypothetical protein
*
Shewanella sediminis HAW-EB3

Site:
position = -76
score = 5.12559
sequence = TAATGCAAACGATTCGTATTT

Gene: Ssed_3793: Hypothetical protein
*
Shewanella woodyi ATCC 51908

Site:
position = -79
score = 5.78429
sequence = TAATGAAAACGATTCGCATTT

Gene: Swoo_0790: Hypothetical protein
Hypothetical protein
Sfri_0811
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217

Gene: Sden_0722: Imelysin peptidase family lipoprotein
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0811: Imelysin peptidase family lipoprotein
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4

Gene: Shew_0676: Imelysin peptidase family lipoprotein
 
Shewanella pealeana ATCC 700345

Gene: Spea_0671: Imelysin peptidase family lipoprotein
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3527: Imelysin peptidase family lipoprotein
 
Shewanella piezotolerans WP3

Gene: swp_4048: Imelysin peptidase family lipoprotein
 
Shewanella sediminis HAW-EB3

Gene: Ssed_3792: Imelysin peptidase family lipoprotein
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0791: Imelysin peptidase family lipoprotein
Imelysin peptidase family lipoprotein
Sfri_0812
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217

Gene: Sden_0723: Protein of unknown function DUF1111
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0812: Protein of unknown function DUF1111
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4

Gene: Shew_0677: Protein of unknown function DUF1111
 
Shewanella pealeana ATCC 700345

Gene: Spea_0672: Protein of unknown function DUF1111
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3526: Protein of unknown function DUF1111
 
Shewanella piezotolerans WP3

Gene: swp_4047: Protein of unknown function DUF1111
 
Shewanella sediminis HAW-EB3

Gene: Ssed_3791: Protein of unknown function DUF1111
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0792: Protein of unknown function DUF1111
Protein of unknown function DUF1111
 
CRON 15.
Sfri_4035
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
*
Shewanella baltica OS155

Site:
position = -93
score = 5.43547
sequence = AAATGCGAATTGTTTGCATTA

Gene: Sbal_2014: Conserved hypothetical signal peptide protein, possibly porin
*
Shewanella denitrificans OS217

Site:
position = -91
score = 5.13938
sequence = AAATACGAATAGTTTGCATTA

Gene: Sden_0638: Conserved hypothetical signal peptide protein, possibly porin
*
Shewanella frigidimarina NCIMB 400

Site:
position = -106
score = 5.63942
sequence = TAATGATAATGGTTTGCATTA

Gene: Sfri_4035: Conserved hypothetical signal peptide protein, possibly porin
*
Shewanella amazonensis SB2B

Site:
position = -84
score = 5.09989
sequence = CAATGCGAATCGTTTGCATTT

Gene: Sama_0589: Conserved hypothetical signal peptide protein, possibly porin
*
Shewanella loihica PV-4

Site:
position = -84
score = 5.65321
sequence = TAATGATAATAGTTTGCATTA

Gene: Shew_3120: Conserved hypothetical signal peptide protein, possibly porin
*
Shewanella pealeana ATCC 700345

Site:
position = -82
score = 5.63942
sequence = TAATGATAACGATTTGCATTA

Gene: Spea_0712: Conserved hypothetical signal peptide protein, possibly porin
 
Shewanella halifaxensis HAW-EB4
*
Shewanella piezotolerans WP3

Site:
position = -81
score = 5.95341
sequence = AAATGAGAATAATTTGCATTA

Gene: swp_4367: Conserved hypothetical signal peptide protein, possibly porin
*
Shewanella sediminis HAW-EB3

Site:
position = -83
score = 5.63942
sequence = AAATGATAACCGTTTGCATTA

Gene: Ssed_3889: Conserved hypothetical signal peptide protein, possibly porin
*
Shewanella woodyi ATCC 51908

Site:
position = -83
score = 5.40091
sequence = GAATGATAACAATTTGCATTA

Gene: Swoo_3788: Conserved hypothetical signal peptide protein, possibly porin
Conserved hypothetical signal peptide protein, possibly porin
Sbal_2015
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155

Gene: Sbal_2015: FMN-binding domain-containing protein
 
Shewanella denitrificans OS217

Gene: Sden_0639: FMN-binding domain-containing protein
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_4034: FMN-binding domain-containing protein
 
Shewanella amazonensis SB2B

Gene: Sama_0588: FMN-binding domain-containing protein
 
Shewanella loihica PV-4

Gene: Shew_3121: FMN-binding domain-containing protein
 
Shewanella pealeana ATCC 700345

Gene: Spea_0711: FMN-binding domain-containing protein
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0765: FMN-binding domain-containing protein
 
Shewanella piezotolerans WP3

Gene: swp_4368: FMN-binding domain-containing protein
 
Shewanella sediminis HAW-EB3

Gene: Ssed_3890: FMN-binding domain-containing protein
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3789: FMN-binding domain-containing protein
FMN-binding domain-containing protein
COG3182
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155

Gene: Sbal_2016: PepSY-associated TM helix domain-containing protein
 
Shewanella denitrificans OS217

Gene: Sden_0640: PepSY-associated TM helix domain-containing protein
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_4033: PepSY-associated TM helix domain-containing protein
 
Shewanella amazonensis SB2B

Gene: Sama_0587: PepSY-associated TM helix domain-containing protein
 
Shewanella loihica PV-4

Gene: Shew_3122: PepSY-associated TM helix domain-containing protein
 2
Shewanella pealeana ATCC 700345

Gene: Spea_0709: PepSY-associated TM helix domain-containing protein

Gene: Spea_0710: PepSY-associated TM helix domain-containing protein
 
Shewanella halifaxensis HAW-EB4
 2
Shewanella piezotolerans WP3

Gene: swp_4378: PepSY-associated TM helix domain-containing protein

Gene: swp_4369: PepSY-associated TM helix domain-containing protein
 
Shewanella sediminis HAW-EB3

Gene: Ssed_3891: PepSY-associated TM helix domain-containing protein
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3790: PepSY-associated TM helix domain-containing protein
PepSY-associated TM helix domain-containing protein
 
CRON 16.
Sfri_2008
 
Shewanella oneidensis MR-1
*
Shewanella putrefaciens CN-32

Site:
position = -63
score = 5.90495
sequence = TGTTGATAATAATTATCATTT

Gene: Sputcn32_1997: Hypothetical protein
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
*
Shewanella sp MR-4

Site:
position = -59
score = 5.73917
sequence = TGTTGATAACTATTCTCATTT

Gene: Shewmr4_2003: Hypothetical protein
*
Shewanella sp MR-7

Site:
position = -59
score = 5.73917
sequence = TGTTGATAACTATTCTCATTT

Gene: Shewmr7_1972: Hypothetical protein
*2
Shewanella baltica OS155

Site:
position = -63
score = 5.5943
sequence = TGTTGATAACAGTTATCATTT

Site:
position = -165
score = 4.72252
sequence = AAATAAAAATAATGATCACAT

Gene: Sbal_2198: Hypothetical protein

Site:
position = -63
score = 5.5943
sequence = TGTTGATAACAGTTATCATTT

Site:
position = -165
score = 4.72252
sequence = AAATAAAAATAATGATCACAT

Gene: Sbal_4484: Hypothetical protein
*
Shewanella denitrificans OS217

Site:
position = -36
score = 6.00614
sequence = AAATAAAAACCATTCTCATTT

Gene: Sden_1854: Hypothetical protein
*
Shewanella frigidimarina NCIMB 400

Site:
position = -116
score = 5.97818
sequence = AATTGATAACTATTCTCATTA

Gene: Sfri_2008: Hypothetical protein
*
Shewanella amazonensis SB2B

Site:
position = -52
score = 5.97095
sequence = ATATGATAACTATTCTCATTT

Gene: Sama_1788: Hypothetical protein
 
Shewanella loihica PV-4
*
Shewanella pealeana ATCC 700345

Site:
position = -117
score = 6.13016
sequence = TATTGATAATCATTATCATTT

Gene: Spea_2212: Hypothetical protein
*
Shewanella halifaxensis HAW-EB4

Site:
position = -62
score = 5.8807
sequence = TGTTGATAATCATTCTCATTT

Gene: Shal_2195: Hypothetical protein
 
Shewanella piezotolerans WP3
*
Shewanella sediminis HAW-EB3

Site:
position = -64
score = 5.79792
sequence = CATTGATAATCATTCTCATTT

Gene: Ssed_2208: Hypothetical protein
*
Shewanella woodyi ATCC 51908

Site:
position = -62
score = 5.8807
sequence = AGTTGATAACCATTCTCATTT

Gene: Swoo_2428: Hypothetical protein
Hypothetical protein
 
CRON 17.
Sputcn32_0603
 
Shewanella oneidensis MR-1
*
Shewanella putrefaciens CN-32

Site:
position = -91
score = 5.12315
sequence = AAATAACAATAACTATCATTA

Gene: Sputcn32_0603: TonB-dependent siderophore receptor
*
Shewanella sp W3-18-1

Site:
position = -91
score = 5.12315
sequence = AAATAACAATAACTATCATTA

Gene: Sputw3181_3569: TonB-dependent siderophore receptor
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
*
Shewanella denitrificans OS217

Site:
position = -122
score = 6.20539
sequence = AAATAATAATGATTATCATTT

Gene: Sden_3064: TonB-dependent siderophore receptor
*2
Shewanella frigidimarina NCIMB 400

Site:
position = -91
score = 5.61222
sequence = TAATGATAATCATTAGCAATA

Site:
position = -195
score = 5.00536
sequence = GATTGATAACGAATCTCAATA

Site:
position = -168
score = 5.46857
sequence = GAGTGATAATTATTATCAATT

Gene: Sfri_2549: TonB-dependent siderophore receptor

Site:
position = -90
score = 5.72154
sequence = AAATGATAATGATTTCTATTT

Gene: Sfri_3717: TonB-dependent siderophore receptor
*
Shewanella amazonensis SB2B

Site:
position = -65
score = 6.03039
sequence = TAATGATAATTATTTTTATTT

Gene: Sama_3412: TonB-dependent siderophore receptor
*
Shewanella loihica PV-4

Site:
position = -136
score = 5.88532
sequence = AAATGATAACCATTCCCATTT

Gene: Shew_3097: TonB-dependent siderophore receptor
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
TonB-dependent siderophore receptor
piuB
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217

Gene: Sden_3065: Iron-uptake factor PiuB
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_3413: Iron-uptake factor PiuB
*
Shewanella loihica PV-4

Site:
position = -108
score = 5.57299
sequence = GAATGAAATTAATTCTCATTA

Gene: Shew_1181: Iron-uptake factor PiuB
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Iron-uptake factor PiuB
 
CRON 18.
Sbal_0657
 
Shewanella oneidensis MR-1
*
Shewanella putrefaciens CN-32

Site:
position = -101
score = 5.82024
sequence = TAACGATAATTATTATCATTT

Gene: Sputcn32_3181: Hypothetical protein
*
Shewanella sp W3-18-1

Site:
position = -101
score = 5.82024
sequence = TAACGATAATTATTATCATTT

Gene: Sputw3181_0762: Hypothetical protein
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
*
Shewanella baltica OS155

Site:
position = -101
score = 5.82024
sequence = TAACGATAATTATTATCATTT

Gene: Sbal_0657: Hypothetical protein
 
Shewanella denitrificans OS217

Gene: Sden_0953: Hypothetical protein
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
*
Shewanella woodyi ATCC 51908

Site:
position = -120
score = 5.80855
sequence = TATTGATAATAAATATCATTT

Gene: Swoo_2460: Hypothetical protein
Hypothetical protein
 
CRON 19.
Sama_1866
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
*
Shewanella amazonensis SB2B

Site:
position = -40
score = 5.64353
sequence = TAATGCGAATCATTTTTATTT

Gene: Sama_1866: Probable two-component system sensor kinase
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
*
Shewanella sediminis HAW-EB3

Site:
position = -38
score = 5.06688
sequence = TGGTGAGAACGATTATTATTA

Gene: Ssed_2007: Probable two-component system sensor kinase
*
Shewanella woodyi ATCC 51908

Site:
position = -48
score = 5.61556
sequence = AATTGCGAACAATTATCATTA

Gene: Swoo_2596: Probable two-component system sensor kinase
Probable two-component system sensor kinase
 
CRON 20.
Sama_0590
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
*
Shewanella sp MR-4

Site:
position = -62
score = 4.96353
sequence = TAACGAGAATAATTCTTGTTT

Gene: Shewmr4_0630: TonB-dependent receptor
*
Shewanella sp MR-7

Site:
position = -62
score = 4.96353
sequence = TAACGAGAATAATTCTTGTTT

Gene: Shewmr7_3399: TonB-dependent receptor
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
*
Shewanella amazonensis SB2B

Site:
position = -2
score = 5.90608
sequence = AAATGATAACTATTGTCATTA

Gene: Sama_0590: TonB-dependent receptor
 
Shewanella loihica PV-4
*
Shewanella pealeana ATCC 700345

Site:
position = -66
score = 5.54992
sequence = AAATGATAATCAATCCCATTA

Gene: Spea_0713: TonB-dependent receptor
*
Shewanella halifaxensis HAW-EB4

Site:
position = -67
score = 5.63768
sequence = AAATGAGAATGAATAGCATTA

Gene: Shal_0766: TonB-dependent receptor
 
Shewanella piezotolerans WP3
*
Shewanella sediminis HAW-EB3

Site:
position = -84
score = 5.53821
sequence = AAATGATAACCACTCTCATTA

Gene: Ssed_3888: TonB-dependent receptor
*
Shewanella woodyi ATCC 51908

Site:
position = -2
score = 5.54992
sequence = AAATGATAATCAATCCCATTA

Gene: Swoo_3787: TonB-dependent receptor
TonB-dependent receptor
 
CRON 21.
mtrH
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
*
Shewanella halifaxensis HAW-EB4

Site:
position = -65
score = 5.29842
sequence = AGGTGAGAATAATTCTCATAA

Gene: Shal_2783: Surface localized decaheme cytochrome c lipoprotein, MtrH
*
Shewanella piezotolerans WP3

Site:
position = -67
score = 5.00148
sequence = AAATGAGATTTGTTCTCAAAC

Gene: swp_3277: Surface localized decaheme cytochrome c lipoprotein, MtrH
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Surface localized decaheme cytochrome c lipoprotein, MtrH
 
CRON 22.
adhC
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
*
Shewanella pealeana ATCC 700345

Site:
position = -80
score = 5.47984
sequence = AAATGAAATCAATTATAATTT

Gene: Spea_3021: S-(hydroxymethyl)glutathione dehydrogenase (EC 1.1.1.284)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -78
score = 4.79046
sequence = AAATGGAATTAGTTATAATCT

Gene: Shal_3111: S-(hydroxymethyl)glutathione dehydrogenase (EC 1.1.1.284)
*
Shewanella piezotolerans WP3

Site:
position = -111
score = 4.55146
sequence = ATATTAGAGGGATTATCATTT

Gene: swp_2093: S-(hydroxymethyl)glutathione dehydrogenase (EC 1.1.1.284)
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0375: S-(hydroxymethyl)glutathione dehydrogenase (EC 1.1.1.284)
S-(hydroxymethyl)glutathione dehydrogenase (EC 1.1.1.284)
 
CRON 23.
Sama_2875
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
*
Shewanella amazonensis SB2B

Site:
position = -68
score = 5.66805
sequence = AATTGAGAATTATTCTCAACA

Gene: Sama_2875: TonB-dependent siderophore receptor
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
*
Shewanella piezotolerans WP3

Site:
position = -94
score = 5.55909
sequence = TGTTGAGATTAATTATCATTT

Gene: swp_0926: TonB-dependent siderophore receptor
 
Shewanella sediminis HAW-EB3
*
Shewanella woodyi ATCC 51908

Site:
position = -81
score = 5.91417
sequence = AATTGATAATCGTTATCAATT

Gene: Swoo_0946: TonB-dependent siderophore receptor
TonB-dependent siderophore receptor
 
CRON 24.
Sama_2655
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
*
Shewanella sp ANA-3

Site:
position = -84
score = 4.93325
sequence = TAATGATAATGATTTGCGTTG

Gene: Shewana3_0919: Conserved hypothetical protein
*
Shewanella sp MR-4

Site:
position = -84
score = 4.93325
sequence = TAATGATAATGATTTGCGTTG

Gene: Shewmr4_0920: Conserved hypothetical protein
*
Shewanella sp MR-7

Site:
position = -84
score = 4.93325
sequence = TAATGATAATGATTTGCGTTG

Gene: Shewmr7_0955: Conserved hypothetical protein
*
Shewanella baltica OS155

Site:
position = -83
score = 4.77793
sequence = TAATGATAACGATTTGCGTTG

Gene: Sbal_0904: Conserved hypothetical protein
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
*
Shewanella amazonensis SB2B

Site:
position = -84
score = 5.41954
sequence = TAATGCGAACTATTTTCATAT

Gene: Sama_2655: Conserved hypothetical protein
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Conserved hypothetical protein
Sama_2656
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3

Gene: Shewana3_0920: FMN-binding domain protein
 
Shewanella sp MR-4

Gene: Shewmr4_0921: FMN-binding domain protein
 
Shewanella sp MR-7

Gene: Shewmr7_0956: FMN-binding domain protein
 
Shewanella baltica OS155

Gene: Sbal_0905: FMN-binding domain protein
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_2656: FMN-binding domain protein
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
FMN-binding domain protein
Sama_2657
 
Shewanella oneidensis MR-1

Gene: SO1090: ApbE family protein, putative
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3

Gene: Shewana3_0921: ApbE family protein, putative
 
Shewanella sp MR-4

Gene: Shewmr4_0922: ApbE family protein, putative
 
Shewanella sp MR-7

Gene: Shewmr7_0957: ApbE family protein, putative
 
Shewanella baltica OS155

Gene: Sbal_0906: ApbE family protein, putative
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_2657: ApbE family protein, putative
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
ApbE family protein, putative
Sama_2658
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3

Gene: Shewana3_0922: Hypothetical protein
 
Shewanella sp MR-4

Gene: Shewmr4_0923: Hypothetical protein
 
Shewanella sp MR-7

Gene: Shewmr7_0958: Hypothetical protein
 
Shewanella baltica OS155

Gene: Sbal_0907: Hypothetical protein
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_2658: Hypothetical protein
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Hypothetical protein
 
CRON 25.
Sputcn32_2703
*
Shewanella oneidensis MR-1

Site:
position = -59
score = 4.67455
sequence = TTATGATAATGAACATTATTT

Gene: SO3371: Cytochrome B561
*
Shewanella putrefaciens CN-32

Site:
position = -60
score = 4.64108
sequence = TTATGATAATGGATATTGTTT

Gene: Sputcn32_2703: Cytochrome B561
*
Shewanella sp W3-18-1

Site:
position = -60
score = 4.64108
sequence = TTATGATAATGGATATTGTTT

Gene: Sputw3181_1308: Cytochrome B561
*
Shewanella sp ANA-3

Site:
position = -59
score = 5.02936
sequence = TTATGATAATGACTATTATTT

Gene: Shewana3_1178: Cytochrome B561
*
Shewanella sp MR-4

Site:
position = -59
score = 5.02936
sequence = TTATGATAATGACTATTATTT

Gene: Shewmr4_1177: Cytochrome B561
*
Shewanella sp MR-7

Site:
position = -59
score = 5.02936
sequence = TTATGATAATGACTATTATTT

Gene: Shewmr7_1248: Cytochrome B561
*
Shewanella baltica OS155

Site:
position = -61
score = 5.33612
sequence = TTATGATAATGAATATTATTT

Gene: Sbal_3042: Cytochrome B561
 
Shewanella denitrificans OS217

Gene: Sden_2129: Cytochrome B561
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2876: Cytochrome B561
*
Shewanella amazonensis SB2B

Site:
position = -38
score = 5.36819
sequence = AGATGAAAACCATTCTCGTTA

Gene: Sama_0949: Cytochrome B561
 
Shewanella loihica PV-4

Gene: Shew_1120: Cytochrome B561
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3

Gene: swp_3690: Cytochrome B561
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1216: Cytochrome B561
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1316: Cytochrome B561
Cytochrome B561
yceI
 
Shewanella oneidensis MR-1

Gene: SO3370: Protein yceI precursor
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2702: Protein yceI precursor
 
Shewanella sp W3-18-1

Gene: Sputw3181_1309: Protein yceI precursor
 
Shewanella sp ANA-3

Gene: Shewana3_1179: Protein yceI precursor
 
Shewanella sp MR-4

Gene: Shewmr4_1178: Protein yceI precursor
 
Shewanella sp MR-7

Gene: Shewmr7_1249: Protein yceI precursor
 
Shewanella baltica OS155

Gene: Sbal_3041: Protein yceI precursor
 
Shewanella denitrificans OS217

Gene: Sden_2128: Protein yceI precursor
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2875: Protein yceI precursor
 
Shewanella amazonensis SB2B

Gene: Sama_0950: Protein yceI precursor
 
Shewanella loihica PV-4

Gene: Shew_1121: Protein yceI precursor
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3

Gene: swp_3689: Protein yceI precursor
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1217: Protein yceI precursor
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1317: Protein yceI precursor
Protein yceI precursor
 
CRON 26.
SO3914
*
Shewanella oneidensis MR-1

Site:
position = -108
score = 5.05585
sequence = AAATGATAATAATTATTGATC

Gene: SO3914: TonB-dependent siderophore receptor
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
*
Shewanella sp ANA-3

Site:
position = -107
score = 5.46348
sequence = AAATGATAATAATTATTGATT

Gene: Shewana3_0716: TonB-dependent siderophore receptor
*
Shewanella sp MR-4

Site:
position = -106
score = 5.46348
sequence = AAATGATAATAATTATTGATT

Gene: Shewmr4_3245: TonB-dependent siderophore receptor
*
Shewanella sp MR-7

Site:
position = -106
score = 4.80191
sequence = AAATGATAATAATAATTGATT

Gene: Shewmr7_0697: TonB-dependent siderophore receptor
*
Shewanella baltica OS155

Site:
position = -108
score = 4.90053
sequence = AAATGATAATAGTTATTGATC

Gene: Sbal_3635: TonB-dependent siderophore receptor
 
Shewanella denitrificans OS217
*
Shewanella frigidimarina NCIMB 400

Site:
position = -103
score = 5.8093
sequence = AAATGATAATGATTTGTATTT

Gene: Sfri_0611: TonB-dependent siderophore receptor
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
TonB-dependent siderophore receptor
piuC
 
Shewanella oneidensis MR-1

Gene: SO3913: Iron-uptake factor PiuC
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3

Gene: Shewana3_0717: Iron-uptake factor PiuC
 
Shewanella sp MR-4

Gene: Shewmr4_3244: Iron-uptake factor PiuC
 
Shewanella sp MR-7

Gene: Shewmr7_0698: Iron-uptake factor PiuC
 
Shewanella baltica OS155

Gene: Sbal_3634: Iron-uptake factor PiuC
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0612: Iron-uptake factor PiuC
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Iron-uptake factor PiuC
 
CRON 27.
SO0719
*
Shewanella oneidensis MR-1

Site:
position = -40
score = 4.93049
sequence = AGGTAGGAACAATTCTCATTT

Gene: SO0719: TonB-dependent receptor
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
*
Shewanella pealeana ATCC 700345

Site:
position = -43
score = 5.83651
sequence = AAAAGAGAATAATTCTCATTT

Gene: Spea_2929: TonB-dependent receptor
*
Shewanella halifaxensis HAW-EB4

Site:
position = -42
score = 5.83651
sequence = AAAGGAGAATAATTCTCATTT

Gene: Shal_3020: TonB-dependent receptor
 
Shewanella piezotolerans WP3
*
Shewanella sediminis HAW-EB3

Site:
position = -42
score = 5.53631
sequence = TAAGGATAATAATTCTCATTA

Gene: Ssed_3638: TonB-dependent receptor
 
Shewanella woodyi ATCC 51908
TonB-dependent receptor
 
CRON 28.
SO4700
*
Shewanella oneidensis MR-1

Site:
position = -86
score = 5.30027
sequence = AAATCAAATCCATTCTCATTA

Gene: SO4700: Hypothetical outer membrane protein
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0086: Hypothetical outer membrane protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_3979: Hypothetical outer membrane protein
*
Shewanella sp ANA-3

Site:
position = -86
score = 4.84989
sequence = AAATCGAATCCATTCTCATTA

Gene: Shewana3_4052: Hypothetical outer membrane protein
*
Shewanella sp MR-4

Site:
position = -27
score = 5.30027
sequence = AAATCAAATCCATTCTCATTA

Gene: Shewmr4_3843: Hypothetical outer membrane protein
*
Shewanella sp MR-7

Site:
position = -27
score = 5.30027
sequence = AAATCAAATCCATTCTCATTA

Gene: Shewmr7_3936: Hypothetical outer membrane protein
*
Shewanella baltica OS155

Site:
position = -86
score = 4.50107
sequence = AAATCGAATCAATTCGCATTA

Gene: Sbal_0123: Hypothetical outer membrane protein
*
Shewanella denitrificans OS217

Site:
position = -123
score = 4.70527
sequence = AAATAAGACTGGTTTGTATTT

Gene: Sden_3594: Hypothetical outer membrane protein
*
Shewanella frigidimarina NCIMB 400

Site:
position = -80
score = 5.30915
sequence = AAACGAGACTGATTATCATTT

Gene: Sfri_3875: Hypothetical outer membrane protein
 
Shewanella amazonensis SB2B
*
Shewanella loihica PV-4

Site:
position = -83
score = 5.31125
sequence = AAATGCAACCAATTCTCATTT

Gene: Shew_3658: Hypothetical outer membrane protein
*
Shewanella pealeana ATCC 700345

Site:
position = 7
score = 5.04863
sequence = AAATACGAGCTATTATCATTT

Gene: Spea_4066: Hypothetical outer membrane protein
*
Shewanella halifaxensis HAW-EB4

Site:
position = -87
score = 4.37326
sequence = AAATACGTCCCATTATCATTT

Gene: Shal_0192: Hypothetical outer membrane protein
*
Shewanella piezotolerans WP3

Site:
position = -86
score = 5.01181
sequence = AAATACAACCGATTATCATTT

Gene: swp_4927: Hypothetical outer membrane protein
*
Shewanella sediminis HAW-EB3

Site:
position = -97
score = 5.49149
sequence = AAATGGGAAGTGTTATCATTT

Gene: Ssed_0144: Hypothetical outer membrane protein
*
Shewanella woodyi ATCC 51908

Site:
position = -85
score = 5.24635
sequence = AAATACAAAGCGTTATCATTT

Gene: Swoo_0123: Hypothetical outer membrane protein
Hypothetical outer membrane protein
 
CRON 29.
SO2841
*
Shewanella oneidensis MR-1

Site:
position = -60
score = 5.42629
sequence = GACTGATAATAGTTTTCATTT

Gene: SO2841: Hypothetical protein
*
Shewanella putrefaciens CN-32

Site:
position = -59
score = 5.58161
sequence = GACTGATAATAATTTTCATTT

Gene: Sputcn32_1534: Hypothetical protein
*
Shewanella sp W3-18-1

Site:
position = -59
score = 5.58161
sequence = GACTGATAATAATTTTCATTT

Gene: Sputw3181_2565: Hypothetical protein
*
Shewanella sp ANA-3

Site:
position = -71
score = 5.58161
sequence = GACTGATAATAATTTTCATTT

Gene: Shewana3_2609: Hypothetical protein
*
Shewanella sp MR-4

Site:
position = -71
score = 5.58161
sequence = GACTGATAATAATTTTCATTT

Gene: Shewmr4_2447: Hypothetical protein
*
Shewanella sp MR-7

Site:
position = -71
score = 5.58161
sequence = GACTGATAATAATTTTCATTT

Gene: Shewmr7_2517: Hypothetical protein
*
Shewanella baltica OS155

Site:
position = -63
score = 5.42629
sequence = GACTGATAATAGTTTTCATTT

Gene: Sbal_1657: Hypothetical protein
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
*
Shewanella amazonensis SB2B

Site:
position = -60
score = 5.40204
sequence = GACTGAGAATGGTTTTCATTT

Gene: Sama_1270: Hypothetical protein
 
Shewanella loihica PV-4
*
Shewanella pealeana ATCC 700345

Site:
position = -104
score = 5.52067
sequence = GAACGATAATGATTTTCATTT

Gene: Spea_2627: Hypothetical protein
*
Shewanella halifaxensis HAW-EB4

Site:
position = -103
score = 5.77297
sequence = TAACGATAATGATTTTCATTT

Gene: Shal_2698: Hypothetical protein
*
Shewanella piezotolerans WP3

Site:
position = -56
score = 6.09669
sequence = AATTGATAACGATTTTCATTT

Gene: swp_3175: Hypothetical protein
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Hypothetical protein
 
CRON 30.
irgA
*
Shewanella oneidensis MR-1

Site:
position = -50
score = 6.11048
sequence = TATTGAAAATTATTATCATTT

Gene: SO_4523: TonB-dependent receptor
*
Shewanella putrefaciens CN-32

Site:
position = -52
score = 5.94471
sequence = TATTGAAAATTGTTCTCATTT

Gene: Sputcn32_3503: TonB-dependent receptor
*
Shewanella sp W3-18-1

Site:
position = -52
score = 5.94471
sequence = TATTGAAAATTGTTCTCATTT

Gene: Sputw3181_0403: TonB-dependent receptor
*
Shewanella sp ANA-3

Site:
position = -49
score = 6.11048
sequence = TATTGAAAATTATTATCATTT

Gene: Shewana3_3929: TonB-dependent receptor
 
Shewanella sp MR-4
 
Shewanella sp MR-7
*
Shewanella baltica OS155

Site:
position = -52
score = 5.94471
sequence = TATTGAAAATTGTTCTCATTT

Gene: Sbal_0217: TonB-dependent receptor
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
TonB-dependent receptor
 
CRON 31.
viuA
*
Shewanella oneidensis MR-1

Site:
position = -100
score = 5.79475
sequence = AAATGATATTGGTTATCAATT

Gene: SO4516: TonB-dependent receptor
*
Shewanella putrefaciens CN-32

Site:
position = -101
score = 5.59083
sequence = AAATGATAATCCTTCTCAGTT

Gene: Sputcn32_0330: TonB-dependent receptor
*
Shewanella sp W3-18-1

Site:
position = -101
score = 5.59083
sequence = AAATGATAATCCTTCTCAGTT

Gene: Sputw3181_3878: TonB-dependent receptor
*
Shewanella sp ANA-3

Site:
position = -99
score = 5.77174
sequence = AAATGATATTGGTTATCATCT

Gene: Shewana3_3923: TonB-dependent receptor
*
Shewanella sp MR-4

Site:
position = -99
score = 6.01075
sequence = AAATGATATTGGTTATCATTT

Gene: Shewmr4_3727: TonB-dependent receptor
*
Shewanella sp MR-7

Site:
position = -99
score = 6.01075
sequence = AAATGATATTGGTTATCATTT

Gene: Shewmr7_3798: TonB-dependent receptor
 
Shewanella baltica OS155
*
Shewanella denitrificans OS217

Site:
position = -92
score = 5.23678
sequence = AAATGAGAGTGATTTGCAATT

Gene: Sden_0621: TonB-dependent receptor
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
*
Shewanella piezotolerans WP3

Site:
position = -104
score = 5.26396
sequence = AAATGTGAATGATTCGCAATT

Gene: swp_0161: TonB-dependent receptor
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
TonB-dependent receptor
 
CRON 32.
SO3406
*
Shewanella oneidensis MR-1

Site:
position = -273
score = 5.68896
sequence = AAATGATATTGTTTATCATTT

Gene: SO3406: Conserved hypothetical protein
*
Shewanella putrefaciens CN-32

Site:
position = -196
score = 5.53364
sequence = AAATGATATCGTTTATCATTT

Gene: Sputcn32_2727: Conserved hypothetical protein
*
Shewanella sp W3-18-1

Site:
position = -196
score = 5.53364
sequence = AAATGATATCGTTTATCATTT

Gene: Sputw3181_1285: Conserved hypothetical protein
*
Shewanella sp ANA-3

Site:
position = -177
score = 5.68896
sequence = AAATGATATTGTTTATCATTT

Gene: Shewana3_1149: Conserved hypothetical protein
*
Shewanella sp MR-4

Site:
position = -177
score = 5.68896
sequence = AAATGATATTGTTTATCATTT

Gene: Shewmr4_1148: Conserved hypothetical protein
*
Shewanella sp MR-7

Site:
position = -177
score = 5.68896
sequence = AAATGATATTGTTTATCATTT

Gene: Shewmr7_1219: Conserved hypothetical protein
*
Shewanella baltica OS155

Site:
position = -195
score = 5.53364
sequence = AAATGATATCGTTTATCATTT

Gene: Sbal_1237: Conserved hypothetical protein
*
Shewanella denitrificans OS217

Site:
position = -75
score = 5.24099
sequence = GAATAAAAACAGTTCTCAATT

Gene: Sden_2355: Conserved hypothetical protein
 
Shewanella frigidimarina NCIMB 400
*
Shewanella amazonensis SB2B

Site:
position = -72
score = 5.79792
sequence = AATTGAGAATGTTTATCATTT

Gene: Sama_3409: Conserved hypothetical protein
*
Shewanella loihica PV-4

Site:
position = -63
score = 4.49479
sequence = GAATGAGAACCTATCTCAACA

Gene: Shew_1240: Conserved hypothetical protein
*
Shewanella pealeana ATCC 700345

Site:
position = -82
score = 5.27096
sequence = GAATGAAAACAGTTATCAGTT

Gene: Spea_1223: Conserved hypothetical protein
*
Shewanella halifaxensis HAW-EB4

Site:
position = -96
score = 5.07291
sequence = GAATGGAAACGGTTCTCAATT

Gene: Shal_1257: Conserved hypothetical protein
*
Shewanella piezotolerans WP3

Site:
position = -91
score = 5.23765
sequence = GAATAAAAATGGTTATCAATA

Gene: swp_3413: Conserved hypothetical protein
*
Shewanella sediminis HAW-EB3

Site:
position = -98
score = 5.08765
sequence = GAATGAAAACGGTTATCACCT

Gene: Ssed_1345: Conserved hypothetical protein
*
Shewanella woodyi ATCC 51908

Site:
position = -96
score = 5.69549
sequence = AAATAAAAACCGTTCTCATTA

Gene: Swoo_3307: Conserved hypothetical protein
Conserved hypothetical protein
SO3407
 
Shewanella oneidensis MR-1

Gene: SO3407: Iron-regulated membrane protein
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2728: Iron-regulated membrane protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_1284: Iron-regulated membrane protein
 
Shewanella sp ANA-3

Gene: Shewana3_1148: Iron-regulated membrane protein
 
Shewanella sp MR-4

Gene: Shewmr4_1147: Iron-regulated membrane protein
 
Shewanella sp MR-7

Gene: Shewmr7_1218: Iron-regulated membrane protein
 
Shewanella baltica OS155

Gene: Sbal_1236: Iron-regulated membrane protein
 
Shewanella denitrificans OS217

Gene: Sden_2356: Iron-regulated membrane protein
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_3410: Iron-regulated membrane protein
 
Shewanella loihica PV-4

Gene: Shew_1239: Iron-regulated membrane protein
 
Shewanella pealeana ATCC 700345

Gene: Spea_1222: Iron-regulated membrane protein
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1256: Iron-regulated membrane protein
 
Shewanella piezotolerans WP3

Gene: swp_3414: Iron-regulated membrane protein
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1344: Iron-regulated membrane protein
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3308: Iron-regulated membrane protein
Iron-regulated membrane protein
SO3408
 
Shewanella oneidensis MR-1

Gene: SO3408: Conserved hypothetical inner membrane protein
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2729: Conserved hypothetical inner membrane protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_1283: Conserved hypothetical inner membrane protein
 
Shewanella sp ANA-3

Gene: Shewana3_1147: Conserved hypothetical inner membrane protein
 
Shewanella sp MR-4

Gene: Shewmr4_1146: Conserved hypothetical inner membrane protein
 
Shewanella sp MR-7

Gene: Shewmr7_1217: Conserved hypothetical inner membrane protein
 
Shewanella baltica OS155

Gene: Sbal_1235: Conserved hypothetical inner membrane protein
 
Shewanella denitrificans OS217

Gene: Sden_2357: Conserved hypothetical inner membrane protein
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_3411: Conserved hypothetical inner membrane protein
 
Shewanella loihica PV-4

Gene: Shew_1238: Conserved hypothetical inner membrane protein
 
Shewanella pealeana ATCC 700345

Gene: Spea_1221: Conserved hypothetical inner membrane protein
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1255: Conserved hypothetical inner membrane protein
 
Shewanella piezotolerans WP3

Gene: swp_3415: Conserved hypothetical inner membrane protein
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1343: Conserved hypothetical inner membrane protein
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3309: Conserved hypothetical inner membrane protein
Conserved hypothetical inner membrane protein
 
CRON 33.
SO3025
*
Shewanella oneidensis MR-1

Site:
position = -220
score = 5.76286
sequence = AAATGACAATAGTTGTCATTT

Gene: SO3025: Periplasmic esterase
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
*
Shewanella sp ANA-3

Site:
position = -177
score = 5.8091
sequence = GAATGATAATAATTGTCATTT

Gene: Shewana3_1514: Periplasmic esterase
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Periplasmic esterase
 
CRON 34.
SO2039
*
Shewanella oneidensis MR-1

Site:
position = -44
score = 5.5636
sequence = AAATGCGAATAATTAGCAATT

Gene: SO2039: Signalling protein with EAL domain
*
Shewanella putrefaciens CN-32

Site:
position = -48
score = 4.87901
sequence = AAATGCAAATAATAAGCAATT

Gene: Sputcn32_2106: Signalling protein with EAL domain
*
Shewanella sp W3-18-1

Site:
position = -48
score = 4.87901
sequence = AAATGCAAATAATAAGCAATT

Gene: Sputw3181_1906: Signalling protein with EAL domain
*
Shewanella sp ANA-3

Site:
position = -44
score = 5.02389
sequence = AAATGCGAATAATTAGCGATT

Gene: Shewana3_2237: Signalling protein with EAL domain
*
Shewanella sp MR-4

Site:
position = -42
score = 5.02389
sequence = AAATGCGAATAATTAGCGATT

Gene: Shewmr4_2112: Signalling protein with EAL domain
*
Shewanella sp MR-7

Site:
position = -44
score = 5.5636
sequence = AAATGCGAATAATTAGCAATT

Gene: Shewmr7_1862: Signalling protein with EAL domain
*2
Shewanella baltica OS155

Site:
position = -46
score = 5.32818
sequence = AAATGCGAATAATTAGTATTA

Gene: Sbal_4560: Signalling protein with EAL domain

Site:
position = -46
score = 5.32818
sequence = AAATGCGAATAATTAGTATTA

Gene: Sbal_2274: Signalling protein with EAL domain
*
Shewanella denitrificans OS217

Site:
position = -44
score = 5.24041
sequence = AAATAGGAATAATTAGCATTA

Gene: Sden_1592: Signalling protein with EAL domain
 
Shewanella frigidimarina NCIMB 400
*
Shewanella amazonensis SB2B

Site:
position = -42
score = 5.46268
sequence = TAATGAGATTTATTTGCATTA

Gene: Sama_1896: Signalling protein with EAL domain
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
*
Shewanella halifaxensis HAW-EB4

Site:
position = -35
score = 5.23706
sequence = TAATATAAACAATTATCATTT

Gene: Shal_1861: Signalling protein with EAL domain
*
Shewanella piezotolerans WP3

Site:
position = 29
score = 5.56661
sequence = TAATGTTAATAATTATCATTA

Gene: swp_2763: Signalling protein with EAL domain
*
Shewanella sediminis HAW-EB3

Site:
position = -56
score = 4.96502
sequence = TAATGTGAATAATTACTATTT

Gene: Ssed_1968: Signalling protein with EAL domain
 
Shewanella woodyi ATCC 51908

Gene: Swoo_2622: Signalling protein with EAL domain
Signalling protein with EAL domain
 
CRON 35.
SO1755
*
Shewanella oneidensis MR-1

Site:
position = -30
score = 5.31835
sequence = AATTGAAAATGATTTTCACTG

Gene: SO1755: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon
*
Shewanella putrefaciens CN-32

Site:
position = -30
score = 4.7552
sequence = GATTGCAAATGATTTTCAATG

Gene: Sputcn32_1454: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon
*
Shewanella sp W3-18-1

Site:
position = -30
score = 4.7552
sequence = GATTGCAAATGATTTTCAATG

Gene: Sputw3181_2648: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon
*
Shewanella sp ANA-3

Site:
position = -30
score = 4.91073
sequence = GATTGAAAATGATTTTCACTG

Gene: Shewana3_2707: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon
*
Shewanella sp MR-4

Site:
position = -30
score = 4.91073
sequence = GATTGAAAATGATTTTCACTG

Gene: Shewmr4_2541: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon
*
Shewanella sp MR-7

Site:
position = -31
score = 4.91073
sequence = GATTGAAAATGATTTTCACTG

Gene: Shewmr7_2608: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon
*
Shewanella baltica OS155

Site:
position = -30
score = 4.7552
sequence = GATTGCAAATGATTTTCAATG

Gene: Sbal_1561: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon
 
Shewanella denitrificans OS217

Gene: Sden_1966: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon
*
Shewanella frigidimarina NCIMB 400

Site:
position = -30
score = 5.40359
sequence = TATTGAAAATGATTATCAATG

Gene: Sfri_2159: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon
 
Shewanella amazonensis SB2B

Gene: Sama_1189: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon
 
Shewanella loihica PV-4

Gene: Shew_2544: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon
 
Shewanella pealeana ATCC 700345

Gene: Spea_2727: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2810: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon
 
Shewanella piezotolerans WP3

Gene: swp_3297: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon
*
Shewanella sediminis HAW-EB3

Site:
position = -67
score = 5.28327
sequence = AAATGAAAATCATTTGTAGTT

Gene: Ssed_1517: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon
*
Shewanella woodyi ATCC 51908

Site:
position = -66
score = 5.17329
sequence = CAATGCTAATGATTTTCAACT

Gene: Swoo_3151: Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon
Phosphomannomutase (EC 5.4.2.8) clustering with Aga operon
 
CRON 36.
SO1580
*
Shewanella oneidensis MR-1

Site:
position = -82
score = 5.45374
sequence = ATGTGAGAATTATTCTCATCT

Gene: SO1580: TonB-dependent heme receptor
*
Shewanella putrefaciens CN-32

Site:
position = -84
score = 5.58796
sequence = AATTGAGAACTATTCTTATCT

Gene: Sputcn32_1308: TonB-dependent heme receptor
*
Shewanella sp W3-18-1

Site:
position = -84
score = 5.58796
sequence = AATTGAGAACTATTCTTATCT

Gene: Sputw3181_2795: TonB-dependent heme receptor
*
Shewanella sp ANA-3

Site:
position = -81
score = 5.59328
sequence = AGGTGAGAATTATTCTCATCT

Gene: Shewana3_2862: TonB-dependent heme receptor
 
Shewanella sp MR-4
 
Shewanella sp MR-7
*
Shewanella baltica OS155

Site:
position = -84
score = 5.38087
sequence = AAGTGAGAACTATTCTTATCT

Gene: Sbal_1397: TonB-dependent heme receptor
*
Shewanella denitrificans OS217

Site:
position = -172
score = 5.52135
sequence = AACTGATAATCATTCTCATTG

Gene: Sden_2503: TonB-dependent heme receptor
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
*
Shewanella piezotolerans WP3

Site:
position = -76
score = 5.67077
sequence = AAGTGATAATCATTATCATTC

Gene: swp_0953: TonB-dependent heme receptor
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
TonB-dependent heme receptor
 
CRON 37.
SO3062
*
Shewanella oneidensis MR-1

Site:
position = -67
score = 5.48972
sequence = TGTTGAGAACAATTCTCATCT

Gene: SO3062: Hypothetical inner membrane protein
*
Shewanella putrefaciens CN-32

Site:
position = -55
score = 5.49893
sequence = AATTGAGAACCATTCTCAACA

Gene: Sputcn32_2436: Hypothetical inner membrane protein
 
Shewanella sp W3-18-1
*
Shewanella sp ANA-3

Site:
position = -67
score = 5.80037
sequence = AGTTGAGAATAATTCTCATCT

Gene: Shewana3_1485: Hypothetical inner membrane protein
*
Shewanella sp MR-4

Site:
position = -66
score = 6.02558
sequence = AATTGAGAATGATTCTCATCT

Gene: Shewmr4_1432: Hypothetical inner membrane protein
*
Shewanella sp MR-7

Site:
position = -66
score = 5.80037
sequence = AGTTGAGAATTATTCTCATCT

Gene: Shewmr7_1497: Hypothetical inner membrane protein
*
Shewanella baltica OS155

Site:
position = -50
score = 5.15012
sequence = AATTGCGAATAGTTCTCAACA

Gene: Sbal_2737: Hypothetical inner membrane protein
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
*
Shewanella loihica PV-4

Site:
position = -55
score = 5.29184
sequence = TGTTGAGAATCATTCTCACTA

Gene: Shew_2300: Hypothetical inner membrane protein
*
Shewanella pealeana ATCC 700345

Site:
position = -61
score = 5.41807
sequence = TGTTGAGAACAGTTCTCATTA

Gene: Spea_1624: Hypothetical inner membrane protein
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
*
Shewanella woodyi ATCC 51908

Site:
position = -70
score = 6.27837
sequence = AATTGAGAATAATTCTCATTT

Gene: Swoo_2977: Hypothetical inner membrane protein
Hypothetical inner membrane protein
 
CRON 38.
SO0798
*
Shewanella oneidensis MR-1

Site:
position = -62
score = 6.05341
sequence = AAATAATAACAATTCTCATTT

Gene: SO0798: TonB-dependent outer membrane receptor
*
Shewanella putrefaciens CN-32

Site:
position = -62
score = 5.63199
sequence = AAATAATAACCATTCTCATTC

Gene: Sputcn32_3191: TonB-dependent outer membrane receptor
*
Shewanella sp W3-18-1

Site:
position = -62
score = 5.63199
sequence = AAATAATAACCATTCTCATTC

Gene: Sputw3181_0752: TonB-dependent outer membrane receptor
 
Shewanella sp ANA-3
*
Shewanella sp MR-4

Site:
position = -62
score = 6.20873
sequence = AAATAATAATTATTCTCATTT

Gene: Shewmr4_3318: TonB-dependent outer membrane receptor
*
Shewanella sp MR-7

Site:
position = -62
score = 6.20873
sequence = AAATAATAATTATTCTCATTT

Gene: Shewmr7_0635: TonB-dependent outer membrane receptor
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
TonB-dependent outer membrane receptor
SO0797
 
Shewanella oneidensis MR-1

Gene: SO0797: Periplasmic thioredoxin-family protein
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3192: Periplasmic thioredoxin-family protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_0751: Periplasmic thioredoxin-family protein
 
Shewanella sp ANA-3
 
Shewanella sp MR-4

Gene: Shewmr4_3319: Periplasmic thioredoxin-family protein
 
Shewanella sp MR-7

Gene: Shewmr7_0634: Periplasmic thioredoxin-family protein
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Periplasmic thioredoxin-family protein
 
CRON 39.
SO3344
*
Shewanella oneidensis MR-1

Site:
position = -44
score = 6.00891
sequence = AAATGATAATGATTATCAGTT

Gene: SO3344: Hypothetical inner membrane protein
*
Shewanella putrefaciens CN-32

Site:
position = -40
score = 6.04648
sequence = AGATGATAATGATTATCAATT

Gene: Sputcn32_2679: Hypothetical inner membrane protein
*
Shewanella sp W3-18-1

Site:
position = -40
score = 6.04648
sequence = AGATGATAATGATTATCAATT

Gene: Sputw3181_1332: Hypothetical inner membrane protein
*
Shewanella sp ANA-3

Site:
position = -44
score = 6.07839
sequence = AAATGATAATGATTATCACTT

Gene: Shewana3_1202: Hypothetical inner membrane protein
*
Shewanella sp MR-4

Site:
position = -44
score = 6.07839
sequence = AAATGATAATGATTATCACTT

Gene: Shewmr4_1201: Hypothetical inner membrane protein
*
Shewanella sp MR-7

Site:
position = -44
score = 6.07839
sequence = AAATGATAATGATTATCACTT

Gene: Shewmr7_1272: Hypothetical inner membrane protein
*
Shewanella baltica OS155

Site:
position = -41
score = 6.04648
sequence = AGATGATAATGATTATCAATT

Gene: Sbal_3017: Hypothetical inner membrane protein
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
*
Shewanella amazonensis SB2B

Site:
position = -52
score = 5.92796
sequence = TATTGATAATAATTATCAATT

Gene: Sama_2470: Hypothetical inner membrane protein
*
Shewanella loihica PV-4

Site:
position = -43
score = 6.28548
sequence = AAATGATAATGATTATCAATT

Gene: Shew_1146: Hypothetical inner membrane protein
*
Shewanella pealeana ATCC 700345

Site:
position = -33
score = 6.13016
sequence = TAATGATAATGATTATCAATT

Gene: Spea_1134: Hypothetical inner membrane protein
*
Shewanella halifaxensis HAW-EB4

Site:
position = -44
score = 6.06949
sequence = AATTGATAATGATTATCAATT

Gene: Shal_1179: Hypothetical inner membrane protein
*
Shewanella piezotolerans WP3

Site:
position = -43
score = 6.13016
sequence = TAATGATAATGATTATCAATT

Gene: swp_3598: Hypothetical inner membrane protein
*
Shewanella sediminis HAW-EB3

Site:
position = -41
score = 5.72253
sequence = TAATGATAATGATTATCAATC

Gene: Ssed_1239: Hypothetical inner membrane protein
*
Shewanella woodyi ATCC 51908

Site:
position = -42
score = 6.00891
sequence = AAATGATAATGATTATCAGTT

Gene: Swoo_1339: Hypothetical inner membrane protein
Hypothetical inner membrane protein
 
CRON 40.
ftn
*
Shewanella oneidensis MR-1

Site:
position = -133
score = 5.74412
sequence = AAATGAAAATCATTTTTATCA

Gene: SO0139: Ferritin, Ftn
*
Shewanella putrefaciens CN-32

Site:
position = -131
score = 5.74412
sequence = AAATGAAAATCATTTTTATCA

Gene: Sputcn32_0132: Ferritin, Ftn
*
Shewanella sp W3-18-1

Site:
position = -131
score = 5.74412
sequence = AAATGAAAATCATTTTTATCA

Gene: Sputw3181_3940: Ferritin, Ftn
*
Shewanella sp ANA-3

Site:
position = -132
score = 5.74412
sequence = AAATGAAAATCATTTTTATCA

Gene: Shewana3_0132: Ferritin, Ftn
*
Shewanella sp MR-4

Site:
position = -132
score = 5.3815
sequence = AAATGCAAATCATTTTTATCA

Gene: Shewmr4_0133: Ferritin, Ftn
*
Shewanella sp MR-7

Site:
position = -132
score = 5.3815
sequence = AAATGCAAATCATTTTTATCA

Gene: Shewmr7_0127: Ferritin, Ftn
*
Shewanella baltica OS155

Site:
position = -131
score = 5.74412
sequence = AAATGAAAATCATTTTTATCA

Gene: Sbal_4222: Ferritin, Ftn
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
*
Shewanella amazonensis SB2B

Site:
position = -113
score = 5.05053
sequence = TAATGATAAGTGTTACTATTT

Gene: Sama_0141: Ferritin, Ftn
*
Shewanella loihica PV-4

Site:
position = -381
score = 5.42415
sequence = TAACGATAATTATTTGCATTT

Gene: Shew_0042: Ferritin, Ftn
*
Shewanella pealeana ATCC 700345

Site:
position = -111
score = 6.01659
sequence = AAATGAAAACCATTATTATTT

Gene: Spea_0129: Ferritin, Ftn
*
Shewanella halifaxensis HAW-EB4

Site:
position = -111
score = 6.01659
sequence = AAATGAAAACCATTATTATTT

Gene: Shal_4189: Ferritin, Ftn
*
Shewanella piezotolerans WP3

Site:
position = -110
score = 6.01659
sequence = AAATGAAAACCATTATTATTT

Gene: swp_0167: Ferritin, Ftn
*
Shewanella sediminis HAW-EB3

Site:
position = -107
score = 5.70124
sequence = TAATGATAATTATTAGTATTT

Gene: Ssed_4374: Ferritin, Ftn
*
Shewanella woodyi ATCC 51908

Site:
position = -176
score = 5.65732
sequence = TAATGAGAATTATTTGTATTT

Gene: Swoo_4766: Ferritin, Ftn
Ferritin, Ftn
 
CRON 41.
omcA2
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
*
Shewanella pealeana ATCC 700345

Site:
position = -67
score = 5.31834
sequence = AAATGAGAGTTGTTCTCATAT

Gene: Spea_2697: Surface localized decaheme cytochrome c lipoprotein, OmcA
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
*
Shewanella woodyi ATCC 51908

Site:
position = -79
score = 4.5996
sequence = GAATAAGAATCACTCTTATCT

Gene: Swoo_3124: Surface localized decaheme cytochrome c lipoprotein, OmcA
Surface localized decaheme cytochrome c lipoprotein, OmcA
 
CRON 42.
SO4740
*
Shewanella oneidensis MR-1

Site:
position = -60
score = 5.95517
sequence = TAATGAGAATTGTTATCATCT

Gene: SO4740: Conserved hypothetical inner membrane protein
*
Shewanella putrefaciens CN-32

Site:
position = -59
score = 5.95517
sequence = TAATGAGAATTGTTATCATCT

Gene: Sputcn32_3921: Conserved hypothetical inner membrane protein
*
Shewanella sp W3-18-1

Site:
position = -59
score = 5.95517
sequence = TAATGAGAATTGTTATCATCT

Gene: Sputw3181_4047: Conserved hypothetical inner membrane protein
*
Shewanella sp ANA-3

Site:
position = -60
score = 5.95517
sequence = TAATGAGAATTGTTATCATCT

Gene: Shewana3_4124: Conserved hypothetical inner membrane protein
*
Shewanella sp MR-4

Site:
position = -60
score = 5.95517
sequence = TAATGAGAATTGTTATCATCT

Gene: Shewmr4_3919: Conserved hypothetical inner membrane protein
*
Shewanella sp MR-7

Site:
position = -60
score = 5.95517
sequence = TAATGAGAATTGTTATCATCT

Gene: Shewmr7_4011: Conserved hypothetical inner membrane protein
*
Shewanella baltica OS155

Site:
position = -59
score = 5.95517
sequence = TAATGAGAATTGTTATCATCT

Gene: Sbal_4341: Conserved hypothetical inner membrane protein
*
Shewanella denitrificans OS217

Site:
position = -50
score = 5.97483
sequence = TATTGATAACGATTATCATTT

Gene: Sden_3706: Conserved hypothetical inner membrane protein
*
Shewanella frigidimarina NCIMB 400

Site:
position = -46
score = 6.03885
sequence = TAATGAGAACTGTTATCATTT

Gene: Sfri_4031: Conserved hypothetical inner membrane protein
*
Shewanella amazonensis SB2B

Site:
position = -50
score = 5.93686
sequence = AAGTGATAACTATTATCATTT

Gene: Sama_3636: Conserved hypothetical inner membrane protein
*
Shewanella loihica PV-4

Site:
position = -46
score = 6.51527
sequence = AAATGATAATAATTATCATTT

Gene: Shew_3815: Conserved hypothetical inner membrane protein
*
Shewanella pealeana ATCC 700345

Site:
position = -47
score = 5.92807
sequence = AAATGAGAAGCGTTATCATTT

Gene: Spea_4226: Conserved hypothetical inner membrane protein
*
Shewanella halifaxensis HAW-EB4

Site:
position = -47
score = 6.34615
sequence = AAATGATAACCATTATCATTT

Gene: Shal_4274: Conserved hypothetical inner membrane protein
*
Shewanella piezotolerans WP3

Site:
position = -46
score = 6.10715
sequence = AAATGATAATCGTTATCATCT

Gene: swp_5137: Conserved hypothetical inner membrane protein
*
Shewanella sediminis HAW-EB3

Site:
position = -47
score = 6.11049
sequence = AGATGAGAATAGTTATCATTT

Gene: Ssed_4479: Conserved hypothetical inner membrane protein
*
Shewanella woodyi ATCC 51908

Site:
position = -50
score = 6.3357
sequence = AAATGAGAACCATTATCATTT

Gene: Swoo_4887: Conserved hypothetical inner membrane protein
Conserved hypothetical inner membrane protein
 
CRON 43.
swp_4957
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
*
Shewanella piezotolerans WP3

Site:
position = -84
score = 5.74799
sequence = GAATGAGAATCAATATCATTT

Gene: swp_4957: Outer membrane receptor protein, mostly Fe transport
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Outer membrane receptor protein, mostly Fe transport
swp_4956
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3

Gene: swp_4956: Probable zinc protease
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Probable zinc protease
swp_4955
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3

Gene: swp_4955: ABC-type uncharacterized transport system, permease and ATPase components
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
ABC-type uncharacterized transport system, permease and ATPase components
Sden_2158
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217

Gene: Sden_2158: TonB mediate energy transduction system, conserved hypothetical periplasmic component
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3

Gene: swp_4954: TonB mediate energy transduction system, conserved hypothetical periplasmic component
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
TonB mediate energy transduction system, conserved hypothetical periplasmic component
ttpc
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217

Gene: Sden_2157: TonB mediated energy transduction system, inner membrane component, TtpC
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3

Gene: swp_4953: TonB mediated energy transduction system, inner membrane component, TtpC
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
TonB mediated energy transduction system, inner membrane component, TtpC
exbB
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217

Gene: Sden_2156: TonB mediated energy transduction system, inner membrane component, ExbB
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3

Gene: swp_4952: TonB mediated energy transduction system, inner membrane component, ExbB
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
TonB mediated energy transduction system, inner membrane component, ExbB
exbD
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217

Gene: Sden_2155: TonB mediated energy transduction system, membrane anchored component, ExbD
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3

Gene: swp_4950: TonB mediated energy transduction system, membrane anchored component, ExbD
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
TonB mediated energy transduction system, membrane anchored component, ExbD
swp_4949
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3

Gene: swp_4949: Hypothetical protein
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Hypothetical protein
Sden_2154
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217

Gene: Sden_2154: TonB mediated energy transduction system, energy transducer component, TonB
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3

Gene: swp_4948: TonB mediated energy transduction system, energy transducer component, TonB
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
TonB mediated energy transduction system, energy transducer component, TonB
tprX
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217

Gene: Sden_2153: TPR repeat-containing protein
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3

Gene: swp_4947: TPR repeat-containing protein
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
TPR repeat-containing protein
Sden_2159
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
*
Shewanella denitrificans OS217

Site:
position = -58
score = 5.7843
sequence = TATTGAGATTCATTATCATTT

Gene: Sden_2159: TonB-dependent receptor
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
TonB-dependent receptor
SO1188
*
Shewanella oneidensis MR-1

Site:
position = -185
score = 5.43001
sequence = TTTTGATAATAAATATCATTT

Gene: SO1188: Inner membrane protein with PepSY TM helix
*
Shewanella putrefaciens CN-32

Site:
position = -93
score = 5.17771
sequence = GTTTGATAATAAATATCATTT

Gene: Sputcn32_2850: Inner membrane protein with PepSY TM helix
*
Shewanella sp W3-18-1

Site:
position = -93
score = 5.17771
sequence = GTTTGATAATAAATATCATTT

Gene: Sputw3181_1054: Inner membrane protein with PepSY TM helix
*
Shewanella sp ANA-3

Site:
position = -181
score = 5.56954
sequence = TGTTGATAATAAATATCATTT

Gene: Shewana3_1014: Inner membrane protein with PepSY TM helix
*
Shewanella sp MR-4

Site:
position = -181
score = 5.56954
sequence = TGTTGATAATAAATATCATTT

Gene: Shewmr4_1010: Inner membrane protein with PepSY TM helix
*
Shewanella sp MR-7

Site:
position = -181
score = 5.56954
sequence = TGTTGATAATAAATATCATTT

Gene: Shewmr7_1075: Inner membrane protein with PepSY TM helix
*
Shewanella baltica OS155

Site:
position = -45
score = 5.40576
sequence = ATTTGATAATCGATCTCATTT

Gene: Sbal_3255: Inner membrane protein with PepSY TM helix
 
Shewanella denitrificans OS217

Gene: Sden_2152: Inner membrane protein with PepSY TM helix
 
Shewanella frigidimarina NCIMB 400
*
Shewanella amazonensis SB2B

Site:
position = -73
score = 4.8188
sequence = TGGTGAGAATTACTCTCAATT

Gene: Sama_2808: Inner membrane protein with PepSY TM helix
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
*
Shewanella piezotolerans WP3

Site:
position = -102
score = 4.28607
sequence = TGATCATAATTGTTTTAAATC

Gene: swp_3069: Inner membrane protein with PepSY TM helix
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Inner membrane protein with PepSY TM helix
SO1189
 
Shewanella oneidensis MR-1

Gene: SO1189: Putative exported protein
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2849: Putative exported protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_1055: Putative exported protein
 
Shewanella sp ANA-3

Gene: Shewana3_1015: Putative exported protein
 
Shewanella sp MR-4

Gene: Shewmr4_1011: Putative exported protein
 
Shewanella sp MR-7

Gene: Shewmr7_1076: Putative exported protein
 
Shewanella baltica OS155

Gene: Sbal_3254: Putative exported protein
 
Shewanella denitrificans OS217

Gene: Sden_2151: Putative exported protein
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_2809: Putative exported protein
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3

Gene: swp_3071: Putative exported protein
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Putative exported protein
SO1190
 
Shewanella oneidensis MR-1

Gene: SO1190: putative exported protein
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2848: putative exported protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_1056: putative exported protein
 
Shewanella sp ANA-3

Gene: Shewana3_1016: putative exported protein
 
Shewanella sp MR-4

Gene: Shewmr4_1012: putative exported protein
 
Shewanella sp MR-7

Gene: Shewmr7_1077: putative exported protein
 
Shewanella baltica OS155

Gene: Sbal_3253: putative exported protein
 
Shewanella denitrificans OS217

Gene: Sden_2150: putative exported protein
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_2810: putative exported protein
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
putative exported protein
 
CRON 44.
omp
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
*
Shewanella frigidimarina NCIMB 400

Site:
position = -102
score = 4.97258
sequence = GATTGATAATCGTTGTTATTA

Gene: Sfri_3225: TonB-dependent siderophore receptor
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
TonB-dependent siderophore receptor
SO0447
*
Shewanella oneidensis MR-1

Site:
position = -146
score = 5.21078
sequence = TATTGCGAACTATTCTCATCA

Gene: SO0447: Iron-regulated inner membrane protein
*
Shewanella putrefaciens CN-32

Site:
position = -184
score = 5.24425
sequence = TATTGCGAATTGTTATCAATA

Gene: Sputcn32_3397: Iron-regulated inner membrane protein
*
Shewanella sp W3-18-1

Site:
position = -182
score = 5.24425
sequence = TATTGCGAATTGTTATCAATA

Gene: Sputw3181_0546: Iron-regulated inner membrane protein
*
Shewanella sp ANA-3

Site:
position = -152
score = 5.05546
sequence = TATTGCGAACTGTTCTCATCA

Gene: Shewana3_0445: Iron-regulated inner membrane protein
*
Shewanella sp MR-4

Site:
position = -153
score = 4.7877
sequence = TATTGCGAACTATTCTCACCA

Gene: Shewmr4_0449: Iron-regulated inner membrane protein
*
Shewanella sp MR-7

Site:
position = -155
score = 4.7877
sequence = TATTGCGAACTATTCTCACCA

Gene: Shewmr7_3580: Iron-regulated inner membrane protein
 
Shewanella baltica OS155
*
Shewanella denitrificans OS217

Site:
position = -72
score = 5.23678
sequence = AATTGCAAATCACTCTCATTT

Gene: Sden_0620: Iron-regulated inner membrane protein
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3224: Iron-regulated inner membrane protein
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Iron-regulated inner membrane protein
SO0448
 
Shewanella oneidensis MR-1

Gene: SO0448: Iron-regulated inner membrane protein
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3396: Iron-regulated inner membrane protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_0547: Iron-regulated inner membrane protein
 
Shewanella sp ANA-3

Gene: Shewana3_0446: Iron-regulated inner membrane protein
 
Shewanella sp MR-4

Gene: Shewmr4_0450: Iron-regulated inner membrane protein
 
Shewanella sp MR-7

Gene: Shewmr7_3579: Iron-regulated inner membrane protein
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217

Gene: Sden_0619: Iron-regulated inner membrane protein
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3223: Iron-regulated inner membrane protein
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
*
Shewanella piezotolerans WP3

Site:
position = -456
score = 5.26396
sequence = AATTGCGAATCATTCACATTT

Gene: swp_0160: Iron-regulated inner membrane protein
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Iron-regulated inner membrane protein
SO0449
 
Shewanella oneidensis MR-1

Gene: SO0449: Iron-regulated membrane protein
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3395: Iron-regulated membrane protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_0548: Iron-regulated membrane protein
 
Shewanella sp ANA-3

Gene: Shewana3_0447: Iron-regulated membrane protein
 
Shewanella sp MR-4

Gene: Shewmr4_0451: Iron-regulated membrane protein
 
Shewanella sp MR-7

Gene: Shewmr7_3578: Iron-regulated membrane protein
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217

Gene: Sden_0618: Iron-regulated membrane protein
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3222: Iron-regulated membrane protein
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3

Gene: swp_0159: Iron-regulated membrane protein
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Iron-regulated membrane protein
 
CRON 45.
Spea_3339
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
*
Shewanella pealeana ATCC 700345

Site:
position = -53
score = 5.76541
sequence = ATTTGATAATAATTATCATTA

Gene: Spea_3339: Coproporphyrinogen III oxidase
*
Shewanella halifaxensis HAW-EB4

Site:
position = -54
score = 5.90694
sequence = ATTTGATAATGATTATCATTT

Gene: Shal_3411: Coproporphyrinogen III oxidase
*
Shewanella piezotolerans WP3

Site:
position = -48
score = 5.89116
sequence = AGTTGATAATGATTATCATTA

Gene: swp_3985: Coproporphyrinogen III oxidase
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Coproporphyrinogen III oxidase
 
CRON 46.
hmuA
*
Shewanella oneidensis MR-1

Site:
position = -169
score = 5.72154
sequence = AAATGATAATGATTTCTATTT

Gene: SO3669: TonB-dependent haem/haemoglobin receptor, HmuA
*
Shewanella putrefaciens CN-32

Site:
position = -178
score = 6.0511
sequence = AAATGATAATGATTACCATTT

Gene: Sputcn32_0966: TonB-dependent haem/haemoglobin receptor, HmuA
*
Shewanella sp W3-18-1

Site:
position = -178
score = 6.0511
sequence = AAATGATAATGATTACCATTT

Gene: Sputw3181_3201: TonB-dependent haem/haemoglobin receptor, HmuA
*
Shewanella sp ANA-3

Site:
position = -171
score = 6.01763
sequence = AAATGATAATGATTTCCATTT

Gene: Shewana3_3235: TonB-dependent haem/haemoglobin receptor, HmuA
 
Shewanella sp MR-4
 
Shewanella sp MR-7
*
Shewanella baltica OS155

Site:
position = -284
score = 6.10539
sequence = AAATGATAATGATTTGCATTT

Gene: Sbal_0952: TonB-dependent haem/haemoglobin receptor, HmuA
*
Shewanella denitrificans OS217

Site:
position = -133
score = 6.468
sequence = AAATGATAATGATTTTCATTT

Gene: Sden_0790: TonB-dependent haem/haemoglobin receptor, HmuA
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
*
Shewanella pealeana ATCC 700345

Site:
position = -143
score = 6.468
sequence = AAATGATAATGATTTTCATTT

Gene: Spea_3327: TonB-dependent haem/haemoglobin receptor, HmuA
*
Shewanella halifaxensis HAW-EB4

Site:
position = -144
score = 6.468
sequence = AAATGATAATGATTTTCATTT

Gene: Shal_3399: TonB-dependent haem/haemoglobin receptor, HmuA
*
Shewanella piezotolerans WP3

Site:
position = -143
score = 6.468
sequence = AAATGATAATGATTTTCATTT

Gene: swp_3978: TonB-dependent haem/haemoglobin receptor, HmuA
 
Shewanella sediminis HAW-EB3
*
Shewanella woodyi ATCC 51908

Site:
position = -113
score = 6.468
sequence = AAATGATAATGATTTTCATTT

Gene: Swoo_4004: TonB-dependent haem/haemoglobin receptor, HmuA
TonB-dependent haem/haemoglobin receptor, HmuA
huvX
 
Shewanella oneidensis MR-1

Gene: SO3668: Putative heme iron utilization protein
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0967: Putative heme iron utilization protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_3200: Putative heme iron utilization protein
 
Shewanella sp ANA-3

Gene: Shewana3_3234: Putative heme iron utilization protein
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155

Gene: Sbal_0953: Putative heme iron utilization protein
 
Shewanella denitrificans OS217

Gene: Sden_0791: Putative heme iron utilization protein
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345

Gene: Spea_3326: Putative heme iron utilization protein
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3398: Putative heme iron utilization protein
 
Shewanella piezotolerans WP3

Gene: swp_3976: Putative heme iron utilization protein
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908

Gene: Swoo_4003: Putative heme iron utilization protein
Putative heme iron utilization protein
SO3667
 
Shewanella oneidensis MR-1

Gene: SO3667: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0968: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_3199: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
 
Shewanella sp ANA-3

Gene: Shewana3_3233: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155

Gene: Sbal_0954: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
 
Shewanella denitrificans OS217

Gene: Sden_0792: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345

Gene: Spea_3325: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3397: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
 
Shewanella piezotolerans WP3

Gene: swp_3974: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908

Gene: Swoo_4002: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
 
CRON 47.
pubA
*
Shewanella oneidensis MR-1

Site:
position = -208
score = 5.70061
sequence = AGATGAGAACGATTTGCATTT

Gene: SO3030: Putrescine monooxygenase, PubA
*
Shewanella putrefaciens CN-32

Site:
position = -219
score = 5.95007
sequence = AAATGATAACGATTTGCATTT

Gene: Sputcn32_2411: Putrescine monooxygenase, PubA
*
Shewanella sp W3-18-1

Site:
position = -219
score = 5.95007
sequence = AAATGATAACGATTTGCATTT

Gene: Sputw3181_1597: Putrescine monooxygenase, PubA
*
Shewanella sp ANA-3

Site:
position = -224
score = 6.09494
sequence = AAATGAGAATGATTTGCATTT

Gene: Shewana3_1510: Putrescine monooxygenase, PubA
*
Shewanella sp MR-4

Site:
position = -222
score = 5.93961
sequence = AAATGAGAATGGTTTGCATTT

Gene: Shewmr4_1454: Putrescine monooxygenase, PubA
*
Shewanella sp MR-7

Site:
position = -223
score = 5.93961
sequence = AAATGAGAATGGTTTGCATTT

Gene: Shewmr7_1520: Putrescine monooxygenase, PubA
*
Shewanella baltica OS155

Site:
position = -232
score = 6.09494
sequence = AAATGAGAATGATTTGCATTT

Gene: Sbal_2708: Putrescine monooxygenase, PubA
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Putrescine monooxygenase, PubA
pubB
 
Shewanella oneidensis MR-1

Gene: SO3031: N-hydroxyputrescine-succinyl CoA transferase, PubB
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2412: N-hydroxyputrescine-succinyl CoA transferase, PubB
 
Shewanella sp W3-18-1

Gene: Sputw3181_1596: N-hydroxyputrescine-succinyl CoA transferase, PubB
 
Shewanella sp ANA-3

Gene: Shewana3_1509: N-hydroxyputrescine-succinyl CoA transferase, PubB
 
Shewanella sp MR-4

Gene: Shewmr4_1453: N-hydroxyputrescine-succinyl CoA transferase, PubB
 
Shewanella sp MR-7

Gene: Shewmr7_1519: N-hydroxyputrescine-succinyl CoA transferase, PubB
 
Shewanella baltica OS155

Gene: Sbal_2709: N-hydroxyputrescine-succinyl CoA transferase, PubB
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
N-hydroxyputrescine-succinyl CoA transferase, PubB
pubC
 
Shewanella oneidensis MR-1

Gene: SO3032: NTP-dependent putrebactin synthetase, PubC
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2413: NTP-dependent putrebactin synthetase, PubC
 
Shewanella sp W3-18-1

Gene: Sputw3181_1595: NTP-dependent putrebactin synthetase, PubC
 
Shewanella sp ANA-3

Gene: Shewana3_1508: NTP-dependent putrebactin synthetase, PubC
 
Shewanella sp MR-4

Gene: Shewmr4_1452: NTP-dependent putrebactin synthetase, PubC
 
Shewanella sp MR-7

Gene: Shewmr7_1518: NTP-dependent putrebactin synthetase, PubC
 
Shewanella baltica OS155

Gene: Sbal_2710: NTP-dependent putrebactin synthetase, PubC
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
NTP-dependent putrebactin synthetase, PubC
putA
 
Shewanella oneidensis MR-1

Gene: SO3033: TonB-dependent ferric putrebactin siderophore receptor, PutA
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2414: TonB-dependent ferric putrebactin siderophore receptor, PutA
 
Shewanella sp W3-18-1

Gene: Sputw3181_1594: TonB-dependent ferric putrebactin siderophore receptor, PutA
 
Shewanella sp ANA-3

Gene: Shewana3_1507: TonB-dependent ferric putrebactin siderophore receptor, PutA
 
Shewanella sp MR-4

Gene: Shewmr4_1451: TonB-dependent ferric putrebactin siderophore receptor, PutA
 
Shewanella sp MR-7

Gene: Shewmr7_1517: TonB-dependent ferric putrebactin siderophore receptor, PutA
 
Shewanella baltica OS155

Gene: Sbal_2711: TonB-dependent ferric putrebactin siderophore receptor, PutA
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
TonB-dependent ferric putrebactin siderophore receptor, PutA
putB
 
Shewanella oneidensis MR-1

Gene: SO3034: Ferric putrebactin reductase, PutB
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2415: Ferric putrebactin reductase, PutB
 
Shewanella sp W3-18-1

Gene: Sputw3181_1593: Ferric putrebactin reductase, PutB
 
Shewanella sp ANA-3

Gene: Shewana3_1506: Ferric putrebactin reductase, PutB
 
Shewanella sp MR-4

Gene: Shewmr4_1450: Ferric putrebactin reductase, PutB
 
Shewanella sp MR-7

Gene: Shewmr7_1516: Ferric putrebactin reductase, PutB
 
Shewanella baltica OS155

Gene: Sbal_2712: Ferric putrebactin reductase, PutB
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Ferric putrebactin reductase, PutB
 
CRON 48.
mtrD
*
Shewanella oneidensis MR-1

Site:
position = -370
score = 5.41545
sequence = TAACGATAATAGTTTTCAATT

Gene: SO1782: Periplasmic decaheme cytochrome c, MtrD
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
*
Shewanella sp ANA-3

Site:
position = -326
score = 5.41545
sequence = TAACGATAATAGTTTTCAATT

Gene: Shewana3_2672: Periplasmic decaheme cytochrome c, MtrD
*
Shewanella sp MR-4

Site:
position = -326
score = 5.41545
sequence = TAACGATAATAGTTTTCAATT

Gene: Shewmr4_2506: Periplasmic decaheme cytochrome c, MtrD
*
Shewanella sp MR-7

Site:
position = -326
score = 5.41545
sequence = TAACGATAATAGTTTTCAATT

Gene: Shewmr7_2574: Periplasmic decaheme cytochrome c, MtrD
*
Shewanella baltica OS155

Site:
position = -335
score = 5.41545
sequence = TAACGATAATAGTTTTCAATT

Gene: Sbal_1593: Periplasmic decaheme cytochrome c, MtrD
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
*
Shewanella amazonensis SB2B

Site:
position = -297
score = 5.57077
sequence = TAACGATAATAATTTTCAATT

Site:
position = -150
score = 4.68402
sequence = AAATCAGACTAATTATTAATA

Gene: Sama_1213: Periplasmic decaheme cytochrome c, MtrD
*
Shewanella loihica PV-4

Site:
position = -291
score = 5.7261
sequence = AAACGATAATAATTTTCAATT

Site:
position = -222
score = 5.82512
sequence = AAATGAGAACCATTTTCATTG

Gene: Shew_2519: Periplasmic decaheme cytochrome c, MtrD
*
Shewanella pealeana ATCC 700345

Site:
position = -317
score = 5.7261
sequence = AAACGATAATAATTTTCAATT

Site:
position = -252
score = 5.07715
sequence = AATTAAGAATGGTTACTATTT

Gene: Spea_2692: Periplasmic decaheme cytochrome c, MtrD
*
Shewanella halifaxensis HAW-EB4

Site:
position = -336
score = 5.7261
sequence = AAACGATAATAATTTTCAATT

Gene: Shal_2778: Periplasmic decaheme cytochrome c, MtrD
*
Shewanella piezotolerans WP3

Site:
position = -339
score = 5.7261
sequence = AAACGATAATAATTTTCAATT

Site:
position = -239
score = 5.3036
sequence = AAATAGTAATGGTTATTATTT

Gene: swp_3272: Periplasmic decaheme cytochrome c, MtrD
*
Shewanella sediminis HAW-EB3

Site:
position = -322
score = 5.56032
sequence = AAACGAGAATAGTTTTCAATT

Site:
position = -229
score = 4.8816
sequence = AGATGAGAATGATTATCGCTC

Site:
position = -110
score = 4.78379
sequence = AGATAAAAATGTTACTCATTT

Gene: Ssed_1530: Periplasmic decaheme cytochrome c, MtrD
 
Shewanella woodyi ATCC 51908
Periplasmic decaheme cytochrome c, MtrD
mtrE
 
Shewanella oneidensis MR-1

Gene: SO1781: Outer membrane protein, MtrE
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3

Gene: Shewana3_2673: Outer membrane protein, MtrE
 
Shewanella sp MR-4

Gene: Shewmr4_2507: Outer membrane protein, MtrE
 
Shewanella sp MR-7

Gene: Shewmr7_2575: Outer membrane protein, MtrE
 
Shewanella baltica OS155

Gene: Sbal_1592: Outer membrane protein, MtrE
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_1212: Outer membrane protein, MtrE
 
Shewanella loihica PV-4

Gene: Shew_2520: Outer membrane protein, MtrE
 
Shewanella pealeana ATCC 700345

Gene: Spea_2693: Outer membrane protein, MtrE
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2779: Outer membrane protein, MtrE
 
Shewanella piezotolerans WP3

Gene: swp_3273: Outer membrane protein, MtrE
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1529: Outer membrane protein, MtrE
 
Shewanella woodyi ATCC 51908
Outer membrane protein, MtrE
mtrF
 
Shewanella oneidensis MR-1

Gene: SO1780: Surface localized decaheme cytochrome c lipoprotein, MtrF
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3

Gene: Shewana3_2674: Surface localized decaheme cytochrome c lipoprotein, MtrF
 
Shewanella sp MR-4

Gene: Shewmr4_2508: Surface localized decaheme cytochrome c lipoprotein, MtrF
 
Shewanella sp MR-7

Gene: Shewmr7_2576: Surface localized decaheme cytochrome c lipoprotein, MtrF
 
Shewanella baltica OS155

Gene: Sbal_1591: Surface localized decaheme cytochrome c lipoprotein, MtrF
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_1211: Surface localized decaheme cytochrome c lipoprotein, MtrF
 
Shewanella loihica PV-4

Gene: Shew_2521: Surface localized decaheme cytochrome c lipoprotein, MtrF
 
Shewanella pealeana ATCC 700345

Gene: Spea_2694: Surface localized decaheme cytochrome c lipoprotein, MtrF
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2780: Surface localized decaheme cytochrome c lipoprotein, MtrF
 
Shewanella piezotolerans WP3

Gene: swp_3274: Surface localized decaheme cytochrome c lipoprotein, MtrF
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1528: Surface localized decaheme cytochrome c lipoprotein, MtrF
 
Shewanella woodyi ATCC 51908
Surface localized decaheme cytochrome c lipoprotein, MtrF
omcA
*
Shewanella oneidensis MR-1

Site:
position = -64
score = 5.55222
sequence = TAATGAGATTTGTTCTTATTT

Gene: SO1779: Surface localized decaheme cytochrome c lipoprotein, OmcA
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
*
Shewanella sp ANA-3

Site:
position = -64
score = 5.29992
sequence = TAATGAGATTTATTCTTATTC

Gene: Shewana3_2675: Surface localized decaheme cytochrome c lipoprotein, OmcA
*
Shewanella sp MR-4

Site:
position = -64
score = 5.70755
sequence = TAATGAGATTTATTCTTATTT

Gene: Shewmr4_2509: Surface localized decaheme cytochrome c lipoprotein, OmcA
*
Shewanella sp MR-7

Site:
position = -64
score = 5.70755
sequence = TAATGAGATTTATTCTTATTT

Gene: Shewmr7_2577: Surface localized decaheme cytochrome c lipoprotein, OmcA
*
Shewanella baltica OS155

Site:
position = -64
score = 5.46855
sequence = TAATGAGATTTATTCTTATCT

Gene: Sbal_1590: Surface localized decaheme cytochrome c lipoprotein, OmcA
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2636: Surface localized decaheme cytochrome c lipoprotein, OmcA
 
Shewanella amazonensis SB2B

Gene: Sama_1210: Surface localized decaheme cytochrome c lipoprotein, OmcA
 
Shewanella loihica PV-4

Gene: Shew_2522: Surface localized decaheme cytochrome c lipoprotein, OmcA
 
Shewanella pealeana ATCC 700345

Gene: Spea_2695: Surface localized decaheme cytochrome c lipoprotein, OmcA
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2781: Surface localized decaheme cytochrome c lipoprotein, OmcA
 
Shewanella piezotolerans WP3

Gene: swp_3275: Surface localized decaheme cytochrome c lipoprotein, OmcA
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1527: Surface localized decaheme cytochrome c lipoprotein, OmcA
 
Shewanella woodyi ATCC 51908
Surface localized decaheme cytochrome c lipoprotein, OmcA
 
CRON 49.
feoA
*
Shewanella oneidensis MR-1

Site:
position = -121
score = 5.41545
sequence = AATTGAAAACTATTATCGTTA

Gene: SO1783: Ferrous iron transport protein A
*
Shewanella putrefaciens CN-32

Site:
position = -123
score = 5.41545
sequence = AATTGAAAACTATTATCGTTA

Gene: Sputcn32_1480: Ferrous iron transport protein A
*
Shewanella sp W3-18-1

Site:
position = -123
score = 5.41545
sequence = AATTGAAAACTATTATCGTTA

Gene: Sputw3181_2621: Ferrous iron transport protein A
*
Shewanella sp ANA-3

Site:
position = -121
score = 5.41545
sequence = AATTGAAAACTATTATCGTTA

Gene: Shewana3_2671: Ferrous iron transport protein A
*
Shewanella sp MR-4

Site:
position = -121
score = 5.41545
sequence = AATTGAAAACTATTATCGTTA

Gene: Shewmr4_2505: Ferrous iron transport protein A
*
Shewanella sp MR-7

Site:
position = -121
score = 5.41545
sequence = AATTGAAAACTATTATCGTTA

Gene: Shewmr7_2573: Ferrous iron transport protein A
*
Shewanella baltica OS155

Site:
position = -121
score = 5.41545
sequence = AATTGAAAACTATTATCGTTA

Gene: Sbal_1594: Ferrous iron transport protein A
*
Shewanella denitrificans OS217

Site:
position = -116
score = 5.41545
sequence = AATTGAAAACTATTATCGTTA

Gene: Sden_2415: Ferrous iron transport protein A
*
Shewanella frigidimarina NCIMB 400

Site:
position = -111
score = 5.12843
sequence = AACTGAAAACTATTCTCGTTA

Gene: Sfri_2617: Ferrous iron transport protein A
*
Shewanella amazonensis SB2B

Site:
position = -119
score = 5.57077
sequence = AATTGAAAATTATTATCGTTA

Gene: Sama_1214: Ferrous iron transport protein A
*
Shewanella loihica PV-4

Site:
position = -123
score = 5.7261
sequence = AATTGAAAATTATTATCGTTT

Site:
position = -192
score = 5.82512
sequence = CAATGAAAATGGTTCTCATTT

Gene: Shew_2518: Ferrous iron transport protein A
*
Shewanella pealeana ATCC 700345

Site:
position = -126
score = 5.7261
sequence = AATTGAAAATTATTATCGTTT

Site:
position = -191
score = 5.07715
sequence = AAATAGTAACCATTCTTAATT

Gene: Spea_2691: Ferrous iron transport protein A
*
Shewanella halifaxensis HAW-EB4

Site:
position = -126
score = 5.7261
sequence = AATTGAAAATTATTATCGTTT

Gene: Shal_2777: Ferrous iron transport protein A
*
Shewanella piezotolerans WP3

Site:
position = -125
score = 5.7261
sequence = AATTGAAAATTATTATCGTTT

Site:
position = -225
score = 5.3036
sequence = AAATAATAACCATTACTATTT

Gene: swp_3271: Ferrous iron transport protein A
*
Shewanella sediminis HAW-EB3

Site:
position = -126
score = 5.56032
sequence = AATTGAAAACTATTCTCGTTT

Site:
position = -219
score = 4.8816
sequence = GAGCGATAATCATTCTCATCT

Gene: Ssed_1531: Ferrous iron transport protein A
*
Shewanella woodyi ATCC 51908

Site:
position = -125
score = 5.57077
sequence = AATTGAAAACTATTATCGTTT

Site:
position = -218
score = 4.80034
sequence = TAGTGATAATCGTTCTCACAA

Gene: Swoo_3123: Ferrous iron transport protein A
Ferrous iron transport protein A
feoB
 
Shewanella oneidensis MR-1

Gene: SO1784: Ferrous iron transport protein B
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1481: Ferrous iron transport protein B
 
Shewanella sp W3-18-1

Gene: Sputw3181_2620: Ferrous iron transport protein B
 
Shewanella sp ANA-3

Gene: Shewana3_2670: Ferrous iron transport protein B
 
Shewanella sp MR-4

Gene: Shewmr4_2504: Ferrous iron transport protein B
 
Shewanella sp MR-7

Gene: Shewmr7_2572: Ferrous iron transport protein B
 
Shewanella baltica OS155

Gene: Sbal_1595: Ferrous iron transport protein B
 
Shewanella denitrificans OS217

Gene: Sden_2414: Ferrous iron transport protein B
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2616: Ferrous iron transport protein B
 
Shewanella amazonensis SB2B

Gene: Sama_1215: Ferrous iron transport protein B
 
Shewanella loihica PV-4

Gene: Shew_2517: Ferrous iron transport protein B
 
Shewanella pealeana ATCC 700345

Gene: Spea_2690: Ferrous iron transport protein B
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2776: Ferrous iron transport protein B
 
Shewanella piezotolerans WP3

Gene: swp_3270: Ferrous iron transport protein B
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1532: Ferrous iron transport protein B
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3122: Ferrous iron transport protein B
Ferrous iron transport protein B
 
CRON 50.
omcA3
 
Shewanella oneidensis MR-1
*
Shewanella putrefaciens CN-32

Site:
position = -64
score = 5.70755
sequence = TAATGAGATTAATTCTTATTT

Gene: Sputcn32_1479: Surface localized undecaheme cytochrome c lipoprotein, UndA
*
Shewanella sp W3-18-1

Site:
position = -64
score = 5.70755
sequence = TAATGAGATTAATTCTTATTT

Gene: Sputw3181_2622: Surface localized undecaheme cytochrome c lipoprotein, UndA
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345

Gene: Spea_2696: Surface localized undecaheme cytochrome c lipoprotein, UndA
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2782: Surface localized undecaheme cytochrome c lipoprotein, UndA
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Surface localized undecaheme cytochrome c lipoprotein, UndA
 
CRON 51.
SO1482
*
Shewanella oneidensis MR-1

Site:
position = -49
score = 4.96337
sequence = GGATGGAAATCATTATCATTC

Gene: SO1482: TonB-dependent receptor
*
Shewanella putrefaciens CN-32

Site:
position = -49
score = 4.65521
sequence = AAATACAAATCATTACTATTC

Gene: Sputcn32_1237: TonB-dependent receptor
*
Shewanella sp W3-18-1

Site:
position = -49
score = 4.65521
sequence = AAATACAAATCATTACTATTC

Gene: Sputw3181_2867: TonB-dependent receptor
*
Shewanella sp ANA-3

Site:
position = -48
score = 5.82138
sequence = AGATGAAAATCATTATCATTC

Gene: Shewana3_2944: TonB-dependent receptor
*
Shewanella sp MR-4

Site:
position = -48
score = 5.82138
sequence = AGATGAAAATCATTATCATTC

Gene: Shewmr4_2768: TonB-dependent receptor
*
Shewanella sp MR-7

Site:
position = -48
score = 5.82138
sequence = AGATGAAAATCATTATCATTC

Gene: Shewmr7_2846: TonB-dependent receptor
*
Shewanella baltica OS155

Site:
position = -49
score = 4.9513
sequence = AAATGCAAATCATTACTATTC

Gene: Sbal_1315: TonB-dependent receptor
*
Shewanella denitrificans OS217

Site:
position = -48
score = 5.2382
sequence = CTATGATAATCATTATCATTC

Gene: Sden_1445: TonB-dependent receptor
*
Shewanella frigidimarina NCIMB 400

Site:
position = -52
score = 5.55998
sequence = TTATGATAATCATTATCATTC

Gene: Sfri_2440: TonB-dependent receptor
 
Shewanella amazonensis SB2B
*
Shewanella loihica PV-4

Site:
position = -51
score = 5.97483
sequence = TATTGATAATCGTTATCATTT

Gene: Shew_2690: TonB-dependent receptor
*
Shewanella pealeana ATCC 700345

Site:
position = -51
score = 5.95182
sequence = TAATGATAATCGTTATCATCT

Gene: Spea_2930: TonB-dependent receptor
*
Shewanella halifaxensis HAW-EB4

Site:
position = -51
score = 5.64528
sequence = TAATAAGAATCGTTATCATCT

Gene: Shal_3021: TonB-dependent receptor
*
Shewanella piezotolerans WP3

Site:
position = -51
score = 5.7965
sequence = TAATGATAATGGTTATCATCA

Gene: swp_3568: TonB-dependent receptor
*
Shewanella sediminis HAW-EB3

Site:
position = -49
score = 5.54244
sequence = AAATGCAAATCGTTATCATTC

Gene: Ssed_3242: TonB-dependent receptor
*
Shewanella woodyi ATCC 51908

Site:
position = -51
score = 5.95182
sequence = TAATGATAATCGTTATCATCT

Gene: Swoo_3375: TonB-dependent receptor
TonB-dependent receptor
 
CRON 52.
bfd
*
Shewanella oneidensis MR-1

Site:
position = -55
score = 5.31052
sequence = ATTTGATAAGCGTTTTCATTT

Gene: SO0583: Bacterioferritin-associated ferredoxin
*
Shewanella putrefaciens CN-32

Site:
position = -54
score = 5.31052
sequence = ATTTGATAAGCGTTTTCATTT

Gene: Sputcn32_3295: Bacterioferritin-associated ferredoxin
*
Shewanella sp W3-18-1

Site:
position = -54
score = 5.31052
sequence = ATTTGATAAGCGTTTTCATTT

Gene: Sputw3181_0646: Bacterioferritin-associated ferredoxin
*
Shewanella sp ANA-3

Site:
position = -54
score = 5.31052
sequence = ATTTGATAAGCGTTTTCATTT

Gene: Shewana3_0581: Bacterioferritin-associated ferredoxin
*
Shewanella sp MR-4

Site:
position = -54
score = 5.31052
sequence = ATTTGATAAGCGTTTTCATTT

Gene: Shewmr4_0582: Bacterioferritin-associated ferredoxin
*
Shewanella sp MR-7

Site:
position = -54
score = 5.31052
sequence = ATTTGATAAGCGTTTTCATTT

Gene: Shewmr7_3448: Bacterioferritin-associated ferredoxin
*
Shewanella baltica OS155

Site:
position = -53
score = 5.31052
sequence = ATTTGATAAGCGTTTTCATTT

Gene: Sbal_0542: Bacterioferritin-associated ferredoxin
*
Shewanella denitrificans OS217

Site:
position = -99
score = 5.68025
sequence = CAATGATAACCGTTTTCATTT

Gene: Sden_3217: Bacterioferritin-associated ferredoxin
*
Shewanella frigidimarina NCIMB 400

Site:
position = -76
score = 5.68025
sequence = CAATGATAACCGTTTTCATTT

Gene: Sfri_3324: Bacterioferritin-associated ferredoxin
*
Shewanella amazonensis SB2B

Site:
position = -59
score = 5.45649
sequence = TGATGAGAACGGTTTTTATTT

Gene: Sama_3040: Bacterioferritin-associated ferredoxin
*
Shewanella loihica PV-4

Site:
position = -57
score = 5.40204
sequence = CAGTGAGAATCGTTTTCATTT

Gene: Shew_0552: Bacterioferritin-associated ferredoxin
*
Shewanella pealeana ATCC 700345

Site:
position = -58
score = 5.76445
sequence = CATTGAGAATCATTTTCATTT

Gene: Spea_3555: Bacterioferritin-associated ferredoxin
*
Shewanella halifaxensis HAW-EB4

Site:
position = -58
score = 5.48788
sequence = CACTGAGAATCATTTTCATTT

Gene: Shal_3649: Bacterioferritin-associated ferredoxin
*
Shewanella piezotolerans WP3

Site:
position = -57
score = 5.60913
sequence = CATTGAGAATCGTTTTCATTT

Site:
position = -86
score = 5.33155
sequence = GATTGATAACTATTCTCATCA

Gene: swp_0771: Bacterioferritin-associated ferredoxin
*
Shewanella sediminis HAW-EB3

Site:
position = -54
score = 5.76445
sequence = CATTGAGAATCATTTTCATTT

Gene: Ssed_0782: Bacterioferritin-associated ferredoxin
*
Shewanella woodyi ATCC 51908

Site:
position = -56
score = 5.60913
sequence = CATTGAGAATCGTTTTCATTT

Gene: Swoo_4187: Bacterioferritin-associated ferredoxin
Bacterioferritin-associated ferredoxin
 
CRON 53.
fbpA
*
Shewanella oneidensis MR-1

Site:
position = -76
score = 5.71206
sequence = AACTGATAACTATTATCATTA

Gene: SO0744: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
*
Shewanella putrefaciens CN-32

Site:
position = -74
score = 5.78154
sequence = AAGTGATAACTATTATCATTA

Gene: Sputcn32_3227: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
*
Shewanella sp W3-18-1

Site:
position = -74
score = 5.78154
sequence = AAGTGATAACTATTATCATTA

Gene: Sputw3181_0714: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
*
Shewanella sp ANA-3

Site:
position = -76
score = 5.71206
sequence = AACTGATAACTATTATCATTA

Gene: Shewana3_3517: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
*
Shewanella sp MR-4

Site:
position = -76
score = 5.71206
sequence = AACTGATAACTATTATCATTA

Gene: Shewmr4_3347: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
*
Shewanella sp MR-7

Site:
position = -76
score = 5.71206
sequence = AACTGATAACTATTATCATTA

Gene: Shewmr7_0606: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
*2
Shewanella baltica OS155

Site:
position = -76
score = 5.44596
sequence = AACTGATAAGCATTATCATTA

Gene: Sbal_0812: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA

Gene: Sbal_0601: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
 
Shewanella denitrificans OS217
*
Shewanella frigidimarina NCIMB 400

Site:
position = -67
score = 5.91417
sequence = AATTGATAACCATTATCAATT

Gene: Sfri_0636: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
*
Shewanella amazonensis SB2B

Site:
position = -57
score = 5.78154
sequence = TAGTGATAATAATTATCATTA

Gene: Sama_0666: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
*
Shewanella loihica PV-4

Site:
position = -41
score = 6.14395
sequence = AATTGATAATTATTATCATTA

Gene: Shew_0861: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
*
Shewanella pealeana ATCC 700345

Site:
position = -60
score = 5.79626
sequence = AATTGAGAATTATTATCAGTT

Gene: Spea_0844: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
*
Shewanella halifaxensis HAW-EB4

Site:
position = -64
score = 5.38864
sequence = AATTGAGAATTATTATCAGTC

Gene: Shal_0897: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
*
Shewanella piezotolerans WP3

Site:
position = -60
score = 5.24661
sequence = AATTGAGAACTATTATCAGCA

Gene: swp_4107: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
*
Shewanella sediminis HAW-EB3

Site:
position = -58
score = 5.73633
sequence = GATTGATAATAATTATCATTA

Gene: Ssed_0945: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
*
Shewanella woodyi ATCC 51908

Site:
position = -57
score = 5.42784
sequence = AATTGATAACTATTATCATCG

Gene: Swoo_0996: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
fbpB
 
Shewanella oneidensis MR-1

Gene: SO0743: ABC iron(III) transporter, inner membrane subunit, FbpB
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3226: ABC iron(III) transporter, inner membrane subunit, FbpB
 
Shewanella sp W3-18-1

Gene: Sputw3181_0715: ABC iron(III) transporter, inner membrane subunit, FbpB
 
Shewanella sp ANA-3

Gene: Shewana3_3516: ABC iron(III) transporter, inner membrane subunit, FbpB
 
Shewanella sp MR-4

Gene: Shewmr4_3346: ABC iron(III) transporter, inner membrane subunit, FbpB
 
Shewanella sp MR-7

Gene: Shewmr7_0607: ABC iron(III) transporter, inner membrane subunit, FbpB
 
Shewanella baltica OS155

Gene: Sbal_0602: ABC iron(III) transporter, inner membrane subunit, FbpB
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0637: ABC iron(III) transporter, inner membrane subunit, FbpB
 
Shewanella amazonensis SB2B

Gene: Sama_0667: ABC iron(III) transporter, inner membrane subunit, FbpB
 
Shewanella loihica PV-4

Gene: Shew_0862: ABC iron(III) transporter, inner membrane subunit, FbpB
 
Shewanella pealeana ATCC 700345

Gene: Spea_0845: ABC iron(III) transporter, inner membrane subunit, FbpB
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0898: ABC iron(III) transporter, inner membrane subunit, FbpB
 
Shewanella piezotolerans WP3

Gene: swp_4106: ABC iron(III) transporter, inner membrane subunit, FbpB
*
Shewanella sediminis HAW-EB3

Site:
position = -154
score = 5.27608
sequence = GAATTATAATCATTCTTATTT

Gene: Ssed_0946: ABC iron(III) transporter, inner membrane subunit, FbpB
*
Shewanella woodyi ATCC 51908

Site:
position = -79
score = 5.50451
sequence = AATTAATAATCGTTTTTATTT

Gene: Swoo_0997: ABC iron(III) transporter, inner membrane subunit, FbpB
ABC iron(III) transporter, inner membrane subunit, FbpB
fbpC
 
Shewanella oneidensis MR-1

Gene: SO0742: ABC iron(III) transporter, ATPase subunit, FbpC
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3225: ABC iron(III) transporter, ATPase subunit, FbpC
 
Shewanella sp W3-18-1

Gene: Sputw3181_0716: ABC iron(III) transporter, ATPase subunit, FbpC
 
Shewanella sp ANA-3

Gene: Shewana3_3515: ABC iron(III) transporter, ATPase subunit, FbpC
 
Shewanella sp MR-4

Gene: Shewmr4_3345: ABC iron(III) transporter, ATPase subunit, FbpC
 
Shewanella sp MR-7

Gene: Shewmr7_0608: ABC iron(III) transporter, ATPase subunit, FbpC
 
Shewanella baltica OS155

Gene: Sbal_0603: ABC iron(III) transporter, ATPase subunit, FbpC
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0638: ABC iron(III) transporter, ATPase subunit, FbpC
 
Shewanella amazonensis SB2B

Gene: Sama_0668: ABC iron(III) transporter, ATPase subunit, FbpC
 
Shewanella loihica PV-4

Gene: Shew_0863: ABC iron(III) transporter, ATPase subunit, FbpC
 
Shewanella pealeana ATCC 700345

Gene: Spea_0846: ABC iron(III) transporter, ATPase subunit, FbpC
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0899: ABC iron(III) transporter, ATPase subunit, FbpC
 
Shewanella piezotolerans WP3

Gene: swp_4105: ABC iron(III) transporter, ATPase subunit, FbpC
 
Shewanella sediminis HAW-EB3

Gene: Ssed_0947: ABC iron(III) transporter, ATPase subunit, FbpC
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0998: ABC iron(III) transporter, ATPase subunit, FbpC
ABC iron(III) transporter, ATPase subunit, FbpC
 
CRON 54.
bfr2
*
Shewanella oneidensis MR-1

Site:
position = -125
score = 5.22805
sequence = TAATGAGAATGCTTTTAATTA

Gene: SO1111: Bacterioferritin subunit 2
*
Shewanella putrefaciens CN-32

Site:
position = -126
score = 5.47227
sequence = AAATGAGAATGGTTTTTATAA

Gene: Sputcn32_0948: Bacterioferritin subunit 2
*
Shewanella sp W3-18-1

Site:
position = -126
score = 5.47227
sequence = AAATGAGAATGGTTTTTATAA

Gene: Sputw3181_3228: Bacterioferritin subunit 2
*
Shewanella sp ANA-3

Site:
position = -125
score = 5.35951
sequence = TAATGAGAATGCTTTTTATCT

Gene: Shewana3_0946: Bacterioferritin subunit 2
*
Shewanella sp MR-4

Site:
position = -124
score = 5.35951
sequence = TAATGAGAATGCTTTTTATCT

Gene: Shewmr4_0944: Bacterioferritin subunit 2
*
Shewanella sp MR-7

Site:
position = -125
score = 5.35951
sequence = TAATGAGAATGCTTTTTATCT

Gene: Shewmr7_0982: Bacterioferritin subunit 2
*
Shewanella baltica OS155

Site:
position = -126
score = 5.34674
sequence = AAATGAGAATGGTTGTTATCA

Gene: Sbal_0932: Bacterioferritin subunit 2
*
Shewanella denitrificans OS217

Site:
position = -120
score = 5.61242
sequence = TAATGATAATGGTTATCACTA

Gene: Sden_0990: Bacterioferritin subunit 2
*
Shewanella frigidimarina NCIMB 400

Site:
position = -121
score = 5.98863
sequence = TAATGATAATAGTTATCAATT

Gene: Sfri_0957: Bacterioferritin subunit 2
*
Shewanella amazonensis SB2B

Site:
position = -122
score = 4.71115
sequence = CAATAAGAATAATTAGCCTTT

Gene: Sama_2530: Bacterioferritin subunit 2
*
Shewanella loihica PV-4

Site:
position = -115
score = 4.75964
sequence = GAATGAGAACGATTTTCTTTG

Gene: Shew_2873: Bacterioferritin subunit 2
*
Shewanella pealeana ATCC 700345

Site:
position = -116
score = 5.36719
sequence = TAATGAGAATGGTTATCTTTA

Gene: Spea_3095: Bacterioferritin subunit 2
*
Shewanella halifaxensis HAW-EB4

Site:
position = -121
score = 4.34769
sequence = TAGTGATAATGAAAATCACTA

Site:
position = -88
score = 4.26603
sequence = TGTTGATATTTAACCTTATTT

Gene: Shal_3179: Bacterioferritin subunit 2
*
Shewanella piezotolerans WP3

Site:
position = -118
score = 5.54676
sequence = TAATGATAATAATTATCTTTA

Gene: swp_1175: Bacterioferritin subunit 2
*
Shewanella sediminis HAW-EB3

Site:
position = -137
score = 4.64906
sequence = TAATGGGAATGATTATCTCTA

Gene: Ssed_2230: Bacterioferritin subunit 2
*
Shewanella woodyi ATCC 51908

Site:
position = -167
score = 4.46472
sequence = AAATGATAATGCTTAATGTTA

Gene: Swoo_3608: Bacterioferritin subunit 2
Bacterioferritin subunit 2
bfr1
 
Shewanella oneidensis MR-1

Gene: SO1112: Bacterioferritin subunit 1
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0949: Bacterioferritin subunit 1
 
Shewanella sp W3-18-1

Gene: Sputw3181_3227: Bacterioferritin subunit 1
 
Shewanella sp ANA-3

Gene: Shewana3_0947: Bacterioferritin subunit 1
 
Shewanella sp MR-4

Gene: Shewmr4_0945: Bacterioferritin subunit 1
 
Shewanella sp MR-7

Gene: Shewmr7_0983: Bacterioferritin subunit 1
 
Shewanella baltica OS155

Gene: Sbal_0933: Bacterioferritin subunit 1
 
Shewanella denitrificans OS217

Gene: Sden_0991: Bacterioferritin subunit 1
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0958: Bacterioferritin subunit 1
 
Shewanella amazonensis SB2B

Gene: Sama_2529: Bacterioferritin subunit 1
 
Shewanella loihica PV-4

Gene: Shew_2872: Bacterioferritin subunit 1
 
Shewanella pealeana ATCC 700345

Gene: Spea_3094: Bacterioferritin subunit 1
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3178: Bacterioferritin subunit 1
 
Shewanella piezotolerans WP3

Gene: swp_1176: Bacterioferritin subunit 1
 
Shewanella sediminis HAW-EB3

Gene: Ssed_2231: Bacterioferritin subunit 1
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3607: Bacterioferritin subunit 1
Bacterioferritin subunit 1
 
CRON 55.
Swoo_1070
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
*
Shewanella woodyi ATCC 51908

Site:
position = -49
score = 6.16941
sequence = AAATGATATTAATTCTCATTT

Gene: Swoo_1070: Hypothetical protein
Hypothetical protein
 
CRON 56.
SO2426
*
Shewanella oneidensis MR-1

Site:
position = -2
score = 5.61591
sequence = AAATGATATTGATTCTCGTTT

Gene: SO2426: Two component transcriptional regulator, Winged helix family
*
Shewanella putrefaciens CN-32

Site:
position = -2
score = 5.46058
sequence = AAATGATATCGATTCTCGTTT

Gene: Sputcn32_1941: Two component transcriptional regulator, Winged helix family
*
Shewanella sp W3-18-1

Site:
position = -2
score = 5.46058
sequence = AAATGATATCGATTCTCGTTT

Gene: Sputw3181_2064: Two component transcriptional regulator, Winged helix family
*
Shewanella sp ANA-3

Site:
position = -32
score = 5.61591
sequence = AAATGATATTGATTCTCGTTT

Gene: Shewana3_1959: Two component transcriptional regulator, Winged helix family
*
Shewanella sp MR-4

Site:
position = -32
score = 5.61591
sequence = AAATGATATTGATTCTCGTTT

Gene: Shewmr4_1904: Two component transcriptional regulator, Winged helix family
*
Shewanella sp MR-7

Site:
position = -32
score = 5.61591
sequence = AAATGATATTGATTCTCGTTT

Gene: Shewmr7_2074: Two component transcriptional regulator, Winged helix family
*
Shewanella baltica OS155

Site:
position = -32
score = 5.1388
sequence = AAATGATATAGATTCTCGTTT

Gene: Sbal_2050: Two component transcriptional regulator, Winged helix family
*
Shewanella denitrificans OS217

Site:
position = 10
score = 5.61765
sequence = TAATGAAAATGGTTATCGTTT

Gene: Sden_1906: Two component transcriptional regulator, Winged helix family
*
Shewanella frigidimarina NCIMB 400

Site:
position = -32
score = 5.58512
sequence = TAATGGTAATCGTTATCATTA

Gene: Sfri_2150: Two component transcriptional regulator, Winged helix family
*
Shewanella amazonensis SB2B

Site:
position = -32
score = 4.8155
sequence = GAATAACAACCGTTCGCATTT

Gene: Sama_1718: Two component transcriptional regulator, Winged helix family
*
Shewanella loihica PV-4

Site:
position = -31
score = 6.0493
sequence = TAATGATAACTATTATCATTA

Gene: Shew_1936: Two component transcriptional regulator, Winged helix family
*
Shewanella pealeana ATCC 700345

Site:
position = -34
score = 5.31772
sequence = TAATGCGAATTATTCGTATTT

Gene: Spea_2236: Two component transcriptional regulator, Winged helix family
*
Shewanella halifaxensis HAW-EB4

Site:
position = -34
score = 5.61783
sequence = AAATGAAAATGATTCGCATTG

Gene: Shal_2220: Two component transcriptional regulator, Winged helix family
*
Shewanella piezotolerans WP3

Site:
position = -9
score = 5.50977
sequence = CAATGATAATTGTTCGCATTT

Gene: swp_2595: Two component transcriptional regulator, Winged helix family
*
Shewanella sediminis HAW-EB3

Site:
position = -34
score = 5.53547
sequence = AAATGATAACAGTTCGTATTT

Gene: Ssed_2316: Two component transcriptional regulator, Winged helix family
*
Shewanella woodyi ATCC 51908

Site:
position = -36
score = 5.37656
sequence = TGTTGATAATTGTTCGCATTT

Gene: Swoo_2294: Two component transcriptional regulator, Winged helix family
Two component transcriptional regulator, Winged helix family
 
CRON 57.
SO4743
*
Shewanella oneidensis MR-1

Site:
position = -116
score = 5.72385
sequence = AAATAAAAACAATTCTTATTT

Gene: SO4743: TonB-dependent siderophore receptor
*
Shewanella putrefaciens CN-32

Site:
position = -68
score = 5.61231
sequence = AAATAAAAACACTTCTCATTT

Gene: Sputcn32_3953: TonB-dependent siderophore receptor
*
Shewanella sp W3-18-1

Site:
position = -68
score = 5.61231
sequence = AAATAAAAACACTTCTCATTT

Gene: Sputw3181_4050: TonB-dependent siderophore receptor
*
Shewanella sp ANA-3

Site:
position = -68
score = 5.72385
sequence = AAATAAAAACAATTCTTATTT

Gene: Shewana3_4127: TonB-dependent siderophore receptor
*
Shewanella sp MR-4

Site:
position = -68
score = 5.72385
sequence = AAATAAAAACAATTCTTATTT

Gene: Shewmr4_3922: TonB-dependent siderophore receptor
*
Shewanella sp MR-7

Site:
position = -68
score = 5.72385
sequence = AAATAAAAACAATTCTTATTT

Gene: Shewmr7_4014: TonB-dependent siderophore receptor
*
Shewanella baltica OS155

Site:
position = -68
score = 5.61231
sequence = AAATAAAAACACTTCTCATTT

Gene: Sbal_4363: TonB-dependent siderophore receptor
 
Shewanella denitrificans OS217
*
Shewanella frigidimarina NCIMB 400

Site:
position = -68
score = 5.44423
sequence = AAATGGAAACGCTTCTCATTT

Gene: Sfri_4042: TonB-dependent siderophore receptor
*
Shewanella amazonensis SB2B

Site:
position = -73
score = 5.92287
sequence = AAATGCTAATCATTATCAATT

Gene: Sama_3641: TonB-dependent siderophore receptor
*
Shewanella loihica PV-4

Site:
position = -69
score = 6.01994
sequence = AAATAAAAACAATTCTCATTT

Gene: Shew_3841: TonB-dependent siderophore receptor
*
Shewanella pealeana ATCC 700345

Site:
position = -69
score = 6.01994
sequence = AAATAAAAATAGTTCTCATTT

Gene: Spea_4236: TonB-dependent siderophore receptor
*
Shewanella halifaxensis HAW-EB4

Site:
position = -68
score = 6.01994
sequence = AAATAAAAATAGTTCTCATTT

Gene: Shal_4287: TonB-dependent siderophore receptor
*
Shewanella piezotolerans WP3

Site:
position = -68
score = 5.61231
sequence = GAATAAAAACAATTCTCATTT

Gene: swp_5150: TonB-dependent siderophore receptor
*
Shewanella sediminis HAW-EB3

Site:
position = -66
score = 6.00614
sequence = AAATAAAAACGATTCTCATTT

Gene: Ssed_4483: TonB-dependent siderophore receptor
*
Shewanella woodyi ATCC 51908

Site:
position = -67
score = 6.17526
sequence = AAATAAAAATAATTCTCATTT

Gene: Swoo_4894: TonB-dependent siderophore receptor
TonB-dependent siderophore receptor
 
CRON 58.
swp_3303
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
*
Shewanella piezotolerans WP3

Site:
position = -155
score = 5.18069
sequence = TATTGATAGCAATTCTCATTA

Gene: swp_3303: TonB-dependent siderophore receptor
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
TonB-dependent siderophore receptor
 
CRON 59.
Sden_0590
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
*
Shewanella denitrificans OS217

Site:
position = -63
score = 4.96211
sequence = TAATGAAAATCATTACCAGTC

Site:
position = -69
score = 5.34918
sequence = AAATGATAATGAAAATCATTA

Gene: Sden_0590: Putative siderophore biosynthesis protein, related to cysteine synthase
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Putative siderophore biosynthesis protein, related to cysteine synthase
Sden_0589
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217

Gene: Sden_0589: Putative siderophore biosynthesis protein, Ornithine cyclodeaminase (EC 4.3.1.12)
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Putative siderophore biosynthesis protein, Ornithine cyclodeaminase (EC 4.3.1.12)
pvsB
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217

Gene: Sden_0588: Vibrioferrin amide bond forming protein PvsB
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3

Gene: swp_0086: Vibrioferrin amide bond forming protein PvsB
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Vibrioferrin amide bond forming protein PvsB
Sden_0587
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217

Gene: Sden_0587: Putative efflux transmembrane protein in siderophore biosynthesys operon
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Putative efflux transmembrane protein in siderophore biosynthesys operon
Sden_0586
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217

Gene: Sden_0586: Siderophore synthetase superfamily, group A / Siderophore synthetase superfamily, group C
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Siderophore synthetase superfamily, group A / Siderophore synthetase superfamily, group C
Sden_0585
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217

Gene: Sden_0585: Putative siderophore biosynthesis protein, HpcH/HpaI aldolase family
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
*
Shewanella piezotolerans WP3

Site:
position = -206
score = 5.55366
sequence = AAATGATAATTATTACGATTT

Site:
position = -46
score = 5.04171
sequence = AAATGAGAACAATTGGCATCC

Gene: swp_0084: Putative siderophore biosynthesis protein, HpcH/HpaI aldolase family
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Putative siderophore biosynthesis protein, HpcH/HpaI aldolase family
pvsE
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217

Gene: Sden_0584: Vibrioferrin biosynthesis protein, PvsE
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3

Gene: swp_0089: Vibrioferrin biosynthesis protein, PvsE
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Vibrioferrin biosynthesis protein, PvsE
Sden_0583
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217

Gene: Sden_0583: ParB-like nuclease
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
ParB-like nuclease
Sden_0582
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217

Gene: Sden_0582: Outer membrane receptor proteins, likely involved in siderophore uptake
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Outer membrane receptor proteins, likely involved in siderophore uptake
pvsA
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
*
Shewanella piezotolerans WP3

Site:
position = -111
score = 5.55366
sequence = AAATCGTAATAATTATCATTT

Site:
position = -271
score = 5.04171
sequence = GGATGCCAATTGTTCTCATTT

Gene: swp_0085: Vibrioferrin ligase/carboxylase protein PvsA
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Vibrioferrin ligase/carboxylase protein PvsA
pvsC
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3

Gene: swp_0087: Vibrioferrin membrane-spanning transport protein PvsC
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Vibrioferrin membrane-spanning transport protein PvsC
pvsD
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3

Gene: swp_0088: Vibrioferrin biosynthesis protein, PvsD
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Vibrioferrin biosynthesis protein, PvsD
Sfri_3851
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
*
Shewanella denitrificans OS217

Site:
position = -101
score = 5.29185
sequence = AAACGCTAACAATTCTCATTA

Gene: Sden_0609: TonB-dependent siderophore receptor
*
Shewanella frigidimarina NCIMB 400

Site:
position = -309
score = 5.75496
sequence = AAATGAGAATAATTATCAAAA

Gene: Sfri_3851: TonB-dependent siderophore receptor
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3

Gene: swp_0083: TonB-dependent siderophore receptor
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
TonB-dependent siderophore receptor
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD