Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Crp - Shewanellaceae

Properties
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: repressor (activator)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2713 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Shewanella oneidensis MR-1 286 150
Shewanella putrefaciens CN-32 317 165
Shewanella sp W3-18-1 316 164
Shewanella sp ANA-3 335 178
Shewanella sp MR-4 346 181
Shewanella sp MR-7 345 179
Shewanella baltica OS155 291 153
Shewanella denitrificans OS217 111 55
Shewanella frigidimarina NCIMB 400 233 120
Shewanella amazonensis SB2B 234 106
Shewanella loihica PV-4 235 126
Shewanella pealeana ATCC 700345 294 148
Shewanella halifaxensis HAW-EB4 310 162
Shewanella piezotolerans WP3 262 136
Shewanella sediminis HAW-EB3 281 144
Shewanella woodyi ATCC 51908 241 130
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
SO1419
*
Shewanella oneidensis MR-1

Site:
position = -117
score = 3.9475
sequence = AAGTGTTAGCTAACTCATAGAT

Gene: SO1419: lipoprotein, putative
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
*
Shewanella loihica PV-4

Site:
position = -120
score = 4.46207
sequence = TTTTGTTAAGCAGATCAAAATA

Gene: Shew_1972: lipoprotein, putative
*
Shewanella pealeana ATCC 700345

Site:
position = -120
score = 4.15776
sequence = TAGTGTTAACTGTGTCAAATAA

Gene: Spea_2091: lipoprotein, putative
*
Shewanella halifaxensis HAW-EB4

Site:
position = -93
score = 4.09607
sequence = TTGTGTTAACTGCGTCAAATAA

Gene: Shal_2064: lipoprotein, putative
*
Shewanella piezotolerans WP3

Site:
position = -119
score = 4.47596
sequence = AAATGTTATCTCTGTCAAACAA

Gene: swp_2516: lipoprotein, putative
*
Shewanella sediminis HAW-EB3

Site:
position = -159
score = 4.20258
sequence = ATGTGTTAACTGGGTCAAATAT

Gene: Ssed_2279: lipoprotein, putative
 
Shewanella woodyi ATCC 51908
lipoprotein, putative
SO1420
 
Shewanella oneidensis MR-1

Gene: SO1420: outer membrane porin, putative
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_2403: outer membrane porin, putative
 
Shewanella loihica PV-4

Gene: Shew_1973: outer membrane porin, putative
 
Shewanella pealeana ATCC 700345

Gene: Spea_2092: outer membrane porin, putative
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2065: outer membrane porin, putative
 
Shewanella piezotolerans WP3

Gene: swp_2517: outer membrane porin, putative
 
Shewanella sediminis HAW-EB3

Gene: Ssed_2278: outer membrane porin, putative
 
Shewanella woodyi ATCC 51908
outer membrane porin, putative
 
CRON 2.
SO1247
 
Shewanella oneidensis MR-1

Gene: SO1247: hypothetical protein
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2807: hypothetical protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_1205: hypothetical protein
 
Shewanella sp ANA-3

Gene: Shewana3_1063: hypothetical protein
*
Shewanella sp MR-4

Site:
position = -273
score = 4.28857
sequence = CAATGTGAGCTAGTTAACATCA

Gene: Shewmr4_1059: hypothetical protein
*
Shewanella sp MR-7

Site:
position = -273
score = 4.28857
sequence = CAATGTGAGCTAGTTAACATCA

Gene: Shewmr7_1131: hypothetical protein
*
Shewanella baltica OS155

Site:
position = -159
score = 3.83994
sequence = AATAGTGATCTTTCTCAGCATC

Gene: Sbal_3204: hypothetical protein
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
*
Shewanella amazonensis SB2B

Site:
position = -108
score = 3.79832
sequence = TCATGTGAGCCAGGTTAAAAAA

Gene: Sama_0996: hypothetical protein
 
Shewanella loihica PV-4

Gene: Shew_2789: hypothetical protein
*
Shewanella pealeana ATCC 700345

Site:
position = -187
score = 4.05502
sequence = TTTAGTGATGTTTTTTAGATTA

Gene: Spea_3022: hypothetical protein
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3112: hypothetical protein
 
Shewanella piezotolerans WP3

Gene: swp_1258: hypothetical protein
 
Shewanella sediminis HAW-EB3

Gene: Ssed_3352: hypothetical protein
*
Shewanella woodyi ATCC 51908

Site:
position = -312
score = 4.78872
sequence = TTTTGTGAATTGTATCACTTAT

Gene: Swoo_3518: hypothetical protein
hypothetical protein
 
CRON 3.
fadD1
*
Shewanella oneidensis MR-1

Site:
position = -155
score = 5.12551
sequence = TTATGTGATGATGATCAAAATT

Gene: SO2581: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
*
Shewanella putrefaciens CN-32

Site:
position = -154
score = 5.12551
sequence = TTATGTGATGATGATCAAAATT

Gene: Sputcn32_1761: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
*
Shewanella sp W3-18-1

Site:
position = -154
score = 5.12551
sequence = TTATGTGATGATGATCAAAATT

Gene: Sputw3181_2264: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
*
Shewanella sp ANA-3

Site:
position = -155
score = 5.12551
sequence = TTATGTGATGATGATCAAAATT

Gene: Shewana3_2386: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
*
Shewanella sp MR-4

Site:
position = -155
score = 5.12551
sequence = TTATGTGATGATGATCAAAATT

Gene: Shewmr4_2177: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
*
Shewanella sp MR-7

Site:
position = -155
score = 5.12551
sequence = TTATGTGATGATGATCAAAATT

Gene: Shewmr7_2254: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
*
Shewanella baltica OS155

Site:
position = -156
score = 5.12551
sequence = TTATGTGATGATGATCAAAATT

Gene: Sbal_1864: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
*
Shewanella denitrificans OS217

Site:
position = -189
score = 4.12923
sequence = TTATGTGATTATGGGCCCAAAT

Gene: Sden_1625: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
*
Shewanella frigidimarina NCIMB 400

Site:
position = -165
score = 4.70241
sequence = TTATGTGATTATGATCGAAAAT

Gene: Sfri_1733: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
*
Shewanella amazonensis SB2B

Site:
position = -140
score = 4.83629
sequence = TTATGTGATGATTGTCAAAAAT

Gene: Sama_1934: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
*
Shewanella loihica PV-4

Site:
position = -149
score = 4.86581
sequence = TTGTGTGATGATGTTCAAAATT

Gene: Shew_2188: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
*
Shewanella pealeana ATCC 700345

Site:
position = -156
score = 5.01352
sequence = TTATGTGATGATAATCAAAATT

Gene: Spea_2448: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -155
score = 5.01352
sequence = TTATGTGATGATAATCAAAATT

Gene: Shal_1832: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
*
Shewanella piezotolerans WP3

Site:
position = -153
score = 5.00694
sequence = ATATGTGATGATAATCAAAATT

Gene: swp_2289: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
*
Shewanella sediminis HAW-EB3

Site:
position = -151
score = 5.02801
sequence = TTATGTGATGATGATCATAATT

Gene: Ssed_2523: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
*
Shewanella woodyi ATCC 51908

Site:
position = -153
score = 5.07027
sequence = TTATGTGATGATGTTCAAAATT

Gene: Swoo_2110: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
CRON 4.
SO0971
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
*
Shewanella pealeana ATCC 700345

Site:
position = -161
score = 4.28008
sequence = TATCGATATCTGCCTCACATAT

Gene: Spea_0741: hypothetical protein
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
hypothetical protein
SO0972
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345

Gene: Spea_0740: methyltransferase type 12
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
SAM-dependent methyltransferases
SO0973
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345

Gene: Spea_0739: hypothetical protein
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
hypothetical protein
Sputcn32_0834
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0834: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70)
 
Shewanella sp W3-18-1

Gene: Sputw3181_3339: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70)
*
Shewanella sp ANA-3

Site:
position = -156
score = 4.19724
sequence = AAAGGTGACGAGTATAACAAAA

Gene: Shewana3_0799: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70)
*
Shewanella sp MR-4

Site:
position = -156
score = 4.19724
sequence = AAAGGTGACGAGTATAACAAAA

Gene: Shewmr4_3139: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70)
*
Shewanella sp MR-7

Site:
position = -156
score = 4.19724
sequence = AAAGGTGACGAGTATAACAAAA

Gene: Shewmr7_0827: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70)
 
Shewanella baltica OS155

Gene: Sbal_0733: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70)
*
Shewanella denitrificans OS217

Site:
position = -175
score = 4.00133
sequence = TAATGTGATTGGTATAAGAACA

Gene: Sden_3048: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0515: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70)
 
Shewanella amazonensis SB2B

Gene: Sama_0606: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70)
 
Shewanella loihica PV-4

Gene: Shew_0783: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70)
 
Shewanella pealeana ATCC 700345

Gene: Spea_0738: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0791: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70)
*
Shewanella piezotolerans WP3

Site:
position = -322
score = 3.85784
sequence = TAATGCAATTGGTATTACAATA

Gene: swp_4339: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_0821: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70)
*
Shewanella woodyi ATCC 51908

Site:
position = -67
score = 3.73566
sequence = TATTTTTACTTGCCTCAACTAA

Gene: Swoo_0917: ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70)
ribosomal large subunit pseudouridine synthase A (EC 4.2.1.70)
asnC
 
Shewanella oneidensis MR-1

Gene: SO3799: regulatory protein AsnC
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0833: regulatory protein AsnC
 
Shewanella sp W3-18-1

Gene: Sputw3181_3340: regulatory protein AsnC
 
Shewanella sp ANA-3

Gene: Shewana3_0798: regulatory protein AsnC
 
Shewanella sp MR-4

Gene: Shewmr4_3140: regulatory protein AsnC
 
Shewanella sp MR-7

Gene: Shewmr7_0826: regulatory protein AsnC
 
Shewanella baltica OS155

Gene: Sbal_0732: regulatory protein AsnC
 
Shewanella denitrificans OS217

Gene: Sden_3049: regulatory protein AsnC
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0514: regulatory protein AsnC
 
Shewanella amazonensis SB2B

Gene: Sama_0605: regulatory protein AsnC
 
Shewanella loihica PV-4

Gene: Shew_0782: regulatory protein AsnC
*
Shewanella pealeana ATCC 700345

Site:
position = -7
score = 3.76387
sequence = ATTTATTATGGAAGTCCCATTT

Gene: Spea_0737: regulatory protein AsnC
*
Shewanella halifaxensis HAW-EB4

Site:
position = -248
score = 3.81488
sequence = ATTTATAATGATAATCACAACT

Gene: Shal_0790: regulatory protein AsnC
 
Shewanella piezotolerans WP3

Gene: swp_4340: regulatory protein AsnC
 
Shewanella sediminis HAW-EB3

Gene: Ssed_0820: regulatory protein AsnC
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0916: regulatory protein AsnC
regulatory protein AsnC
 
CRON 5.
Sputcn32_0312
 
Shewanella oneidensis MR-1
*
Shewanella putrefaciens CN-32

Site:
position = -99
score = 4.31656
sequence = AAGTGTGATGCTGGTCAATAAA

Gene: Sputcn32_0312: hypothetical protein
*
Shewanella sp W3-18-1

Site:
position = -99
score = 4.24289
sequence = AAGTGTGATACTGGTCAATAAA

Gene: Sputw3181_3896: hypothetical protein
*
Shewanella sp ANA-3

Site:
position = -99
score = 5.23204
sequence = AAATGTGATCTATGTCAAAAAA

Gene: Shewana3_3963: hypothetical protein
*
Shewanella sp MR-4

Site:
position = -99
score = 5.23204
sequence = AAATGTGATCTATGTCAAAAAA

Gene: Shewmr4_3765: hypothetical protein
*
Shewanella sp MR-7

Site:
position = -99
score = 5.19373
sequence = AAATGTGATCTGTGTCAAAAAA

Gene: Shewmr7_3838: hypothetical protein
*
Shewanella baltica OS155

Site:
position = -97
score = 5.20192
sequence = AAATGTGATCGTGTTCAAAAAA

Gene: Sbal_0180: hypothetical protein
 
Shewanella denitrificans OS217
*
Shewanella frigidimarina NCIMB 400

Site:
position = -115
score = 3.65375
sequence = TTAATTGATTACGATCAATTTA

Gene: Sfri_0616: hypothetical protein
*
Shewanella amazonensis SB2B

Site:
position = -285
score = 4.06654
sequence = AAAAGAGACTTAGATCATATTT

Gene: Sama_2901: hypothetical protein
*
Shewanella loihica PV-4

Site:
position = -286
score = 3.87265
sequence = AAAATAGATCTTGATCATATTT

Gene: Shew_3155: hypothetical protein
*
Shewanella pealeana ATCC 700345

Site:
position = -127
score = 3.40276
sequence = TTTTATGATGAATAAAACGTTC

Gene: Spea_3968: hypothetical protein
*
Shewanella halifaxensis HAW-EB4

Site:
position = -100
score = 3.62988
sequence = ATAATTGATTTGTATCAATGTT

Gene: Shal_0300: hypothetical protein
*
Shewanella piezotolerans WP3

Site:
position = -97
score = 3.34695
sequence = TTATATAATGATTTTTATATTT

Gene: swp_4118: hypothetical protein
*
Shewanella sediminis HAW-EB3

Site:
position = -100
score = 4.06844
sequence = TTGTTTGATTTAAATCAAGGTT

Gene: Ssed_0240: hypothetical protein
*
Shewanella woodyi ATCC 51908

Site:
position = -92
score = 3.98241
sequence = TAACTTGATTTGAATCAATATT

Gene: Swoo_0239: hypothetical protein
hypothetical protein
nrfB
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0313: Cytochrome c-type protein NrfB precursor
 
Shewanella sp W3-18-1

Gene: Sputw3181_3895: Cytochrome c-type protein NrfB precursor
 
Shewanella sp ANA-3

Gene: Shewana3_3962: Cytochrome c-type protein NrfB precursor
 
Shewanella sp MR-4

Gene: Shewmr4_3764: Cytochrome c-type protein NrfB precursor
 
Shewanella sp MR-7

Gene: Shewmr7_3837: Cytochrome c-type protein NrfB precursor
 
Shewanella baltica OS155

Gene: Sbal_0181: Cytochrome c-type protein NrfB precursor
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0615: Cytochrome c-type protein NrfB precursor
 
Shewanella amazonensis SB2B

Gene: Sama_2902: Cytochrome c-type protein NrfB precursor
 
Shewanella loihica PV-4

Gene: Shew_3156: Cytochrome c-type protein NrfB precursor
 
Shewanella pealeana ATCC 700345

Gene: Spea_3967: Cytochrome c-type protein NrfB precursor
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0301: Cytochrome c-type protein NrfB precursor
 
Shewanella piezotolerans WP3

Gene: swp_4117: Cytochrome c-type protein NrfB precursor
 
Shewanella sediminis HAW-EB3

Gene: Ssed_0241: Cytochrome c-type protein NrfB precursor
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0240: Cytochrome c-type protein NrfB precursor
Cytochrome c-type protein NrfB precursor
nrfC
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0314: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_3894: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein
 
Shewanella sp ANA-3

Gene: Shewana3_3961: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein
 
Shewanella sp MR-4

Gene: Shewmr4_3763: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein
 
Shewanella sp MR-7

Gene: Shewmr7_3836: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein
 
Shewanella baltica OS155

Gene: Sbal_0182: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0614: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein
 
Shewanella amazonensis SB2B

Gene: Sama_2903: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein
 
Shewanella loihica PV-4

Gene: Shew_3157: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein
 
Shewanella pealeana ATCC 700345

Gene: Spea_3966: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0302: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein
 
Shewanella piezotolerans WP3

Gene: swp_4116: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein
 
Shewanella sediminis HAW-EB3

Gene: Ssed_0242: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0241: 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein
4Fe-4S ferredoxin iron-sulfur binding domain-containing protein
nrfD-2
 
Shewanella oneidensis MR-1

Gene: SO4568: nitrite reductase, quinol dehydrogenase component, NrfD
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0315: nitrite reductase, quinol dehydrogenase component, NrfD
 
Shewanella sp W3-18-1

Gene: Sputw3181_3893: nitrite reductase, quinol dehydrogenase component, NrfD
 
Shewanella sp ANA-3

Gene: Shewana3_3960: nitrite reductase, quinol dehydrogenase component, NrfD
 
Shewanella sp MR-4

Gene: Shewmr4_3762: nitrite reductase, quinol dehydrogenase component, NrfD
 
Shewanella sp MR-7

Gene: Shewmr7_3835: nitrite reductase, quinol dehydrogenase component, NrfD
 
Shewanella baltica OS155

Gene: Sbal_0183: nitrite reductase, quinol dehydrogenase component, NrfD
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0613: nitrite reductase, quinol dehydrogenase component, NrfD
 
Shewanella amazonensis SB2B

Gene: Sama_2904: nitrite reductase, quinol dehydrogenase component, NrfD
 
Shewanella loihica PV-4

Gene: Shew_3158: nitrite reductase, quinol dehydrogenase component, NrfD
 
Shewanella pealeana ATCC 700345

Gene: Spea_3965: nitrite reductase, quinol dehydrogenase component, NrfD
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0303: nitrite reductase, quinol dehydrogenase component, NrfD
 
Shewanella piezotolerans WP3

Gene: swp_4115: nitrite reductase, quinol dehydrogenase component, NrfD
 
Shewanella sediminis HAW-EB3

Gene: Ssed_0243: nitrite reductase, quinol dehydrogenase component, NrfD
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0242: nitrite reductase, quinol dehydrogenase component, NrfD
nitrite reductase, quinol dehydrogenase component, NrfD
SO4570
*
Shewanella oneidensis MR-1

Site:
position = -207
score = 4.40356
sequence = ATTTGTGAGCTAGTTAGAATTA

Gene: SO4570: conserved domain protein
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
conserved domain protein
 
CRON 6.
hyaA
*
Shewanella oneidensis MR-1

Site:
position = -105
score = 3.97644
sequence = ATTCTTGATATGCATCAATAAT

Gene: SO2099: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)
*
Shewanella putrefaciens CN-32

Site:
position = -167
score = 3.70145
sequence = AAATTAGATCTGCGTCATGTTA

Site:
position = -107
score = 4.01474
sequence = ATTCTTGATATACATCAATAAT

Gene: Sputcn32_2088: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)
*
Shewanella sp W3-18-1

Site:
position = -167
score = 3.70145
sequence = AAATTAGATCTGCGTCATGTTA

Site:
position = -107
score = 4.01474
sequence = ATTCTTGATATACATCAATAAT

Gene: Sputw3181_1924: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)
*
Shewanella sp ANA-3

Site:
position = -166
score = 3.91857
sequence = AAATTAGATCTGCATCATGTTA

Site:
position = -106
score = 4.17166
sequence = ATTCTTGATATGCATCAAGAAT

Gene: Shewana3_1880: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)
*
Shewanella sp MR-4

Site:
position = -166
score = 3.91857
sequence = AAATTAGATCTGCATCATGTTA

Site:
position = -106
score = 4.17166
sequence = ATTCTTGATATGCATCAAGAAT

Gene: Shewmr4_1822: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)
*
Shewanella sp MR-7

Site:
position = -166
score = 3.91857
sequence = AAATTAGATCTGCATCATGTTA

Site:
position = -106
score = 4.17166
sequence = ATTCTTGATATGCATCAAGAAT

Gene: Shewmr7_2155: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)
*
Shewanella baltica OS155

Site:
position = -107
score = 4.20997
sequence = ATTCTTGATATACATCAAGAAT

Site:
position = -229
score = 3.92975
sequence = TTAAGTGACCGATTTCATCCAA

Site:
position = -167
score = 3.73976
sequence = AAATTAGATCTACGTCATGTTA

Gene: Sbal_1889: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)
 
Shewanella denitrificans OS217
*
Shewanella frigidimarina NCIMB 400

Site:
position = -174
score = 3.76852
sequence = TTTTGTTAACTTGATCAACATC

Site:
position = -168
score = 4.36595
sequence = TAACTTGATCAACATCATAAAT

Gene: Sfri_2103: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)
*
Shewanella amazonensis SB2B

Site:
position = -172
score = 3.44118
sequence = AAGCATGACACACCTCATGTTA

Gene: Sama_1679: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)
*
Shewanella loihica PV-4

Site:
position = -164
score = 3.80383
sequence = AAACTTGATCCAGCTCATAGCT

Site:
position = -103
score = 3.70832
sequence = AATGTTGACATACATCAACATT

Gene: Shew_1765: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)
*
Shewanella pealeana ATCC 700345

Site:
position = -211
score = 4.63119
sequence = TTACGTGACCACGATCACCTTT

Gene: Spea_2033: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -212
score = 5.04352
sequence = TTACGTGATCTCCATCACCTTT

Gene: Shal_2261: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)
 
Shewanella piezotolerans WP3

Gene: swp_2639: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)
*
Shewanella sediminis HAW-EB3

Site:
position = -162
score = 3.97894
sequence = AAAGATGATCTAGTTCATATTG

Gene: Ssed_1908: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)
 
Shewanella woodyi ATCC 51908
Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)
hyaB
 
Shewanella oneidensis MR-1

Gene: SO2098: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2089: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1)
 
Shewanella sp W3-18-1

Gene: Sputw3181_1923: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1)
 
Shewanella sp ANA-3

Gene: Shewana3_1879: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1)
 
Shewanella sp MR-4

Gene: Shewmr4_1821: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1)
 
Shewanella sp MR-7

Gene: Shewmr7_2156: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1)
 
Shewanella baltica OS155

Gene: Sbal_1888: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1)
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2104: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1)
 
Shewanella amazonensis SB2B

Gene: Sama_1678: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1)
 
Shewanella loihica PV-4

Gene: Shew_1764: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1)
 
Shewanella pealeana ATCC 700345

Gene: Spea_2032: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2262: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1)
 
Shewanella piezotolerans WP3

Gene: swp_2640: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1907: Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1)
 
Shewanella woodyi ATCC 51908
Quinone-reactive Ni/Fe-hydrogenase large chain (EC 1.12.5.1)
hydC
 
Shewanella oneidensis MR-1

Gene: SO2097: Ni,Fe-hydrogenase I cytochrome b subunit
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2090: Ni,Fe-hydrogenase I cytochrome b subunit
 
Shewanella sp W3-18-1

Gene: Sputw3181_1922: Ni,Fe-hydrogenase I cytochrome b subunit
 
Shewanella sp ANA-3

Gene: Shewana3_1878: Ni,Fe-hydrogenase I cytochrome b subunit
 
Shewanella sp MR-4

Gene: Shewmr4_1820: Ni,Fe-hydrogenase I cytochrome b subunit
 
Shewanella sp MR-7

Gene: Shewmr7_2157: Ni,Fe-hydrogenase I cytochrome b subunit
 
Shewanella baltica OS155

Gene: Sbal_1887: Ni,Fe-hydrogenase I cytochrome b subunit
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2105: Ni,Fe-hydrogenase I cytochrome b subunit
 
Shewanella amazonensis SB2B

Gene: Sama_1677: Ni,Fe-hydrogenase I cytochrome b subunit
 
Shewanella loihica PV-4

Gene: Shew_1763: Ni,Fe-hydrogenase I cytochrome b subunit
 
Shewanella pealeana ATCC 700345

Gene: Spea_2031: Ni,Fe-hydrogenase I cytochrome b subunit
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2263: Ni,Fe-hydrogenase I cytochrome b subunit
 
Shewanella piezotolerans WP3

Gene: swp_2641: Ni,Fe-hydrogenase I cytochrome b subunit
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1906: Ni,Fe-hydrogenase I cytochrome b subunit
 
Shewanella woodyi ATCC 51908
Ni,Fe-hydrogenase I cytochrome b subunit
hyaD
 
Shewanella oneidensis MR-1

Gene: SO2096: Hydrogenase maturation protease (EC 3.4.24.-)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2091: Hydrogenase maturation protease (EC 3.4.24.-)
 
Shewanella sp W3-18-1

Gene: Sputw3181_1921: Hydrogenase maturation protease (EC 3.4.24.-)
 
Shewanella sp ANA-3

Gene: Shewana3_1877: Hydrogenase maturation protease (EC 3.4.24.-)
 
Shewanella sp MR-4

Gene: Shewmr4_1819: Hydrogenase maturation protease (EC 3.4.24.-)
 
Shewanella sp MR-7

Gene: Shewmr7_2158: Hydrogenase maturation protease (EC 3.4.24.-)
 
Shewanella baltica OS155

Gene: Sbal_1886: Hydrogenase maturation protease (EC 3.4.24.-)
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2106: Hydrogenase maturation protease (EC 3.4.24.-)
 
Shewanella amazonensis SB2B

Gene: Sama_1676: Hydrogenase maturation protease (EC 3.4.24.-)
 
Shewanella loihica PV-4

Gene: Shew_1762: Hydrogenase maturation protease (EC 3.4.24.-)
 
Shewanella pealeana ATCC 700345

Gene: Spea_2030: Hydrogenase maturation protease (EC 3.4.24.-)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2264: Hydrogenase maturation protease (EC 3.4.24.-)
 
Shewanella piezotolerans WP3

Gene: swp_2642: Hydrogenase maturation protease (EC 3.4.24.-)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1905: Hydrogenase maturation protease (EC 3.4.24.-)
 
Shewanella woodyi ATCC 51908
Hydrogenase maturation protease (EC 3.4.24.-)
hyaE
 
Shewanella oneidensis MR-1

Gene: SO2095: NiFe hydrogenase assembly chaperone, HyaE
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2092: NiFe hydrogenase assembly chaperone, HyaE
 
Shewanella sp W3-18-1

Gene: Sputw3181_1920: NiFe hydrogenase assembly chaperone, HyaE
 
Shewanella sp ANA-3

Gene: Shewana3_1876: NiFe hydrogenase assembly chaperone, HyaE
 
Shewanella sp MR-4

Gene: Shewmr4_1818: NiFe hydrogenase assembly chaperone, HyaE
 
Shewanella sp MR-7

Gene: Shewmr7_2159: NiFe hydrogenase assembly chaperone, HyaE
 
Shewanella baltica OS155

Gene: Sbal_1885: NiFe hydrogenase assembly chaperone, HyaE
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2107: NiFe hydrogenase assembly chaperone, HyaE
 
Shewanella amazonensis SB2B

Gene: Sama_1675: NiFe hydrogenase assembly chaperone, HyaE
 
Shewanella loihica PV-4

Gene: Shew_1761: NiFe hydrogenase assembly chaperone, HyaE
 
Shewanella pealeana ATCC 700345

Gene: Spea_2029: NiFe hydrogenase assembly chaperone, HyaE
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2265: NiFe hydrogenase assembly chaperone, HyaE
 
Shewanella piezotolerans WP3

Gene: swp_2643: NiFe hydrogenase assembly chaperone, HyaE
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1904: NiFe hydrogenase assembly chaperone, HyaE
 
Shewanella woodyi ATCC 51908
NiFe hydrogenase assembly chaperone, HyaE
hyaF
 
Shewanella oneidensis MR-1

Gene: SO2094: NiFe hydrogenase assembly protein, HypF
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2093: NiFe hydrogenase assembly protein, HypF
 
Shewanella sp W3-18-1

Gene: Sputw3181_1919: NiFe hydrogenase assembly protein, HypF
 
Shewanella sp ANA-3

Gene: Shewana3_1875: NiFe hydrogenase assembly protein, HypF
 
Shewanella sp MR-4

Gene: Shewmr4_1817: NiFe hydrogenase assembly protein, HypF
 
Shewanella sp MR-7

Gene: Shewmr7_2160: NiFe hydrogenase assembly protein, HypF
 
Shewanella baltica OS155

Gene: Sbal_1884: NiFe hydrogenase assembly protein, HypF
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2108: NiFe hydrogenase assembly protein, HypF
 
Shewanella amazonensis SB2B

Gene: Sama_1674: NiFe hydrogenase assembly protein, HypF
 
Shewanella loihica PV-4

Gene: Shew_1760: NiFe hydrogenase assembly protein, HypF
 
Shewanella pealeana ATCC 700345

Gene: Spea_2028: NiFe hydrogenase assembly protein, HypF
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2266: NiFe hydrogenase assembly protein, HypF
 
Shewanella piezotolerans WP3

Gene: swp_2644: NiFe hydrogenase assembly protein, HypF
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1903: NiFe hydrogenase assembly protein, HypF
 
Shewanella woodyi ATCC 51908
NiFe hydrogenase assembly protein, HypF
 
CRON 7.
mtrC
*
Shewanella oneidensis MR-1

Site:
position = -190
score = 3.51764
sequence = TAGAAAGATCCAAGTCACACAT

Site:
position = -248
score = 3.6914
sequence = TGTTGTTTTTTTGCTCTCAATT

Gene: SO1778: surface localized decaheme cytochrome c lipoprotein, MtrC
*
Shewanella putrefaciens CN-32

Site:
position = -190
score = 3.51764
sequence = TAGAAAGATCCAAGTCACACAT

Gene: Sputcn32_1478: surface localized decaheme cytochrome c lipoprotein, MtrC
*
Shewanella sp W3-18-1

Site:
position = -190
score = 3.51764
sequence = TAGAAAGATCCAAGTCACACAT

Gene: Sputw3181_2623: surface localized decaheme cytochrome c lipoprotein, MtrC
*
Shewanella sp ANA-3

Site:
position = -189
score = 3.51764
sequence = TAGAAAGATCCAAGTCACACAT

Gene: Shewana3_2676: surface localized decaheme cytochrome c lipoprotein, MtrC
*
Shewanella sp MR-4

Site:
position = -189
score = 3.51764
sequence = TAGAAAGATCCAAGTCACACAT

Gene: Shewmr4_2510: surface localized decaheme cytochrome c lipoprotein, MtrC
*
Shewanella sp MR-7

Site:
position = -189
score = 3.51764
sequence = TAGAAAGATCCAAGTCACACAT

Gene: Shewmr7_2578: surface localized decaheme cytochrome c lipoprotein, MtrC
*
Shewanella baltica OS155

Site:
position = -190
score = 3.51764
sequence = TAGAAAGATCCAAGTCACACAT

Gene: Sbal_1589: surface localized decaheme cytochrome c lipoprotein, MtrC
 
Shewanella denitrificans OS217
*
Shewanella frigidimarina NCIMB 400

Site:
position = -164
score = 3.7709
sequence = TAGGCTGATCATCATCACACAA

Gene: Sfri_2637: surface localized decaheme cytochrome c lipoprotein, MtrC
*
Shewanella amazonensis SB2B

Site:
position = -230
score = 3.85699
sequence = TTTTTTGATCTGAAACAGCTTT

Site:
position = -178
score = 3.63907
sequence = TAGCCGGATCCAGTTCACACAT

Gene: Sama_1208: surface localized decaheme cytochrome c lipoprotein, MtrC
*
Shewanella loihica PV-4

Site:
position = -179
score = 3.59173
sequence = TAGAAAGATCTCGGTCACACAT

Gene: Shew_2525: surface localized decaheme cytochrome c lipoprotein, MtrC
 
Shewanella pealeana ATCC 700345

Gene: Spea_2698: surface localized decaheme cytochrome c lipoprotein, MtrC
*
Shewanella halifaxensis HAW-EB4

Site:
position = -264
score = 4.00452
sequence = TTTTATTACATTTATCACGTAT

Gene: Shal_2784: surface localized decaheme cytochrome c lipoprotein, MtrC
 
Shewanella piezotolerans WP3

Gene: swp_3278: surface localized decaheme cytochrome c lipoprotein, MtrC
*
Shewanella sediminis HAW-EB3

Site:
position = -191
score = 4.01918
sequence = TAGGCTGATCTAGGTCACACAT

Gene: Ssed_1525: surface localized decaheme cytochrome c lipoprotein, MtrC
*
Shewanella woodyi ATCC 51908

Site:
position = -288
score = 3.71936
sequence = ATGAGTTACAACTTTCACACAT

Gene: Swoo_3125: surface localized decaheme cytochrome c lipoprotein, MtrC
surface localized decaheme cytochrome c lipoprotein, MtrC
mtrA
 
Shewanella oneidensis MR-1

Gene: SO1777: periplasmic decaheme cytochrome c, MtrA
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1477: periplasmic decaheme cytochrome c, MtrA
 
Shewanella sp W3-18-1

Gene: Sputw3181_2624: periplasmic decaheme cytochrome c, MtrA
 
Shewanella sp ANA-3

Gene: Shewana3_2677: periplasmic decaheme cytochrome c, MtrA
 
Shewanella sp MR-4

Gene: Shewmr4_2511: periplasmic decaheme cytochrome c, MtrA
 
Shewanella sp MR-7

Gene: Shewmr7_2579: periplasmic decaheme cytochrome c, MtrA
 
Shewanella baltica OS155

Gene: Sbal_1588: periplasmic decaheme cytochrome c, MtrA
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2638: periplasmic decaheme cytochrome c, MtrA
 
Shewanella amazonensis SB2B

Gene: Sama_1207: periplasmic decaheme cytochrome c, MtrA
 
Shewanella loihica PV-4

Gene: Shew_2526: periplasmic decaheme cytochrome c, MtrA
 
Shewanella pealeana ATCC 700345

Gene: Spea_2699: periplasmic decaheme cytochrome c, MtrA
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2785: periplasmic decaheme cytochrome c, MtrA
 
Shewanella piezotolerans WP3

Gene: swp_3279: periplasmic decaheme cytochrome c, MtrA
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1524: periplasmic decaheme cytochrome c, MtrA
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3126: periplasmic decaheme cytochrome c, MtrA
periplasmic decaheme cytochrome c, MtrA
mtrB
 
Shewanella oneidensis MR-1

Gene: SO1776: outer membrane protein, MtrB
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1476: outer membrane protein, MtrB
 
Shewanella sp W3-18-1

Gene: Sputw3181_2625: outer membrane protein, MtrB
 
Shewanella sp ANA-3

Gene: Shewana3_2678: outer membrane protein, MtrB
 
Shewanella sp MR-4

Gene: Shewmr4_2512: outer membrane protein, MtrB
 
Shewanella sp MR-7

Gene: Shewmr7_2580: outer membrane protein, MtrB
 
Shewanella baltica OS155

Gene: Sbal_1587: outer membrane protein, MtrB
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2639: outer membrane protein, MtrB
 
Shewanella amazonensis SB2B

Gene: Sama_1206: outer membrane protein, MtrB
 
Shewanella loihica PV-4

Gene: Shew_2527: outer membrane protein, MtrB
 
Shewanella pealeana ATCC 700345

Gene: Spea_2700: outer membrane protein, MtrB
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2786: outer membrane protein, MtrB
 
Shewanella piezotolerans WP3

Gene: swp_3280: outer membrane protein, MtrB
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1523: outer membrane protein, MtrB
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3127: outer membrane protein, MtrB
outer membrane protein, MtrB
 
CRON 8.
SO0939
*
Shewanella oneidensis MR-1

Site:
position = -382
score = 4.3436
sequence = TACTGTGATCCCGTTAACCCAA

Site:
position = -217
score = 4.55008
sequence = TATCGTGCCTTCGCTCACATTA

Gene: SO0939: split-soret diheme cytochrome c
*
Shewanella putrefaciens CN-32

Site:
position = -388
score = 4.40149
sequence = TACTGTGATCTTGCTAACCCAA

Gene: Sputcn32_0879: split-soret diheme cytochrome c
*
Shewanella sp W3-18-1

Site:
position = -388
score = 4.40149
sequence = TACTGTGATCTTGCTAACCCAA

Site:
position = -253
score = 3.48068
sequence = AAATGGATTTAAATTCACATAA

Gene: Sputw3181_3294: split-soret diheme cytochrome c
*
Shewanella sp ANA-3

Site:
position = -217
score = 3.77595
sequence = TAATGTGCGCTGCCGCAAATTG

Site:
position = -384
score = 4.3436
sequence = TACTGTGATCCCGTTAACCCAA

Gene: Shewana3_3344: split-soret diheme cytochrome c
*
Shewanella sp MR-4

Site:
position = -383
score = 4.3436
sequence = TACTGTGATCCCGTTAACCCAA

Site:
position = -217
score = 4.04131
sequence = TAATGTGCGTTGATGCACATTG

Gene: Shewmr4_0782: split-soret diheme cytochrome c
*
Shewanella sp MR-7

Site:
position = -383
score = 4.3436
sequence = TACTGTGATCCCGTTAACCCAA

Site:
position = -217
score = 3.86944
sequence = TAATGTGCGCAGGCACACATTG

Gene: Shewmr7_3241: split-soret diheme cytochrome c
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
*
Shewanella frigidimarina NCIMB 400

Site:
position = -147
score = 4.43897
sequence = TTATCTGCTTTGAATCACATTT

Site:
position = -325
score = 4.52262
sequence = ATTTGTGAGCGATATCACGTCA

Gene: Sfri_3633: split-soret diheme cytochrome c
*
Shewanella amazonensis SB2B

Site:
position = -297
score = 3.9359
sequence = AATTGTGATATTGAACAATATG

Gene: Sama_2750: split-soret diheme cytochrome c
*
Shewanella loihica PV-4

Site:
position = -246
score = 4.11479
sequence = TAGAGTGATCAGCTTCACATCG

Gene: Shew_0759: split-soret diheme cytochrome c
*
Shewanella pealeana ATCC 700345

Site:
position = -327
score = 4.02021
sequence = AAATGAGACGTTAGTCACACTC

Site:
position = -249
score = 4.53098
sequence = TAATGTGACATCGTTCATGAAA

Gene: Spea_3437: split-soret diheme cytochrome c
*
Shewanella halifaxensis HAW-EB4

Site:
position = -328
score = 4.17432
sequence = AAATGAGAGGTTAATCACACAG

Site:
position = -250
score = 4.69242
sequence = TAATGTGCTATCGGTCACAGAA

Gene: Shal_3518: split-soret diheme cytochrome c
 
Shewanella piezotolerans WP3
*
Shewanella sediminis HAW-EB3

Site:
position = -349
score = 4.10731
sequence = TTTTGCGAACAAAATCACACTG

Gene: Ssed_0882: split-soret diheme cytochrome c
*
Shewanella woodyi ATCC 51908

Site:
position = -250
score = 4.48942
sequence = TAACATGATCCAGCTCACCATT

Site:
position = -337
score = 3.74538
sequence = GTTTGCGAAGAGGATCACATTG

Gene: Swoo_0884: split-soret diheme cytochrome c
split-soret diheme cytochrome c
SO0938
 
Shewanella oneidensis MR-1

Gene: SO0938: hypothetical protein
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0878: hypothetical protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_3295: hypothetical protein
 
Shewanella sp ANA-3

Gene: Shewana3_3345: hypothetical protein
 
Shewanella sp MR-4

Gene: Shewmr4_0781: hypothetical protein
 
Shewanella sp MR-7

Gene: Shewmr7_3242: hypothetical protein
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3634: hypothetical protein
 
Shewanella amazonensis SB2B

Gene: Sama_2751: hypothetical protein
 
Shewanella loihica PV-4

Gene: Shew_0758: hypothetical protein
 
Shewanella pealeana ATCC 700345

Gene: Spea_3436: hypothetical protein
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3517: hypothetical protein
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3

Gene: Ssed_0881: hypothetical protein
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0883: hypothetical protein
hypothetical protein
 
CRON 9.
SO3119
*
Shewanella oneidensis MR-1

Site:
position = -166
score = 4.51106
sequence = AATAGTGATAAAGATCGCGTTT

Gene: SO3119: hypothetical protein
*
Shewanella putrefaciens CN-32

Site:
position = -171
score = 4.51106
sequence = AATAGTGATAAAGATCGCGTTT

Gene: Sputcn32_2489: hypothetical protein
*
Shewanella sp W3-18-1

Site:
position = -171
score = 4.51106
sequence = AATAGTGATAAAGATCGCGTTT

Gene: Sputw3181_1519: hypothetical protein
*
Shewanella sp ANA-3

Site:
position = -171
score = 4.51106
sequence = AATAGTGATAAAGATCGCGTTT

Gene: Shewana3_1429: hypothetical protein
*
Shewanella sp MR-4

Site:
position = -171
score = 4.51106
sequence = AATAGTGATAAAGATCGCGTTT

Gene: Shewmr4_1376: hypothetical protein
*
Shewanella sp MR-7

Site:
position = -171
score = 4.51106
sequence = AATAGTGATAAAGATCGCGTTT

Gene: Shewmr7_1441: hypothetical protein
*
Shewanella baltica OS155

Site:
position = -171
score = 4.51106
sequence = AATAGTGATAAAGATCGCGTTT

Gene: Sbal_2792: hypothetical protein
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
*
Shewanella amazonensis SB2B

Site:
position = -151
score = 4.4095
sequence = AATAGTGATTAAGCTCGCGTTT

Gene: Sama_2198: hypothetical protein
 
Shewanella loihica PV-4
*
Shewanella pealeana ATCC 700345

Site:
position = -148
score = 4.0596
sequence = GAAAGTGATTTATATCGCGTTT

Gene: Spea_1466: hypothetical protein
*
Shewanella halifaxensis HAW-EB4

Site:
position = -148
score = 4.0596
sequence = GAAAGTGATTTATATCGCGTTT

Gene: Shal_1549: hypothetical protein
*
Shewanella piezotolerans WP3

Site:
position = -220
score = 3.76309
sequence = GAAAGTGACTTAAATCGCGTTT

Gene: swp_1671: hypothetical protein
*
Shewanella sediminis HAW-EB3

Site:
position = -173
score = 4.73553
sequence = TAAAGTGATTTAGATCGCGTTT

Gene: Ssed_2897: hypothetical protein
*
Shewanella woodyi ATCC 51908

Site:
position = -148
score = 4.42972
sequence = TTAAGTGACTTAGATCGCGTTT

Gene: Swoo_1750: hypothetical protein
hypothetical protein
 
CRON 10.
mtrD
*
Shewanella oneidensis MR-1

Site:
position = -339
score = 3.80688
sequence = TTATGTGACAAAAATCTCTATG

Gene: SO1782: periplasmic decaheme cytochrome c, MtrD
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
*
Shewanella sp ANA-3

Site:
position = -295
score = 4.35955
sequence = TTATGTGACAAAAATCTCAATG

Site:
position = -172
score = 4.26694
sequence = AAGTGAGAACAAGATCACACTT

Gene: Shewana3_2672: periplasmic decaheme cytochrome c, MtrD
*
Shewanella sp MR-4

Site:
position = -295
score = 4.35955
sequence = TTATGTGACAAAAATCTCAATG

Site:
position = -172
score = 4.26694
sequence = AAGTGAGAACAAGATCACACTT

Gene: Shewmr4_2506: periplasmic decaheme cytochrome c, MtrD
*
Shewanella sp MR-7

Site:
position = -295
score = 4.35955
sequence = TTATGTGACAAAAATCTCAATG

Site:
position = -172
score = 4.26694
sequence = AAGTGAGAACAAGATCACACTT

Gene: Shewmr7_2574: periplasmic decaheme cytochrome c, MtrD
*
Shewanella baltica OS155

Site:
position = -304
score = 3.76559
sequence = TTATGTGACAAAAATACCAATG

Site:
position = -181
score = 4.77529
sequence = AAACGTGATCAACATCACGCTT

Gene: Sbal_1593: periplasmic decaheme cytochrome c, MtrD
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
*
Shewanella amazonensis SB2B

Site:
position = -189
score = 3.93967
sequence = CGGCGTGACACTCATCACACTT

Gene: Sama_1213: periplasmic decaheme cytochrome c, MtrD
*
Shewanella loihica PV-4

Site:
position = -170
score = 5.28415
sequence = CAACGTGATCTAGATCACATAT

Site:
position = -260
score = 4.45471
sequence = TTATGTGACAGATATCTCAATC

Gene: Shew_2519: periplasmic decaheme cytochrome c, MtrD
*
Shewanella pealeana ATCC 700345

Site:
position = -286
score = 4.12663
sequence = TTATGTGACAAAACTCTCAACT

Site:
position = -197
score = 5.43359
sequence = AAGTGTGATACGCATCACATAA

Gene: Spea_2692: periplasmic decaheme cytochrome c, MtrD
*
Shewanella halifaxensis HAW-EB4

Site:
position = -305
score = 4.5247
sequence = TTATGTGATAAATATCTCAACT

Site:
position = -184
score = 4.56732
sequence = AAACTTGACACAGATCACACTT

Gene: Shal_2778: periplasmic decaheme cytochrome c, MtrD
*
Shewanella piezotolerans WP3

Site:
position = -308
score = 4.16651
sequence = TTATGTGACAAATCTCTCAACT

Site:
position = -185
score = 4.56511
sequence = CAGTGTGACGTAGATCACGCTT

Gene: swp_3272: periplasmic decaheme cytochrome c, MtrD
*
Shewanella sediminis HAW-EB3

Site:
position = -174
score = 4.76284
sequence = TAGCGTGACCAAGATCACACTT

Site:
position = -291
score = 4.01107
sequence = TTATGTGACAAAAGTCTCAACT

Gene: Ssed_1530: periplasmic decaheme cytochrome c, MtrD
 
Shewanella woodyi ATCC 51908
periplasmic decaheme cytochrome c, MtrD
mtrE
 
Shewanella oneidensis MR-1

Gene: SO1781: outer membrane protein, MtrE
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3

Gene: Shewana3_2673: outer membrane protein, MtrE
 
Shewanella sp MR-4

Gene: Shewmr4_2507: outer membrane protein, MtrE
 
Shewanella sp MR-7

Gene: Shewmr7_2575: outer membrane protein, MtrE
 
Shewanella baltica OS155

Gene: Sbal_1592: outer membrane protein, MtrE
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_1212: outer membrane protein, MtrE
 
Shewanella loihica PV-4

Gene: Shew_2520: outer membrane protein, MtrE
 
Shewanella pealeana ATCC 700345

Gene: Spea_2693: outer membrane protein, MtrE
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2779: outer membrane protein, MtrE
 
Shewanella piezotolerans WP3

Gene: swp_3273: outer membrane protein, MtrE
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1529: outer membrane protein, MtrE
 
Shewanella woodyi ATCC 51908
outer membrane protein, MtrE
mtrF
 
Shewanella oneidensis MR-1

Gene: SO1780: surface localized decaheme cytochrome c lipoprotein, MtrF
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3

Gene: Shewana3_2674: surface localized decaheme cytochrome c lipoprotein, MtrF
 
Shewanella sp MR-4

Gene: Shewmr4_2508: surface localized decaheme cytochrome c lipoprotein, MtrF
 
Shewanella sp MR-7

Gene: Shewmr7_2576: surface localized decaheme cytochrome c lipoprotein, MtrF
 
Shewanella baltica OS155

Gene: Sbal_1591: surface localized decaheme cytochrome c lipoprotein, MtrF
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_1211: surface localized decaheme cytochrome c lipoprotein, MtrF
 
Shewanella loihica PV-4

Gene: Shew_2521: surface localized decaheme cytochrome c lipoprotein, MtrF
 
Shewanella pealeana ATCC 700345

Gene: Spea_2694: surface localized decaheme cytochrome c lipoprotein, MtrF
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2780: surface localized decaheme cytochrome c lipoprotein, MtrF
 
Shewanella piezotolerans WP3

Gene: swp_3274: surface localized decaheme cytochrome c lipoprotein, MtrF
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1528: surface localized decaheme cytochrome c lipoprotein, MtrF
 
Shewanella woodyi ATCC 51908
surface localized decaheme cytochrome c lipoprotein, MtrF
omcA
 
Shewanella oneidensis MR-1

Gene: SO1779: surface localized decaheme cytochrome c lipoprotein, OmcA
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3

Gene: Shewana3_2675: surface localized decaheme cytochrome c lipoprotein, OmcA
 
Shewanella sp MR-4

Gene: Shewmr4_2509: surface localized decaheme cytochrome c lipoprotein, OmcA
 
Shewanella sp MR-7

Gene: Shewmr7_2577: surface localized decaheme cytochrome c lipoprotein, OmcA
 
Shewanella baltica OS155

Gene: Sbal_1590: surface localized decaheme cytochrome c lipoprotein, OmcA
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2636: surface localized decaheme cytochrome c lipoprotein, OmcA
 
Shewanella amazonensis SB2B

Gene: Sama_1210: surface localized decaheme cytochrome c lipoprotein, OmcA
 
Shewanella loihica PV-4

Gene: Shew_2522: surface localized decaheme cytochrome c lipoprotein, OmcA
 
Shewanella pealeana ATCC 700345

Gene: Spea_2695: surface localized decaheme cytochrome c lipoprotein, OmcA
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2781: surface localized decaheme cytochrome c lipoprotein, OmcA
 
Shewanella piezotolerans WP3

Gene: swp_3275: surface localized decaheme cytochrome c lipoprotein, OmcA
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1527: surface localized decaheme cytochrome c lipoprotein, OmcA
 
Shewanella woodyi ATCC 51908
surface localized decaheme cytochrome c lipoprotein, OmcA
 
CRON 11.
cyaC
*
Shewanella oneidensis MR-1

Site:
position = -162
score = 4.6576
sequence = TGTATTGATCCAGATCACAAAT

Gene: SO1329: Adenylate cyclase (EC 4.6.1.1)
*
Shewanella putrefaciens CN-32

Site:
position = -101
score = 4.6576
sequence = TGTATTGATCCAGATCACAAAT

Gene: Sputcn32_1140: Adenylate cyclase (EC 4.6.1.1)
*
Shewanella sp W3-18-1

Site:
position = -101
score = 4.6576
sequence = TGTATTGATCCAGATCACAAAT

Gene: Sputw3181_3024: Adenylate cyclase (EC 4.6.1.1)
*
Shewanella sp ANA-3

Site:
position = -162
score = 4.43072
sequence = TGGATTGATCCAGATCACAAAT

Gene: Shewana3_3045: Adenylate cyclase (EC 4.6.1.1)
*
Shewanella sp MR-4

Site:
position = -162
score = 4.43072
sequence = TGGATTGATCCAGATCACAAAT

Gene: Shewmr4_2867: Adenylate cyclase (EC 4.6.1.1)
*
Shewanella sp MR-7

Site:
position = -162
score = 4.43072
sequence = TGGATTGATCCAGATCACAAAT

Gene: Shewmr7_2949: Adenylate cyclase (EC 4.6.1.1)
*
Shewanella baltica OS155

Site:
position = -101
score = 4.7278
sequence = TAGATTGATCCAGATCACAAAT

Gene: Sbal_1182: Adenylate cyclase (EC 4.6.1.1)
*
Shewanella denitrificans OS217

Site:
position = -157
score = 4.80677
sequence = TGAATTGATCTAGATCACATTT

Gene: Sden_2784: Adenylate cyclase (EC 4.6.1.1)
*
Shewanella frigidimarina NCIMB 400

Site:
position = -158
score = 4.40292
sequence = TCTATTGATCTAAATCACAAAT

Gene: Sfri_2947: Adenylate cyclase (EC 4.6.1.1)
*
Shewanella amazonensis SB2B

Site:
position = -102
score = 4.2287
sequence = TGAATTGATTCAGATCACGTTA

Gene: Sama_0861: Adenylate cyclase (EC 4.6.1.1)
*
Shewanella loihica PV-4

Site:
position = -162
score = 4.57561
sequence = TCATTTGACTTAGATCACAAAT

Gene: Shew_1036: Adenylate cyclase (EC 4.6.1.1)
*
Shewanella pealeana ATCC 700345

Site:
position = -100
score = 4.57561
sequence = TCATTTGACTTAGATCACAAAT

Gene: Spea_1019: Adenylate cyclase (EC 4.6.1.1)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -99
score = 5.05535
sequence = TTATTTGACTTAGATCACAAAT

Gene: Shal_1065: Adenylate cyclase (EC 4.6.1.1)
*
Shewanella piezotolerans WP3

Site:
position = -98
score = 4.57561
sequence = TCATTTGACTTAGATCACAAAT

Gene: swp_3798: Adenylate cyclase (EC 4.6.1.1)
*
Shewanella sediminis HAW-EB3

Site:
position = -103
score = 4.3353
sequence = TCATTTGACAAAGATCACAAAT

Gene: Ssed_1130: Adenylate cyclase (EC 4.6.1.1)
*
Shewanella woodyi ATCC 51908

Site:
position = -96
score = 4.3353
sequence = TCATTTGACTAAGATCACAAAT

Gene: Swoo_1225: Adenylate cyclase (EC 4.6.1.1)
Adenylate cyclase (EC 4.6.1.1)
 
CRON 12.
resA
*
Shewanella oneidensis MR-1

Site:
position = -265
score = 4.09062
sequence = ATTATTGATGCATATCAAGAAT

Gene: SO2100: C-type cytochrome biogenesis protein ResA (thioredoxin)
*
Shewanella putrefaciens CN-32

Site:
position = -279
score = 4.17976
sequence = ATTATTGATGTATATCAAGAAT

Site:
position = -219
score = 3.94856
sequence = TAACATGACGCAGATCTAATTT

Gene: Sputcn32_2087: C-type cytochrome biogenesis protein ResA (thioredoxin)
*
Shewanella sp W3-18-1

Site:
position = -219
score = 3.94856
sequence = TAACATGACGCAGATCTAATTT

Site:
position = -279
score = 4.17976
sequence = ATTATTGATGTATATCAAGAAT

Gene: Sputw3181_1925: C-type cytochrome biogenesis protein ResA (thioredoxin)
*
Shewanella sp ANA-3

Site:
position = -251
score = 4.20702
sequence = ATTCTTGATGCATATCAAGAAT

Site:
position = -191
score = 4.2052
sequence = TAACATGATGCAGATCTAATTT

Gene: Shewana3_1881: C-type cytochrome biogenesis protein ResA (thioredoxin)
*
Shewanella sp MR-4

Site:
position = -206
score = 4.2052
sequence = TAACATGATGCAGATCTAATTT

Site:
position = -266
score = 4.20702
sequence = ATTCTTGATGCATATCAAGAAT

Gene: Shewmr4_1823: C-type cytochrome biogenesis protein ResA (thioredoxin)
*
Shewanella sp MR-7

Site:
position = -191
score = 4.2052
sequence = TAACATGATGCAGATCTAATTT

Site:
position = -251
score = 4.20702
sequence = ATTCTTGATGCATATCAAGAAT

Gene: Shewmr7_2154: C-type cytochrome biogenesis protein ResA (thioredoxin)
*
Shewanella baltica OS155

Site:
position = -301
score = 4.29616
sequence = ATTCTTGATGTATATCAAGAAT

Site:
position = -241
score = 4.03771
sequence = TAACATGACGTAGATCTAATTT

Gene: Sbal_1890: C-type cytochrome biogenesis protein ResA (thioredoxin)
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1124: C-type cytochrome biogenesis protein ResA (thioredoxin)
 
Shewanella amazonensis SB2B

Gene: Sama_1680: C-type cytochrome biogenesis protein ResA (thioredoxin)
 
Shewanella loihica PV-4

Gene: Shew_1895: C-type cytochrome biogenesis protein ResA (thioredoxin)
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3

Gene: Ssed_3819: C-type cytochrome biogenesis protein ResA (thioredoxin)
*
Shewanella woodyi ATCC 51908

Site:
position = -140
score = 4.05319
sequence = ATTTTTGATGCTAATCAAATGA

Gene: Swoo_2219: C-type cytochrome biogenesis protein ResA (thioredoxin)
C-type cytochrome biogenesis protein ResA (thioredoxin)
SO2101
 
Shewanella oneidensis MR-1

Gene: SO2101: lipoprotein, putative
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2086: lipoprotein, putative
 
Shewanella sp W3-18-1

Gene: Sputw3181_1926: lipoprotein, putative
 
Shewanella sp ANA-3

Gene: Shewana3_1882: lipoprotein, putative
 
Shewanella sp MR-4

Gene: Shewmr4_1824: lipoprotein, putative
 
Shewanella sp MR-7

Gene: Shewmr7_2153: lipoprotein, putative
 
Shewanella baltica OS155

Gene: Sbal_1891: lipoprotein, putative
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1125: lipoprotein, putative
 
Shewanella amazonensis SB2B

Gene: Sama_1681: lipoprotein, putative
 
Shewanella loihica PV-4

Gene: Shew_1896: lipoprotein, putative
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3

Gene: Ssed_3818: lipoprotein, putative
 
Shewanella woodyi ATCC 51908

Gene: Swoo_2220: lipoprotein, putative
lipoprotein, putative
SO2102
 
Shewanella oneidensis MR-1

Gene: SO2102: hypothetical protein
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2085: hypothetical protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_1927: hypothetical protein
 
Shewanella sp ANA-3

Gene: Shewana3_1883: hypothetical protein
 
Shewanella sp MR-4

Gene: Shewmr4_1825: hypothetical protein
 
Shewanella sp MR-7

Gene: Shewmr7_2152: hypothetical protein
 
Shewanella baltica OS155

Gene: Sbal_1892: hypothetical protein
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1126: hypothetical protein
 
Shewanella amazonensis SB2B

Gene: Sama_1682: hypothetical protein
 
Shewanella loihica PV-4

Gene: Shew_1897: hypothetical protein
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3

Gene: Ssed_3817: hypothetical protein
 
Shewanella woodyi ATCC 51908

Gene: Swoo_2221: hypothetical protein
hypothetical protein
apbE
 
Shewanella oneidensis MR-1

Gene: SO2103: thiamin biosynthesis lipoprotein ApbE
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2084: thiamin biosynthesis lipoprotein ApbE
 
Shewanella sp W3-18-1

Gene: Sputw3181_1928: thiamin biosynthesis lipoprotein ApbE
 
Shewanella sp ANA-3

Gene: Shewana3_1884: thiamin biosynthesis lipoprotein ApbE
 
Shewanella sp MR-4

Gene: Shewmr4_1826: thiamin biosynthesis lipoprotein ApbE
 
Shewanella sp MR-7

Gene: Shewmr7_2151: thiamin biosynthesis lipoprotein ApbE
 
Shewanella baltica OS155

Gene: Sbal_1893: thiamin biosynthesis lipoprotein ApbE
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1127: thiamin biosynthesis lipoprotein ApbE
 
Shewanella amazonensis SB2B

Gene: Sama_1683: thiamin biosynthesis lipoprotein ApbE
 
Shewanella loihica PV-4

Gene: Shew_1898: thiamin biosynthesis lipoprotein ApbE
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3

Gene: Ssed_3816: thiamin biosynthesis lipoprotein ApbE
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3407: thiamin biosynthesis lipoprotein ApbE
thiamin biosynthesis lipoprotein ApbE
SO2104
 
Shewanella oneidensis MR-1

Gene: SO2104: DNA-binding response regulator for Quinone-reactive Ni/Fe-hydrogenase
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2083: DNA-binding response regulator for Quinone-reactive Ni/Fe-hydrogenase
 
Shewanella sp W3-18-1

Gene: Sputw3181_1929: DNA-binding response regulator for Quinone-reactive Ni/Fe-hydrogenase
 
Shewanella sp ANA-3

Gene: Shewana3_1885: DNA-binding response regulator for Quinone-reactive Ni/Fe-hydrogenase
 
Shewanella sp MR-4

Gene: Shewmr4_1827: DNA-binding response regulator for Quinone-reactive Ni/Fe-hydrogenase
 
Shewanella sp MR-7

Gene: Shewmr7_2150: DNA-binding response regulator for Quinone-reactive Ni/Fe-hydrogenase
 
Shewanella baltica OS155

Gene: Sbal_1894: DNA-binding response regulator for Quinone-reactive Ni/Fe-hydrogenase
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1128: DNA-binding response regulator for Quinone-reactive Ni/Fe-hydrogenase
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
DNA-binding response regulator for Quinone-reactive Ni/Fe-hydrogenase
SO2105
 
Shewanella oneidensis MR-1

Gene: SO2105: Signal transduction histidine kinase for Quinone-reactive Ni/Fe-hydrogenase ## FIG-predicted
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2082: Signal transduction histidine kinase for Quinone-reactive Ni/Fe-hydrogenase ## FIG-predicted
 
Shewanella sp W3-18-1

Gene: Sputw3181_1930: Signal transduction histidine kinase for Quinone-reactive Ni/Fe-hydrogenase ## FIG-predicted
 
Shewanella sp ANA-3

Gene: Shewana3_1886: Signal transduction histidine kinase for Quinone-reactive Ni/Fe-hydrogenase ## FIG-predicted
 
Shewanella sp MR-4

Gene: Shewmr4_1828: Signal transduction histidine kinase for Quinone-reactive Ni/Fe-hydrogenase ## FIG-predicted
 
Shewanella sp MR-7

Gene: Shewmr7_2149: Signal transduction histidine kinase for Quinone-reactive Ni/Fe-hydrogenase ## FIG-predicted
 
Shewanella baltica OS155

Gene: Sbal_1895: Signal transduction histidine kinase for Quinone-reactive Ni/Fe-hydrogenase ## FIG-predicted
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1129: Signal transduction histidine kinase for Quinone-reactive Ni/Fe-hydrogenase ## FIG-predicted
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Signal transduction histidine kinase for Quinone-reactive Ni/Fe-hydrogenase ## FIG-predicted
Swoo_2222
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908

Gene: Swoo_2222: transposase and inactivated derivative
transposase and inactivated derivative
 
CRON 13.
Sputcn32_0777
 
Shewanella oneidensis MR-1
*
Shewanella putrefaciens CN-32

Site:
position = -140
score = 4.46796
sequence = AAACTTGATTCGTGTCACACAA

Gene: Sputcn32_0777: hypothetical protein
*
Shewanella sp W3-18-1

Site:
position = -140
score = 4.46796
sequence = AAACTTGATTCGTGTCACACAA

Gene: Sputw3181_3398: hypothetical protein
*
Shewanella sp ANA-3

Site:
position = -140
score = 4.42397
sequence = AAATTTGAACCACATCACACAG

Gene: Shewana3_0738: hypothetical protein
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155

Gene: Sbal_3565: hypothetical protein
 
Shewanella denitrificans OS217
*
Shewanella frigidimarina NCIMB 400

Site:
position = -129
score = 4.15093
sequence = TTTTGTGAGCTAATTGGCAATT

Gene: Sfri_0507: hypothetical protein
*
Shewanella amazonensis SB2B

Site:
position = -139
score = 4.26481
sequence = AAAGTTGATTCACATCAAATTA

Gene: Sama_0549: hypothetical protein
 
Shewanella loihica PV-4

Gene: Shew_3247: hypothetical protein
 
Shewanella pealeana ATCC 700345

Gene: Spea_0593: hypothetical protein
*
Shewanella halifaxensis HAW-EB4

Site:
position = -79
score = 3.85574
sequence = GTTTTTGACTAAGATCAAAAAA

Gene: Shal_0680: hypothetical protein
*
Shewanella piezotolerans WP3

Site:
position = -64
score = 4.09572
sequence = AAACGTGATCAACAGCATCTTT

Gene: swp_4510: hypothetical protein
 
Shewanella sediminis HAW-EB3

Gene: Ssed_4003: hypothetical protein
*
Shewanella woodyi ATCC 51908

Site:
position = -81
score = 3.91436
sequence = TTTATTGATCGAGATCAGCTTA

Gene: Swoo_4146: hypothetical protein
hypothetical protein
 
CRON 14.
pepQ
*
Shewanella oneidensis MR-1

Site:
position = -237
score = 4.40096
sequence = CTTTGTGATACACTGCACAAAG

Gene: SO0022: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)
*
Shewanella putrefaciens CN-32

Site:
position = -302
score = 4.1807
sequence = CTTTGTGATACACTGCACAGAG

Gene: Sputcn32_0014: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)
*
Shewanella sp W3-18-1

Site:
position = -302
score = 4.1807
sequence = CTTTGTGATACACTGCACAGAG

Gene: Sputw3181_0014: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)
*
Shewanella sp ANA-3

Site:
position = -255
score = 4.40096
sequence = CTTTGTGATACACTGCACAAAG

Gene: Shewana3_0025: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)
*
Shewanella sp MR-4

Site:
position = -255
score = 4.40096
sequence = CTTTGTGATACACTGCACAAAG

Gene: Shewmr4_0019: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)
*
Shewanella sp MR-7

Site:
position = -255
score = 4.40096
sequence = CTTTGTGATACACTGCACAAAG

Gene: Shewmr7_0017: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)
*
Shewanella baltica OS155

Site:
position = -302
score = 4.1807
sequence = CTTTGTGATACACTGCACAGAG

Gene: Sbal_0022: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)
 
Shewanella denitrificans OS217

Gene: Sden_0016: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0014: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)
*
Shewanella amazonensis SB2B

Site:
position = -109
score = 4.02086
sequence = CTTTGTGATACACTGCACAGCA

Gene: Sama_0033: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)
 
Shewanella loihica PV-4

Gene: Shew_0020: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)
*
Shewanella pealeana ATCC 700345

Site:
position = -252
score = 4.08273
sequence = CAGTGTGCGACGAATCACAAAA

Gene: Spea_0019: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -250
score = 4.00906
sequence = CAGTGTGCGACTAATCACAAAA

Gene: Shal_0017: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)
 
Shewanella piezotolerans WP3

Gene: swp_0046: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_0024: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0022: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)
Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)
SO0023
 
Shewanella oneidensis MR-1

Gene: SO0023: FIG000605: protein co-occurring with transport systems (COG1739)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0015: FIG000605: protein co-occurring with transport systems (COG1739)
 
Shewanella sp W3-18-1

Gene: Sputw3181_0015: FIG000605: protein co-occurring with transport systems (COG1739)
 
Shewanella sp ANA-3

Gene: Shewana3_0026: FIG000605: protein co-occurring with transport systems (COG1739)
 
Shewanella sp MR-4

Gene: Shewmr4_0020: FIG000605: protein co-occurring with transport systems (COG1739)
 
Shewanella sp MR-7

Gene: Shewmr7_0018: FIG000605: protein co-occurring with transport systems (COG1739)
 
Shewanella baltica OS155

Gene: Sbal_0023: FIG000605: protein co-occurring with transport systems (COG1739)
 
Shewanella denitrificans OS217

Gene: Sden_0017: FIG000605: protein co-occurring with transport systems (COG1739)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0015: FIG000605: protein co-occurring with transport systems (COG1739)
 
Shewanella amazonensis SB2B

Gene: Sama_0034: FIG000605: protein co-occurring with transport systems (COG1739)
 
Shewanella loihica PV-4

Gene: Shew_0021: FIG000605: protein co-occurring with transport systems (COG1739)
 
Shewanella pealeana ATCC 700345

Gene: Spea_0020: FIG000605: protein co-occurring with transport systems (COG1739)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0018: FIG000605: protein co-occurring with transport systems (COG1739)
 
Shewanella piezotolerans WP3

Gene: swp_0047: FIG000605: protein co-occurring with transport systems (COG1739)
*
Shewanella sediminis HAW-EB3

Site:
position = -48
score = 3.80986
sequence = TTTTCTGATAGATTTTACATCA

Gene: Ssed_0025: FIG000605: protein co-occurring with transport systems (COG1739)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0023: FIG000605: protein co-occurring with transport systems (COG1739)
FIG000605: protein co-occurring with transport systems (COG1739)
trkH-1
 
Shewanella oneidensis MR-1

Gene: SO0024: potassium uptake protein TrkH
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0016: potassium uptake protein TrkH
 
Shewanella sp W3-18-1

Gene: Sputw3181_0016: potassium uptake protein TrkH
 
Shewanella sp ANA-3

Gene: Shewana3_0027: potassium uptake protein TrkH
 
Shewanella sp MR-4

Gene: Shewmr4_0021: potassium uptake protein TrkH
 
Shewanella sp MR-7

Gene: Shewmr7_0019: potassium uptake protein TrkH
 
Shewanella baltica OS155

Gene: Sbal_0024: potassium uptake protein TrkH
 
Shewanella denitrificans OS217

Gene: Sden_0018: potassium uptake protein TrkH
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0016: potassium uptake protein TrkH
 
Shewanella amazonensis SB2B

Gene: Sama_0035: potassium uptake protein TrkH
 
Shewanella loihica PV-4

Gene: Shew_0022: potassium uptake protein TrkH
 
Shewanella pealeana ATCC 700345

Gene: Spea_0021: potassium uptake protein TrkH
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0019: potassium uptake protein TrkH
 
Shewanella piezotolerans WP3

Gene: swp_0048: potassium uptake protein TrkH
 
Shewanella sediminis HAW-EB3

Gene: Ssed_0026: potassium uptake protein TrkH
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0024: potassium uptake protein TrkH
potassium uptake protein TrkH
hemG
 
Shewanella oneidensis MR-1

Gene: SO0025: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0017: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
 
Shewanella sp W3-18-1

Gene: Sputw3181_0017: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
 
Shewanella sp ANA-3

Gene: Shewana3_0028: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
 
Shewanella sp MR-4

Gene: Shewmr4_0022: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
 
Shewanella sp MR-7

Gene: Shewmr7_0020: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
 
Shewanella baltica OS155

Gene: Sbal_0025: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
 
Shewanella denitrificans OS217

Gene: Sden_0019: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0017: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
 
Shewanella amazonensis SB2B

Gene: Sama_0036: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
 
Shewanella loihica PV-4

Gene: Shew_0023: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
 
Shewanella pealeana ATCC 700345

Gene: Spea_0022: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0020: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
 
Shewanella piezotolerans WP3

Gene: swp_0049: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_0027: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0025: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
 
CRON 15.
fadB
*
Shewanella oneidensis MR-1

Site:
position = -210
score = 4.0994
sequence = CTTTGTGCAGTGTATCACAAAG

Gene: SO0021: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
*
Shewanella putrefaciens CN-32

Site:
position = -210
score = 3.70346
sequence = CTCTGTGCAGTGTATCACAAAG

Gene: Sputcn32_0013: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
*
Shewanella sp W3-18-1

Site:
position = -210
score = 3.70346
sequence = CTCTGTGCAGTGTATCACAAAG

Gene: Sputw3181_0013: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
*
Shewanella sp ANA-3

Site:
position = -210
score = 4.0994
sequence = CTTTGTGCAGTGTATCACAAAG

Gene: Shewana3_0024: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
*
Shewanella sp MR-4

Site:
position = -210
score = 4.0994
sequence = CTTTGTGCAGTGTATCACAAAG

Gene: Shewmr4_0018: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
*
Shewanella sp MR-7

Site:
position = -210
score = 4.0994
sequence = CTTTGTGCAGTGTATCACAAAG

Gene: Shewmr7_0016: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
*
Shewanella baltica OS155

Site:
position = -210
score = 3.70346
sequence = CTCTGTGCAGTGTATCACAAAG

Gene: Sbal_0021: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Shewanella denitrificans OS217

Gene: Sden_0015: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0013: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
*
Shewanella amazonensis SB2B

Site:
position = -193
score = 3.83321
sequence = TGCTGTGCAGTGTATCACAAAG

Gene: Sama_0032: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Shewanella loihica PV-4

Gene: Shew_0019: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
*
Shewanella pealeana ATCC 700345

Site:
position = -134
score = 4.5914
sequence = TTTTGTGATTCGTCGCACACTG

Gene: Spea_0018: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -134
score = 4.44023
sequence = TTTTGTGATTAGTCGCACACTG

Gene: Shal_0016: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
*
Shewanella piezotolerans WP3

Site:
position = -127
score = 4.41781
sequence = TTATGTGATTAGTCGCACACTG

Gene: swp_0035: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_0023: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0021: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
fadA
 
Shewanella oneidensis MR-1

Gene: SO0020: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0012: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Shewanella sp W3-18-1

Gene: Sputw3181_0012: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Shewanella sp ANA-3

Gene: Shewana3_0023: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Shewanella sp MR-4

Gene: Shewmr4_0017: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Shewanella sp MR-7

Gene: Shewmr7_0015: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Shewanella baltica OS155

Gene: Sbal_0020: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Shewanella denitrificans OS217

Gene: Sden_0014: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0012: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Shewanella amazonensis SB2B

Gene: Sama_0031: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Shewanella loihica PV-4

Gene: Shew_0018: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Shewanella pealeana ATCC 700345

Gene: Spea_0017: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0015: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Shewanella piezotolerans WP3

Gene: swp_0034: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_0022: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0020: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)
3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
CRON 16.
SO2010
*
Shewanella oneidensis MR-1

Site:
position = -70
score = 4.66386
sequence = TTTTGTGATCTTCGTCACTGTA

Gene: SO2010: hypothetical protein
*
Shewanella putrefaciens CN-32

Site:
position = -65
score = 5.08961
sequence = TTTTGTGATCTCCATCACCGTT

Gene: Sputcn32_2305: hypothetical protein
*
Shewanella sp W3-18-1

Site:
position = -65
score = 5.08961
sequence = TTTTGTGATCTCCATCACCGTT

Gene: Sputw3181_1703: hypothetical protein
 
Shewanella sp ANA-3
*
Shewanella sp MR-4

Site:
position = -65
score = 4.85361
sequence = TTTTGTGATCTTAATCACTGTA

Gene: Shewmr4_2257: hypothetical protein
*
Shewanella sp MR-7

Site:
position = -65
score = 4.85361
sequence = TTTTGTGATCTTAATCACTGTA

Gene: Shewmr7_2329: hypothetical protein
*
Shewanella baltica OS155

Site:
position = -65
score = 4.96559
sequence = TTTTGTGATCTAAATCACTGTA

Gene: Sbal_2577: hypothetical protein
*
Shewanella denitrificans OS217

Site:
position = -81
score = 4.80876
sequence = AAATGTGATCCAGCTCAGCTTT

Gene: Sden_2384: hypothetical protein
*
Shewanella frigidimarina NCIMB 400

Site:
position = -116
score = 4.84249
sequence = TTTTGTGATCGACTTCACGTCT

Gene: Sfri_2410: hypothetical protein
*
Shewanella amazonensis SB2B

Site:
position = -51
score = 4.3278
sequence = TTTTGTGAGCTGCATCACGGCA

Gene: Sama_1307: hypothetical protein
*
Shewanella loihica PV-4

Site:
position = -48
score = 4.08426
sequence = AAAATTGATCTAGATCAATAAA

Gene: Shew_2238: hypothetical protein
*
Shewanella pealeana ATCC 700345

Site:
position = -51
score = 4.08426
sequence = AAAATTGATCTAGATCAATAAA

Gene: Spea_1505: hypothetical protein
*
Shewanella halifaxensis HAW-EB4

Site:
position = -80
score = 4.02505
sequence = TAGTGTGATTGATATCTATAAT

Gene: Shal_1587: hypothetical protein
*
Shewanella piezotolerans WP3

Site:
position = -21
score = 4.08426
sequence = AAAATTGATCTAGATCAATAAA

Gene: swp_1711: hypothetical protein
*
Shewanella sediminis HAW-EB3

Site:
position = -49
score = 4.08426
sequence = AAAATTGATCTAGATCAATAAA

Gene: Ssed_2855: hypothetical protein
*
Shewanella woodyi ATCC 51908

Site:
position = -48
score = 4.09084
sequence = TAAATTGATCTAGATCAATAAA

Gene: Swoo_1790: hypothetical protein
hypothetical protein
 
CRON 17.
SO3553
*
Shewanella oneidensis MR-1

Site:
position = -70
score = 3.91137
sequence = TTTTGCAACTATGATCACACAA

Gene: SO3553: putative sulfate permease
*
Shewanella putrefaciens CN-32

Site:
position = -81
score = 3.95475
sequence = ATTTGCAATCATGATCACACAG

Gene: Sputcn32_1042: putative sulfate permease
*
Shewanella sp W3-18-1

Site:
position = -81
score = 3.95475
sequence = ATTTGCAATCATGATCACACAG

Gene: Sputw3181_3123: putative sulfate permease
*
Shewanella sp ANA-3

Site:
position = -70
score = 3.91137
sequence = TTTTGCAACTATGATCACACAA

Gene: Shewana3_3154: putative sulfate permease
*
Shewanella sp MR-4

Site:
position = -70
score = 4.47087
sequence = TTTTGTAACTATGATCACACAA

Gene: Shewmr4_2974: putative sulfate permease
*
Shewanella sp MR-7

Site:
position = -70
score = 4.47087
sequence = TTTTGTAACTATGATCACACAA

Gene: Shewmr7_3056: putative sulfate permease
 
Shewanella baltica OS155

Gene: Sbal_1037: putative sulfate permease
 
Shewanella denitrificans OS217
*
Shewanella frigidimarina NCIMB 400

Site:
position = -116
score = 4.47739
sequence = TAATGTGATGATAATTATATTA

Gene: Sfri_3674: putative sulfate permease
*
Shewanella amazonensis SB2B

Site:
position = -82
score = 4.12356
sequence = AAATTTGCCAAAGCTCACACAT

Gene: Sama_1067: putative sulfate permease
 
Shewanella loihica PV-4

Gene: Shew_0497: putative sulfate permease
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
*
Shewanella sediminis HAW-EB3

Site:
position = -233
score = 4.0599
sequence = GTAAGTGCTACGCATCACATTT

Gene: Ssed_1334: putative sulfate permease
*
Shewanella woodyi ATCC 51908

Site:
position = -288
score = 3.72381
sequence = TCCAGCGACTTAGATCACATTT

Gene: Swoo_3320: putative sulfate permease
putative sulfate permease
Sama_1066
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_1066: hypothetical protein
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
hypothetical protein
Shewana3_2597
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_1065: L-sorbosone dehydrogenase
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
L-sorbosone dehydrogenase
purE
 
Shewanella oneidensis MR-1

Gene: SO3554: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1041: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
 
Shewanella sp W3-18-1

Gene: Sputw3181_3124: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
 
Shewanella sp ANA-3

Gene: Shewana3_3155: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
 
Shewanella sp MR-4

Gene: Shewmr4_2975: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
 
Shewanella sp MR-7

Gene: Shewmr7_3057: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
 
Shewanella baltica OS155

Gene: Sbal_1036: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
*
Shewanella denitrificans OS217

Site:
position = -315
score = 3.73258
sequence = AATTCTGACTCATCTTAAATTA

Gene: Sden_1224: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1076: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
 
Shewanella amazonensis SB2B

Gene: Sama_1064: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
 2
Shewanella loihica PV-4

Gene: Shew_1248: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)

Gene: Shew_1230: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
 
Shewanella pealeana ATCC 700345

Gene: Spea_1211: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -269
score = 4.35424
sequence = TTGTGGGATCTAGGTAACATTT

Gene: Shal_1245: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
 
Shewanella piezotolerans WP3

Gene: swp_1396: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
*
Shewanella sediminis HAW-EB3

Site:
position = -217
score = 3.77583
sequence = TATTGTGAAGTCATCCGGATAT

Gene: Ssed_1333: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3321: phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
purK
 
Shewanella oneidensis MR-1

Gene: SO3555: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1040: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)
 
Shewanella sp W3-18-1

Gene: Sputw3181_3125: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)
 
Shewanella sp ANA-3

Gene: Shewana3_3156: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)
 
Shewanella sp MR-4

Gene: Shewmr4_2976: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)
 
Shewanella sp MR-7

Gene: Shewmr7_3058: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)
 
Shewanella baltica OS155

Gene: Sbal_1035: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)
 
Shewanella denitrificans OS217

Gene: Sden_1223: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1075: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)
 
Shewanella amazonensis SB2B

Gene: Sama_1063: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)
 
Shewanella loihica PV-4

Gene: Shew_1249: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3322: phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)
phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)
SO3556
 
Shewanella oneidensis MR-1

Gene: SO3556: cyclic nucleotide phosphodiesterase, putative
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1039: cyclic nucleotide phosphodiesterase, putative
 
Shewanella sp W3-18-1

Gene: Sputw3181_3126: cyclic nucleotide phosphodiesterase, putative
 
Shewanella sp ANA-3

Gene: Shewana3_3157: cyclic nucleotide phosphodiesterase, putative
 
Shewanella sp MR-4

Gene: Shewmr4_2977: cyclic nucleotide phosphodiesterase, putative
 
Shewanella sp MR-7

Gene: Shewmr7_3059: cyclic nucleotide phosphodiesterase, putative
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217

Gene: Sden_1222: cyclic nucleotide phosphodiesterase, putative
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_1062: cyclic nucleotide phosphodiesterase, putative
 
Shewanella loihica PV-4

Gene: Shew_2953: cyclic nucleotide phosphodiesterase, putative
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3724: cyclic nucleotide phosphodiesterase, putative
cyclic nucleotide phosphodiesterase, putative
 
CRON 18.
SO0543
*
Shewanella oneidensis MR-1

Site:
position = -192
score = 3.7012
sequence = CGTTATGCGCTAAATCACAAAA

Gene: SO0543: hypothetical protein
*
Shewanella putrefaciens CN-32

Site:
position = -88
score = 4.16514
sequence = ATTTTTACTCTAATTCACAAAA

Gene: Sputcn32_3331: hypothetical protein
*
Shewanella sp W3-18-1

Site:
position = -88
score = 4.16514
sequence = ATTTTTACTCTAATTCACAAAA

Gene: Sputw3181_0610: hypothetical protein
*
Shewanella sp ANA-3

Site:
position = -193
score = 4.07227
sequence = AGTTATGCGCTAAATCACAAAA

Gene: Shewana3_0541: hypothetical protein
*
Shewanella sp MR-4

Site:
position = -192
score = 3.96029
sequence = AGTTATGCGCTTAATCACAAAA

Gene: Shewmr4_0542: hypothetical protein
*
Shewanella sp MR-7

Site:
position = -191
score = 3.96029
sequence = AGTTATGCGCTTAATCACAAAA

Gene: Shewmr7_3488: hypothetical protein
*
Shewanella baltica OS155

Site:
position = -201
score = 4.84616
sequence = TGTTGTGCTCTCAATCACAAAA

Site:
position = -88
score = 3.91937
sequence = AATTTTACCCTGATTCACAAAA

Gene: Sbal_0501: hypothetical protein
*
Shewanella denitrificans OS217

Site:
position = -34
score = 3.93206
sequence = TAATATGACTAGAGTCAAACAT

Gene: Sden_0657: hypothetical protein
*
Shewanella frigidimarina NCIMB 400

Site:
position = -200
score = 4.0127
sequence = ATATTTGATCACAAGCACACTC

Gene: Sfri_3534: hypothetical protein
*
Shewanella amazonensis SB2B

Site:
position = -240
score = 3.88591
sequence = CATTGTTACTCACTTCATACAT

Site:
position = -126
score = 3.94973
sequence = ATTTATGACCATACTCACAGAG

Gene: Sama_3164: hypothetical protein
*
Shewanella loihica PV-4

Site:
position = -190
score = 4.1607
sequence = TAGTGTTAACTCGATCAAACAA

Gene: Shew_0428: hypothetical protein
*
Shewanella pealeana ATCC 700345

Site:
position = -197
score = 4.17892
sequence = TTTTGCTACATAGATCGCATAT

Gene: Spea_3733: hypothetical protein
*
Shewanella halifaxensis HAW-EB4

Site:
position = -235
score = 4.70012
sequence = TTTTGTTACATGGATCGCATAT

Gene: Shal_3818: hypothetical protein
*
Shewanella piezotolerans WP3

Site:
position = -156
score = 4.64928
sequence = TTTTGTTACACAGATCGCATAT

Gene: swp_0532: hypothetical protein
*
Shewanella sediminis HAW-EB3

Site:
position = -213
score = 4.19313
sequence = TAATGTTAAATCGATCTCACTT

Gene: Ssed_0598: hypothetical protein
*
Shewanella woodyi ATCC 51908

Site:
position = -215
score = 3.83055
sequence = AATTGCTAGATAGATCTCACTT

Gene: Swoo_4355: hypothetical protein
hypothetical protein
 
CRON 19.
hmgA
*
Shewanella oneidensis MR-1

Site:
position = -92
score = 3.81693
sequence = AATTGATAAGAAGATCACAGTA

Gene: SO1963: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
*
Shewanella putrefaciens CN-32

Site:
position = -66
score = 4.14896
sequence = AATTGATAACAAGATCACATAA

Gene: Sputcn32_1671: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
*
Shewanella sp W3-18-1

Site:
position = -66
score = 4.14896
sequence = AATTGATAACAAGATCACATAA

Gene: Sputw3181_2354: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
*
Shewanella sp ANA-3

Site:
position = -144
score = 3.88015
sequence = TTTTTAGATTGAGATAACAGAT

Site:
position = -88
score = 3.92208
sequence = AATTGATAAGAAGATCACACTA

Gene: Shewana3_2481: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
*
Shewanella sp MR-4

Site:
position = -144
score = 3.88015
sequence = TTTTTAGATTGAGATAACAGAT

Site:
position = -88
score = 3.92208
sequence = AATTGATAAGAAGATCACACTA

Gene: Shewmr4_2291: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
*
Shewanella sp MR-7

Site:
position = -88
score = 3.92208
sequence = AATTGATAAGAAGATCACACTA

Site:
position = -144
score = 3.88015
sequence = TTTTTAGATAGAGATAACAGAT

Gene: Shewmr7_2363: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
*
Shewanella baltica OS155

Site:
position = -88
score = 3.95142
sequence = AATTGATAACAAGATCACACTA

Site:
position = -144
score = 3.52271
sequence = TTTTTAGATTGAGATAACGGAT

Gene: Sbal_2615: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
*
Shewanella denitrificans OS217

Site:
position = -122
score = 3.58168
sequence = AATTGATAGCTAGATCACAACG

Gene: Sden_2162: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
*
Shewanella frigidimarina NCIMB 400

Site:
position = -106
score = 4.99586
sequence = AATTGTAAGTTAGATCACATAT

Site:
position = -126
score = 3.52118
sequence = TTTGTTGATCTTTACCACTAAA

Gene: Sfri_2326: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
*
Shewanella amazonensis SB2B

Site:
position = -78
score = 4.47858
sequence = AATTGATACCCAGATCACATAT

Gene: Sama_1569: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
*
Shewanella loihica PV-4

Site:
position = -61
score = 5.10196
sequence = AATTGTTACTTAGATCACATAA

Gene: Shew_2154: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
*
Shewanella pealeana ATCC 700345

Site:
position = -63
score = 3.95532
sequence = AAATTGAACCTAGATCACATTA

Gene: Spea_1874: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -63
score = 3.9407
sequence = AAATTAAAGCTAGATCACATTA

Gene: Shal_2409: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
*
Shewanella piezotolerans WP3

Site:
position = -61
score = 4.14896
sequence = AATTGATAACAAGATCACATTA

Site:
position = -84
score = 3.48834
sequence = TTTTTTGCTGTTGTTAGCAACT

Gene: swp_2870: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
 
CRON 20.
SO2806
*
Shewanella oneidensis MR-1

Site:
position = -95
score = 4.26651
sequence = TCTTGTGAATTGAGTCACATAG

Gene: SO2806: hypothetical protein
*
Shewanella putrefaciens CN-32

Site:
position = -95
score = 3.96381
sequence = TCTTGTGAATTGAGTCACAGAG

Gene: Sputcn32_1554: hypothetical protein
*
Shewanella sp W3-18-1

Site:
position = -95
score = 3.96381
sequence = TCTTGTGAATTGAGTCACAGAG

Gene: Sputw3181_2545: hypothetical protein
*
Shewanella sp ANA-3

Site:
position = -95
score = 3.96381
sequence = TCTTGTGAATTGAGTCACAGAG

Gene: Shewana3_2588: hypothetical protein
*
Shewanella sp MR-4

Site:
position = -95
score = 3.96381
sequence = TCTTGTGAATTGAGTCACAGAG

Gene: Shewmr4_2426: hypothetical protein
*
Shewanella sp MR-7

Site:
position = -95
score = 3.96381
sequence = TCTTGTGAATTGAGTCACAGAG

Gene: Shewmr7_2496: hypothetical protein
*
Shewanella baltica OS155

Site:
position = -94
score = 4.18448
sequence = ATCTGTGAATTAAGTCACACAG

Gene: Sbal_1679: hypothetical protein
*
Shewanella denitrificans OS217

Site:
position = -35
score = 3.92596
sequence = ATATTTTATGCCGTTCACTCAT

Gene: Sden_1453: hypothetical protein
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2429: hypothetical protein
*
Shewanella amazonensis SB2B

Site:
position = -85
score = 4.0245
sequence = AATTGTGAAGCCAGTCACGGTG

Gene: Sama_1287: hypothetical protein
 
Shewanella loihica PV-4

Gene: Shew_2323: hypothetical protein
*
Shewanella pealeana ATCC 700345

Site:
position = -84
score = 4.41665
sequence = AATTGTGAATAACGTCACACAG

Gene: Spea_1483: hypothetical protein
*
Shewanella halifaxensis HAW-EB4

Site:
position = -84
score = 4.73677
sequence = AATTGTGAACAACATCACACAG

Gene: Shal_1567: hypothetical protein
*
Shewanella piezotolerans WP3

Site:
position = 27
score = 4.26731
sequence = AACTGTGAAAGGTATCACACAC

Gene: swp_1689: hypothetical protein
*
Shewanella sediminis HAW-EB3

Site:
position = -82
score = 4.45071
sequence = TAATGTGAATGGCGTCACACAG

Gene: Ssed_2877: hypothetical protein
*
Shewanella woodyi ATCC 51908

Site:
position = -81
score = 4.61656
sequence = TATTGTGAAAGTCATCACACAG

Gene: Swoo_1771: hypothetical protein
hypothetical protein
 
CRON 21.
map
 
Shewanella oneidensis MR-1

Gene: SO1627: methionine aminopeptidase (EC 3.4.11.18)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1347: methionine aminopeptidase (EC 3.4.11.18)
 
Shewanella sp W3-18-1

Gene: Sputw3181_2756: methionine aminopeptidase (EC 3.4.11.18)
 
Shewanella sp ANA-3

Gene: Shewana3_2816: methionine aminopeptidase (EC 3.4.11.18)
 
Shewanella sp MR-4

Gene: Shewmr4_2642: methionine aminopeptidase (EC 3.4.11.18)
 
Shewanella sp MR-7

Gene: Shewmr7_2709: methionine aminopeptidase (EC 3.4.11.18)
 
Shewanella baltica OS155

Gene: Sbal_1449: methionine aminopeptidase (EC 3.4.11.18)
 
Shewanella denitrificans OS217

Gene: Sden_1553: methionine aminopeptidase (EC 3.4.11.18)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1269: methionine aminopeptidase (EC 3.4.11.18)
 
Shewanella amazonensis SB2B

Gene: Sama_1138: methionine aminopeptidase (EC 3.4.11.18)
 
Shewanella loihica PV-4

Gene: Shew_2636: methionine aminopeptidase (EC 3.4.11.18)
*
Shewanella pealeana ATCC 700345

Site:
position = -104
score = 4.17206
sequence = TAATTTGAAAAAAAGCACAAAT

Gene: Spea_2886: methionine aminopeptidase (EC 3.4.11.18)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -92
score = 3.70075
sequence = TAATATGAAAAAAAGCACAAAC

Gene: Shal_2982: methionine aminopeptidase (EC 3.4.11.18)
*
Shewanella piezotolerans WP3

Site:
position = -93
score = 4.19448
sequence = TATTTTGAAAAAAAGCACAAAT

Gene: swp_3524: methionine aminopeptidase (EC 3.4.11.18)
*
Shewanella sediminis HAW-EB3

Site:
position = -91
score = 3.88528
sequence = TATTGAGAGAGCAAACACAAAT

Gene: Ssed_3162: methionine aminopeptidase (EC 3.4.11.18)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3282: methionine aminopeptidase (EC 3.4.11.18)
methionine aminopeptidase (EC 3.4.11.18)
 
CRON 22.
SO3895
 
Shewanella oneidensis MR-1

Gene: SO3895: HesA/MoeB/ThiF family protein related to EC-YgdL
*
Shewanella putrefaciens CN-32

Site:
position = -317
score = 4.86557
sequence = AAATGCGATATAGATCACAAAC

Gene: Sputcn32_0780: HesA/MoeB/ThiF family protein related to EC-YgdL
*
Shewanella sp W3-18-1

Site:
position = -317
score = 4.86557
sequence = AAATGCGATATAGATCACAAAC

Gene: Sputw3181_3395: HesA/MoeB/ThiF family protein related to EC-YgdL
*
Shewanella sp ANA-3

Site:
position = -308
score = 4.54871
sequence = AAATGTGATCTTGATCACTTGA

Gene: Shewana3_0735: HesA/MoeB/ThiF family protein related to EC-YgdL
*
Shewanella sp MR-4

Site:
position = -309
score = 3.87278
sequence = AAATGTGATCTGGATCATTGGA

Gene: Shewmr4_3226: HesA/MoeB/ThiF family protein related to EC-YgdL
*
Shewanella sp MR-7

Site:
position = -309
score = 3.87278
sequence = AAATGTGATCTGGATCATTGGA

Gene: Shewmr7_0763: HesA/MoeB/ThiF family protein related to EC-YgdL
*
Shewanella baltica OS155

Site:
position = -321
score = 5.03197
sequence = AAGTGTGATCTGGATCAAGTTT

Gene: Sbal_3568: HesA/MoeB/ThiF family protein related to EC-YgdL
 
Shewanella denitrificans OS217

Gene: Sden_0542: HesA/MoeB/ThiF family protein related to EC-YgdL
*
Shewanella frigidimarina NCIMB 400

Site:
position = -251
score = 3.95131
sequence = TATCTTGATGAGTTTAACCAAT

Gene: Sfri_0504: HesA/MoeB/ThiF family protein related to EC-YgdL
*
Shewanella amazonensis SB2B

Site:
position = -214
score = 4.83968
sequence = AAGTGTGATCACTATCACATCA

Gene: Sama_0546: HesA/MoeB/ThiF family protein related to EC-YgdL
*
Shewanella loihica PV-4

Site:
position = -226
score = 4.63153
sequence = AGGTGTGATCCGTGTCGCAAAT

Site:
position = -196
score = 3.83046
sequence = TTACGTGAGTTTTATCATGTTG

Gene: Shew_3251: HesA/MoeB/ThiF family protein related to EC-YgdL
*
Shewanella pealeana ATCC 700345

Site:
position = -259
score = 4.2915
sequence = ATGTGTGACGCTTGTCACGGTT

Gene: Spea_0591: HesA/MoeB/ThiF family protein related to EC-YgdL
*
Shewanella halifaxensis HAW-EB4

Site:
position = -253
score = 4.77168
sequence = GTTTGTGATGTCTATCACGTTT

Gene: Shal_0678: HesA/MoeB/ThiF family protein related to EC-YgdL
*
Shewanella piezotolerans WP3

Site:
position = -215
score = 3.91162
sequence = ATGTGTGATATTAATCATAGGT

Site:
position = -245
score = 3.77242
sequence = CGATGTGATCTTGATCTGGTTT

Gene: swp_4512: HesA/MoeB/ThiF family protein related to EC-YgdL
*
Shewanella sediminis HAW-EB3

Site:
position = -200
score = 3.77358
sequence = TTTTGTGAACTTGATTAACAAG

Site:
position = -324
score = 5.03019
sequence = TTTTGTGATTCTTATCACGCAT

Site:
position = -294
score = 4.58816
sequence = TTGTGTGATATCAATCATCTTT

Gene: Ssed_4007: HesA/MoeB/ThiF family protein related to EC-YgdL
*
Shewanella woodyi ATCC 51908

Site:
position = -290
score = 5.13082
sequence = CTTTGTGATATCAATCACAATA

Gene: Swoo_4150: HesA/MoeB/ThiF family protein related to EC-YgdL
HesA/MoeB/ThiF family protein related to EC-YgdL
 
CRON 23.
SO4126
*
Shewanella oneidensis MR-1

Site:
position = -92
score = 4.13908
sequence = TTAATTGACCTAAATCAAACTT

Gene: SO4126: hypothetical protein
*
Shewanella putrefaciens CN-32

Site:
position = -90
score = 4.63786
sequence = TAATTTGACCTAGATCAAAGTT

Gene: Sputcn32_0548: hypothetical protein
*
Shewanella sp W3-18-1

Site:
position = -90
score = 4.63786
sequence = TAATTTGACCTAGATCAAAGTT

Gene: Sputw3181_3624: hypothetical protein
*
Shewanella sp ANA-3

Site:
position = -93
score = 4.25106
sequence = TTAATTGACCTAGATCAAACTT

Gene: Shewana3_3675: hypothetical protein
*
Shewanella sp MR-4

Site:
position = -187
score = 4.23469
sequence = AACATTGAACTAGATCACAATT

Site:
position = -93
score = 4.25106
sequence = TTAATTGACCTAGATCAAACTT

Gene: Shewmr4_3498: hypothetical protein
*
Shewanella sp MR-7

Site:
position = -93
score = 4.25106
sequence = TTAATTGACCTAGATCAAACTT

Site:
position = -187
score = 4.23469
sequence = AACATTGAACTAGATCACAATT

Gene: Shewmr7_0454: hypothetical protein
*
Shewanella baltica OS155

Site:
position = -90
score = 4.25106
sequence = TTAATTGACCTAGATCAAACTT

Gene: Sbal_3847: hypothetical protein
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
hypothetical protein
 
CRON 24.
etfD
*
Shewanella oneidensis MR-1

Site:
position = -171
score = 4.25014
sequence = ATCTGTGACAGTGCTCACCCAA

Gene: SO4453: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
*
Shewanella putrefaciens CN-32

Site:
position = -171
score = 4.16552
sequence = ATCTGTGACAGTCCTCACCCAA

Gene: Sputcn32_0388: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
*
Shewanella sp W3-18-1

Site:
position = -171
score = 4.16552
sequence = ATCTGTGACAGTCCTCACCCAA

Gene: Sputw3181_0242: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
*
Shewanella sp ANA-3

Site:
position = -175
score = 4.25014
sequence = ATCTGTGACAGTGCTCACCCAA

Gene: Shewana3_0273: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
*
Shewanella sp MR-4

Site:
position = -175
score = 4.28426
sequence = AACTGTGACAGCGCTCACCCAA

Gene: Shewmr4_0272: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
*
Shewanella sp MR-7

Site:
position = -175
score = 4.28426
sequence = AACTGTGACAGCGCTCACCCAA

Gene: Shewmr7_3749: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
*
Shewanella baltica OS155

Site:
position = -170
score = 4.36307
sequence = ATCTGTGACAGTCCTCACCTAA

Gene: Sbal_0283: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
*
Shewanella denitrificans OS217

Site:
position = -130
score = 4.55565
sequence = TTTTGTGACACAGCTCACCTCA

Gene: Sden_0100: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
*
Shewanella frigidimarina NCIMB 400

Site:
position = -159
score = 4.67074
sequence = ATTTGTGACTCGACTCACGCTA

Gene: Sfri_0081: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
*
Shewanella amazonensis SB2B

Site:
position = -157
score = 4.31194
sequence = AATTGTGACGCCGCTCACTCAG

Gene: Sama_3523: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
*
Shewanella loihica PV-4

Site:
position = -148
score = 4.53276
sequence = TAATGTGACACCGCTCACGAAG

Gene: Shew_0086: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
*
Shewanella pealeana ATCC 700345

Site:
position = -181
score = 4.10743
sequence = TTTTGTGACAGTTATCACGGCA

Gene: Spea_4121: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -180
score = 4.21259
sequence = TTTTGTGACAGTTATCACGCCA

Gene: Shal_0121: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
*
Shewanella piezotolerans WP3

Site:
position = -176
score = 4.43323
sequence = TTTTGTGACACTAATCACCTCA

Gene: swp_5010: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
*
Shewanella sediminis HAW-EB3

Site:
position = -150
score = 4.82835
sequence = TTTTGTGACACCCCTCACATAC

Gene: Ssed_4403: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
*
Shewanella woodyi ATCC 51908

Site:
position = -135
score = 4.72349
sequence = TTTTGTGACGACACTCACATTC

Gene: Swoo_4794: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
 
CRON 25.
omp35
*
Shewanella oneidensis MR-1

Site:
position = -67
score = 4.14845
sequence = AAATGTGTTAAACCACACAAAA

Gene: SO3896: outer membrane porin
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
*
Shewanella sp ANA-3

Site:
position = -67
score = 4.14845
sequence = AAATGTGTTAAACCACACAAAA

Gene: Shewana3_0733: outer membrane porin
*
Shewanella sp MR-4

Site:
position = -67
score = 3.74184
sequence = AAATGTGTAAAACCACACAAAA

Gene: Shewmr4_3228: outer membrane porin
*
Shewanella sp MR-7

Site:
position = -67
score = 3.74184
sequence = AAATGTGTAAAACCACACAAAA

Gene: Shewmr7_0761: outer membrane porin
*
Shewanella baltica OS155

Site:
position = -67
score = 3.58895
sequence = AAATGCGTTAAACCACACAAAA

Gene: Sbal_3570: outer membrane porin
 
Shewanella denitrificans OS217
*
Shewanella frigidimarina NCIMB 400

Site:
position = -145
score = 4.52387
sequence = TTATTTGATCTAGGCCACACTA

Gene: Sfri_0503: outer membrane porin
 
Shewanella amazonensis SB2B
*
Shewanella loihica PV-4

Site:
position = -150
score = 4.10094
sequence = AAATTTGATCTGCGCCACACTC

Gene: Shew_3260: outer membrane porin
*
Shewanella pealeana ATCC 700345

Site:
position = -150
score = 4.4453
sequence = AAACATGATCTAGTCCACAATT

Gene: Spea_0589: outer membrane porin
*
Shewanella halifaxensis HAW-EB4

Site:
position = -150
score = 4.4453
sequence = AAACATGATCTAGTCCACAATT

Gene: Shal_0676: outer membrane porin
*
Shewanella piezotolerans WP3

Site:
position = -150
score = 4.12815
sequence = AAACTTGATCTAGCCCACAATC

Gene: swp_4514: outer membrane porin
*
Shewanella sediminis HAW-EB3

Site:
position = -151
score = 4.4453
sequence = AAACATGATCTAGTCCACAATT

Gene: Ssed_4009: outer membrane porin
*2
Shewanella woodyi ATCC 51908

Site:
position = -149
score = 4.29639
sequence = AAGTTTGATCTAGTCCACAATC

Gene: Swoo_4151: outer membrane porin

Site:
position = -241
score = 3.31103
sequence = AATTATTAACTCTTTCTTAAAT

Gene: Swoo_4152: outer membrane porin
outer membrane porin
 
CRON 26.
SO3421
*
Shewanella oneidensis MR-1

Site:
position = -244
score = 4.22439
sequence = AAACGAGAGTTAAATCACACTT

Gene: SO3421: b-type cytochrome, putative
*
Shewanella putrefaciens CN-32

Site:
position = -242
score = 4.76659
sequence = AAACGAGATCTAAATCACAAAA

Gene: Sputcn32_2739: b-type cytochrome, putative
*
Shewanella sp W3-18-1

Site:
position = -242
score = 4.76659
sequence = AAACGAGATCTAAATCACAAAA

Gene: Sputw3181_1273: b-type cytochrome, putative
*
Shewanella sp ANA-3

Site:
position = -241
score = 4.87751
sequence = AAACGAGATCTAAATCACATTT

Gene: Shewana3_1134: b-type cytochrome, putative
*
Shewanella sp MR-4

Site:
position = -241
score = 4.87751
sequence = AAACGAGATCTAAATCACATTT

Gene: Shewmr4_1133: b-type cytochrome, putative
*
Shewanella sp MR-7

Site:
position = -241
score = 4.87751
sequence = AAACGAGATCTAAATCACATTT

Gene: Shewmr7_1204: b-type cytochrome, putative
*
Shewanella baltica OS155

Site:
position = -244
score = 4.98949
sequence = AAACGAGATCTAGATCACATTT

Gene: Sbal_1222: b-type cytochrome, putative
*
Shewanella denitrificans OS217

Site:
position = -291
score = 4.6838
sequence = AAGCGTGATCAAAGTCACACTT

Gene: Sden_2745: b-type cytochrome, putative
*
Shewanella frigidimarina NCIMB 400

Site:
position = -383
score = 5.24076
sequence = AATAGTGATCTGCATCACACTT

Gene: Sfri_2911: b-type cytochrome, putative
*
Shewanella amazonensis SB2B

Site:
position = -234
score = 4.21525
sequence = AGTCGTGAGTAAAATCACGTTT

Gene: Sama_0900: b-type cytochrome, putative
*
Shewanella loihica PV-4

Site:
position = -208
score = 4.94835
sequence = AAACGTGATCTAGATCAACTTT

Gene: Shew_1074: b-type cytochrome, putative
*
Shewanella pealeana ATCC 700345

Site:
position = -255
score = 4.91113
sequence = AGTCGTGATCTAAATCACGTTT

Gene: Spea_1061: b-type cytochrome, putative
*
Shewanella halifaxensis HAW-EB4

Site:
position = -255
score = 4.91113
sequence = AGTCGTGATCTAAATCACGTTT

Gene: Shal_1109: b-type cytochrome, putative
*
Shewanella piezotolerans WP3

Site:
position = -366
score = 4.91113
sequence = AGTCGTGATCTAAATCACGTTT

Gene: swp_3756: b-type cytochrome, putative
*
Shewanella sediminis HAW-EB3

Site:
position = -236
score = 4.91113
sequence = AGTCGTGATCTAAATCACGTTT

Gene: Ssed_1170: b-type cytochrome, putative
*
Shewanella woodyi ATCC 51908

Site:
position = -234
score = 4.91113
sequence = AGTCGTGATCTTGATCACGTTT

Gene: Swoo_1265: b-type cytochrome, putative
b-type cytochrome, putative
 
CRON 27.
hutC
*
Shewanella oneidensis MR-1

Site:
position = -151
score = 4.14677
sequence = TTATGTGAGCTAGCTTGTATTT

Gene: SO0096: histidine utilization repressor
*
Shewanella putrefaciens CN-32

Site:
position = -178
score = 4.10847
sequence = TTATGTGAGCTGGCTTGTATTT

Gene: Sputcn32_0078: histidine utilization repressor
*
Shewanella sp W3-18-1

Site:
position = -178
score = 4.10847
sequence = TTATGTGAGCTGGCTTGTATTT

Gene: Sputw3181_3999: histidine utilization repressor
*
Shewanella sp ANA-3

Site:
position = -142
score = 4.14677
sequence = TTATGTGAGCTAGCTTGTATTT

Gene: Shewana3_0099: histidine utilization repressor
*
Shewanella sp MR-4

Site:
position = -142
score = 4.05763
sequence = TTATGTGAGCCAGCTTGTATTT

Gene: Shewmr4_0098: histidine utilization repressor
*
Shewanella sp MR-7

Site:
position = -142
score = 4.14677
sequence = TTATGTGAGCTAGCTTGTATTT

Gene: Shewmr7_0093: histidine utilization repressor
*
Shewanella baltica OS155

Site:
position = -177
score = 4.14677
sequence = TTATGTGAGCTAGCTTGTATTT

Gene: Sbal_4253: histidine utilization repressor
 
Shewanella denitrificans OS217

Gene: Sden_0082: histidine utilization repressor
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3954: histidine utilization repressor
 
Shewanella amazonensis SB2B

Gene: Sama_0081: histidine utilization repressor
*
Shewanella loihica PV-4

Site:
position = -138
score = 4.14677
sequence = TTATGTGAGCTAGCTTGTATTT

Gene: Shew_3758: histidine utilization repressor
*
Shewanella pealeana ATCC 700345

Site:
position = -106
score = 3.80517
sequence = ATTTGTGAGCTAGCTTGTGTTT

Gene: Spea_4170: histidine utilization repressor
*
Shewanella halifaxensis HAW-EB4

Site:
position = -106
score = 3.94642
sequence = ATTTGTGAGCCCGCTTGTATTT

Gene: Shal_0072: histidine utilization repressor
*
Shewanella piezotolerans WP3

Site:
position = -177
score = 4.16261
sequence = ATTTGTGAGCTAGCTTGTATTT

Gene: swp_0132: histidine utilization repressor
*
Shewanella sediminis HAW-EB3

Site:
position = -150
score = 4.06614
sequence = AGTTGTGATCCAACTTGTATTT

Gene: Ssed_4448: histidine utilization repressor
*
Shewanella woodyi ATCC 51908

Site:
position = -201
score = 4.13634
sequence = AAGTGTGATCCAACTTGTATTT

Gene: Swoo_4839: histidine utilization repressor
histidine utilization repressor
hutU
 
Shewanella oneidensis MR-1

Gene: SO0097: urocanate hydratase (EC 4.2.1.49)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0079: urocanate hydratase (EC 4.2.1.49)
 
Shewanella sp W3-18-1

Gene: Sputw3181_3998: urocanate hydratase (EC 4.2.1.49)
 
Shewanella sp ANA-3

Gene: Shewana3_0100: urocanate hydratase (EC 4.2.1.49)
 
Shewanella sp MR-4

Gene: Shewmr4_0099: urocanate hydratase (EC 4.2.1.49)
 
Shewanella sp MR-7

Gene: Shewmr7_0094: urocanate hydratase (EC 4.2.1.49)
 
Shewanella baltica OS155

Gene: Sbal_4252: urocanate hydratase (EC 4.2.1.49)
 
Shewanella denitrificans OS217

Gene: Sden_0083: urocanate hydratase (EC 4.2.1.49)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3953: urocanate hydratase (EC 4.2.1.49)
 
Shewanella amazonensis SB2B

Gene: Sama_1632: urocanate hydratase (EC 4.2.1.49)
 
Shewanella loihica PV-4

Gene: Shew_3757: urocanate hydratase (EC 4.2.1.49)
 
Shewanella pealeana ATCC 700345

Gene: Spea_4169: urocanate hydratase (EC 4.2.1.49)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0073: urocanate hydratase (EC 4.2.1.49)
 
Shewanella piezotolerans WP3

Gene: swp_0133: urocanate hydratase (EC 4.2.1.49)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_4447: urocanate hydratase (EC 4.2.1.49)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_4838: urocanate hydratase (EC 4.2.1.49)
urocanate hydratase (EC 4.2.1.49)
hutH
 
Shewanella oneidensis MR-1

Gene: SO0098: histidine ammonia-lyase (EC 4.3.1.3)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0080: histidine ammonia-lyase (EC 4.3.1.3)
 
Shewanella sp W3-18-1

Gene: Sputw3181_3997: histidine ammonia-lyase (EC 4.3.1.3)
 
Shewanella sp ANA-3

Gene: Shewana3_0101: histidine ammonia-lyase (EC 4.3.1.3)
 
Shewanella sp MR-4

Gene: Shewmr4_0100: histidine ammonia-lyase (EC 4.3.1.3)
 
Shewanella sp MR-7

Gene: Shewmr7_0095: histidine ammonia-lyase (EC 4.3.1.3)
 
Shewanella baltica OS155

Gene: Sbal_4251: histidine ammonia-lyase (EC 4.3.1.3)
 
Shewanella denitrificans OS217

Gene: Sden_0084: histidine ammonia-lyase (EC 4.3.1.3)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3952: histidine ammonia-lyase (EC 4.3.1.3)
 
Shewanella amazonensis SB2B

Gene: Sama_1631: histidine ammonia-lyase (EC 4.3.1.3)
 
Shewanella loihica PV-4

Gene: Shew_3756: histidine ammonia-lyase (EC 4.3.1.3)
 
Shewanella pealeana ATCC 700345

Gene: Spea_4168: histidine ammonia-lyase (EC 4.3.1.3)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0074: histidine ammonia-lyase (EC 4.3.1.3)
 
Shewanella piezotolerans WP3

Gene: swp_0134: histidine ammonia-lyase (EC 4.3.1.3)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_4446: histidine ammonia-lyase (EC 4.3.1.3)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_4837: histidine ammonia-lyase (EC 4.3.1.3)
histidine ammonia-lyase (EC 4.3.1.3)
 
CRON 28.
yfiA-2
*
Shewanella oneidensis MR-1

Site:
position = -78
score = 4.65624
sequence = AAGTGTGATTTAACTCTCGTTT

Gene: SO3422: Ribosome hibernation protein YfiA
*
Shewanella putrefaciens CN-32

Site:
position = -77
score = 5.05406
sequence = TTTTGTGATTTAGATCTCGTTT

Gene: Sputcn32_2740: Ribosome hibernation protein YfiA
*
Shewanella sp W3-18-1

Site:
position = -77
score = 5.05406
sequence = TTTTGTGATTTAGATCTCGTTT

Gene: Sputw3181_1272: Ribosome hibernation protein YfiA
*
Shewanella sp ANA-3

Site:
position = -78
score = 5.07423
sequence = AAATGTGATTTAGATCTCGTTT

Gene: Shewana3_1133: Ribosome hibernation protein YfiA
*
Shewanella sp MR-4

Site:
position = -78
score = 5.07423
sequence = AAATGTGATTTAGATCTCGTTT

Gene: Shewmr4_1132: Ribosome hibernation protein YfiA
*
Shewanella sp MR-7

Site:
position = -78
score = 5.07423
sequence = AAATGTGATTTAGATCTCGTTT

Gene: Shewmr7_1203: Ribosome hibernation protein YfiA
*
Shewanella baltica OS155

Site:
position = -77
score = 5.17724
sequence = AAATGTGATCTAGATCTCGTTT

Gene: Sbal_1221: Ribosome hibernation protein YfiA
*
Shewanella denitrificans OS217

Site:
position = -77
score = 4.75052
sequence = AAGTGTGACTTTGATCACGCTT

Site:
position = -38
score = 4.14028
sequence = TAATCTGAAGTTAAGCACATAA

Gene: Sden_2746: Ribosome hibernation protein YfiA
*
Shewanella frigidimarina NCIMB 400

Site:
position = -77
score = 5.02355
sequence = AAGTGTGATGCAGATCACTATT

Gene: Sfri_2912: Ribosome hibernation protein YfiA
*
Shewanella amazonensis SB2B

Site:
position = -78
score = 4.31728
sequence = AAACGTGATTTTACTCACGACT

Gene: Sama_0899: Ribosome hibernation protein YfiA
*
Shewanella loihica PV-4

Site:
position = -76
score = 4.56203
sequence = AAAGTTGATCTAGATCACGTTT

Gene: Shew_1073: Ribosome hibernation protein YfiA
*
Shewanella pealeana ATCC 700345

Site:
position = -76
score = 4.6428
sequence = AAACGTGATTTAGATCACGACT

Gene: Spea_1060: Ribosome hibernation protein YfiA
*2
Shewanella halifaxensis HAW-EB4

Site:
position = -83
score = 4.63076
sequence = AAACATGACCTAGATCACACTA

Site:
position = -58
score = 3.78531
sequence = TAATGTGATTGGACTATTGTAA

Gene: Shal_4284: Ribosome hibernation protein YfiA

Site:
position = -76
score = 4.6428
sequence = AAACGTGATTTAGATCACGACT

Gene: Shal_1108: Ribosome hibernation protein YfiA
*
Shewanella piezotolerans WP3

Site:
position = -76
score = 4.6428
sequence = AAACGTGATTTAGATCACGACT

Gene: swp_3757: Ribosome hibernation protein YfiA
*
Shewanella sediminis HAW-EB3

Site:
position = -222
score = 3.83618
sequence = TTTTGAGAGGCAAATAAAAAAA

Site:
position = -76
score = 4.6428
sequence = AAACGTGATTTAGATCACGACT

Gene: Ssed_1169: Ribosome hibernation protein YfiA
*
Shewanella woodyi ATCC 51908

Site:
position = -76
score = 4.50549
sequence = AAACGTGATCAAGATCACGACT

Gene: Swoo_1264: Ribosome hibernation protein YfiA
Ribosome hibernation protein YfiA
 
CRON 29.
fahA
*
Shewanella oneidensis MR-1

Site:
position = -200
score = 5.1279
sequence = AAATGTGATTTTGTTCACGCTA

Gene: SO1670: Fumarylacetoacetate hydrolase family protein
*
Shewanella putrefaciens CN-32

Site:
position = -229
score = 4.9676
sequence = AAATGTGATTTGTGTCACGCTA

Gene: Sputcn32_1389: Fumarylacetoacetate hydrolase family protein
*
Shewanella sp W3-18-1

Site:
position = -229
score = 4.9676
sequence = AAATGTGATTTGTGTCACGCTA

Gene: Sputw3181_2712: Fumarylacetoacetate hydrolase family protein
*
Shewanella sp ANA-3

Site:
position = -197
score = 5.08159
sequence = AAATGTGATTTTGCTCACGCTA

Gene: Shewana3_2778: Fumarylacetoacetate hydrolase family protein
*
Shewanella sp MR-4

Site:
position = -196
score = 5.08159
sequence = AAATGTGATTTTGCTCACGCTA

Gene: Shewmr4_2604: Fumarylacetoacetate hydrolase family protein
*
Shewanella sp MR-7

Site:
position = -196
score = 5.08159
sequence = AAATGTGATTTTGCTCACGCTA

Gene: Shewmr7_2671: Fumarylacetoacetate hydrolase family protein
*
Shewanella baltica OS155

Site:
position = -235
score = 4.96603
sequence = AAATGTGATTTTGGTCACGCTA

Gene: Sbal_1487: Fumarylacetoacetate hydrolase family protein
*
Shewanella denitrificans OS217

Site:
position = -107
score = 4.65138
sequence = AAATGTGATTTTGCGCACGCTA

Gene: Sden_2592: Fumarylacetoacetate hydrolase family protein
*
Shewanella frigidimarina NCIMB 400

Site:
position = -116
score = 4.13475
sequence = AAATGTGATTTGGTACTTACTA

Gene: Sfri_1331: Fumarylacetoacetate hydrolase family protein
*
Shewanella amazonensis SB2B

Site:
position = -111
score = 4.95014
sequence = AATTGTGATTTGAGTCACGCTA

Gene: Sama_2219: Fumarylacetoacetate hydrolase family protein
*
Shewanella loihica PV-4

Site:
position = -130
score = 4.38301
sequence = GAGTGTGATTTGTATCACGCTA

Gene: Shew_1438: Fumarylacetoacetate hydrolase family protein
*
Shewanella pealeana ATCC 700345

Site:
position = -158
score = 5.26583
sequence = AAGTGTGATTTCGTTCACACTA

Gene: Spea_1451: Fumarylacetoacetate hydrolase family protein
*
Shewanella halifaxensis HAW-EB4

Site:
position = -144
score = 4.54594
sequence = CAGTGTGATTTATCTCACGCTA

Gene: Shal_1534: Fumarylacetoacetate hydrolase family protein
*
Shewanella piezotolerans WP3

Site:
position = -140
score = 4.9957
sequence = TAGTGTGATTTAGCTCACGCTA

Gene: swp_1653: Fumarylacetoacetate hydrolase family protein
*
Shewanella sediminis HAW-EB3

Site:
position = -116
score = 4.14612
sequence = GAGCGTGATTCATGTCACACTA

Gene: Ssed_2927: Fumarylacetoacetate hydrolase family protein
*
Shewanella woodyi ATCC 51908

Site:
position = -133
score = 4.9966
sequence = TATTGTGATTTGTGTCACGCTA

Gene: Swoo_1718: Fumarylacetoacetate hydrolase family protein
Fumarylacetoacetate hydrolase family protein
maiA
 
Shewanella oneidensis MR-1

Gene: SO1671: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1390: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Shewanella sp W3-18-1

Gene: Sputw3181_2711: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Shewanella sp ANA-3

Gene: Shewana3_2777: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Shewanella sp MR-4

Gene: Shewmr4_2603: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Shewanella sp MR-7

Gene: Shewmr7_2670: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Shewanella baltica OS155

Gene: Sbal_1488: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Shewanella denitrificans OS217

Gene: Sden_2591: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1332: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Shewanella amazonensis SB2B

Gene: Sama_2218: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Shewanella loihica PV-4

Gene: Shew_1439: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Shewanella pealeana ATCC 700345

Gene: Spea_1452: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1535: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Shewanella piezotolerans WP3

Gene: swp_1654: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_2926: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1719: Maleylacetoacetate isomerase (EC 5.2.1.2)
Maleylacetoacetate isomerase (EC 5.2.1.2)
 
CRON 30.
purH
*
Shewanella oneidensis MR-1

Site:
position = -180
score = 4.10656
sequence = TATTGTGAAATCGCGCAGAAAA

Gene: SO0442: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)
*
Shewanella putrefaciens CN-32

Site:
position = -193
score = 3.99458
sequence = TATTGTGAAATCACGCAGAAAA

Gene: Sputcn32_3401: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)
*
Shewanella sp W3-18-1

Site:
position = -193
score = 3.99458
sequence = TATTGTGAAATCACGCAGAAAA

Gene: Sputw3181_0542: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)
*
Shewanella sp ANA-3

Site:
position = -181
score = 4.10656
sequence = TATTGTGAAATCGCGCAGAAAA

Gene: Shewana3_0441: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)
*
Shewanella sp MR-4

Site:
position = -181
score = 4.10656
sequence = TATTGTGAAATCGCGCAGAAAA

Gene: Shewmr4_0445: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)
*
Shewanella sp MR-7

Site:
position = -181
score = 4.10656
sequence = TATTGTGAAATCGCGCAGAAAA

Gene: Shewmr7_3584: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)
*
Shewanella baltica OS155

Site:
position = -195
score = 3.99458
sequence = TATTGTGAAATCACGCAGAAAA

Gene: Sbal_0420: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)
 
Shewanella denitrificans OS217

Gene: Sden_3407: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)
*
Shewanella frigidimarina NCIMB 400

Site:
position = -195
score = 3.89434
sequence = TATTGTGAAATCACACAGAAAA

Gene: Sfri_0493: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)
*
Shewanella amazonensis SB2B

Site:
position = -194
score = 3.99458
sequence = TATTGTGAAATCACGCAGAAAA

Gene: Sama_0395: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)
*
Shewanella loihica PV-4

Site:
position = -182
score = 4.00632
sequence = TATTGTGAAATCGCACAGAAAA

Gene: Shew_3412: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)
*
Shewanella pealeana ATCC 700345

Site:
position = -181
score = 4.10656
sequence = TATTGTGAAATCGCGCAGAAAA

Gene: Spea_0432: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -182
score = 4.10656
sequence = TATTGTGAAATCGCGCAGAAAA

Gene: Shal_0488: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)
*
Shewanella piezotolerans WP3

Site:
position = -181
score = 4.10656
sequence = TATTGTGAAATCGCGCAGAAAA

Gene: swp_4724: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)
*
Shewanella sediminis HAW-EB3

Site:
position = -282
score = 4.04029
sequence = GAGTGTGACGCTCTGCACAAAT

Site:
position = -191
score = 4.15287
sequence = TATTGTGAAATCGTGCAGAAAA

Gene: Ssed_0444: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)
*
Shewanella woodyi ATCC 51908

Site:
position = -192
score = 3.55881
sequence = TATTGTGAAATCACATATAAAT

Gene: Swoo_0296: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)
IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)
purD
 
Shewanella oneidensis MR-1

Gene: SO0441: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3402: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)
 
Shewanella sp W3-18-1

Gene: Sputw3181_0541: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)
 
Shewanella sp ANA-3

Gene: Shewana3_0440: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)
 
Shewanella sp MR-4

Gene: Shewmr4_0444: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)
 
Shewanella sp MR-7

Gene: Shewmr7_3585: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)
 
Shewanella baltica OS155

Gene: Sbal_0419: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)
 
Shewanella denitrificans OS217

Gene: Sden_3406: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0492: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)
 
Shewanella amazonensis SB2B

Gene: Sama_0394: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)
 
Shewanella loihica PV-4

Gene: Shew_3413: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)
 
Shewanella pealeana ATCC 700345

Gene: Spea_0431: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0487: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)
 
Shewanella piezotolerans WP3

Gene: swp_4725: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_0443: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0295: Phosphoribosylamine--glycine ligase (EC 6.3.4.13)
Phosphoribosylamine--glycine ligase (EC 6.3.4.13)
 
CRON 31.
SO1328
*
Shewanella oneidensis MR-1

Site:
position = -109
score = 3.99519
sequence = AAAATCGATTTTGCTCACACAA

Gene: SO1328: transcriptional regulator, LysR family
*
Shewanella putrefaciens CN-32

Site:
position = -109
score = 3.84964
sequence = AATGGCGATTCTGCTCACACTC

Gene: Sputcn32_1139: transcriptional regulator, LysR family
*
Shewanella sp W3-18-1

Site:
position = -109
score = 3.92332
sequence = AATGGCGATTCGGCTCACACTC

Gene: Sputw3181_3025: transcriptional regulator, LysR family
*
Shewanella sp ANA-3

Site:
position = -109
score = 3.89004
sequence = AAAATCGATTTTGCTCACAGTA

Gene: Shewana3_3046: transcriptional regulator, LysR family
*
Shewanella sp MR-4

Site:
position = -109
score = 3.99519
sequence = AAAATCGATTTTGCTCACACTA

Gene: Shewmr4_2868: transcriptional regulator, LysR family
*
Shewanella sp MR-7

Site:
position = -109
score = 3.99519
sequence = AAAATCGATTTTGCTCACACAA

Gene: Shewmr7_2950: transcriptional regulator, LysR family
 
Shewanella baltica OS155

Gene: Sbal_1181: transcriptional regulator, LysR family
 
Shewanella denitrificans OS217

Gene: Sden_2788: transcriptional regulator, LysR family
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2948: transcriptional regulator, LysR family
 
Shewanella amazonensis SB2B

Gene: Sama_0860: transcriptional regulator, LysR family
*
Shewanella loihica PV-4

Site:
position = -110
score = 3.79618
sequence = TTTTGGGCAGCGCTTCACACTT

Gene: Shew_1035: transcriptional regulator, LysR family
*
Shewanella pealeana ATCC 700345

Site:
position = -89
score = 4.81238
sequence = ATTTTTGATTCAGTTCACAAAC

Gene: Spea_1016: transcriptional regulator, LysR family
*
Shewanella halifaxensis HAW-EB4

Site:
position = -89
score = 4.59212
sequence = ATTTTTGATTCAGTTCACAGTC

Gene: Shal_1064: transcriptional regulator, LysR family
 
Shewanella piezotolerans WP3

Gene: swp_3799: transcriptional regulator, LysR family
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1129: transcriptional regulator, LysR family
*
Shewanella woodyi ATCC 51908

Site:
position = -111
score = 4.29044
sequence = ATTTTAGAGATAGCTCACATTT

Gene: Swoo_1224: transcriptional regulator, LysR family
transcriptional regulator, LysR family
 
CRON 32.
SO1389
*
Shewanella oneidensis MR-1

Site:
position = -150
score = 3.77881
sequence = AACTGTTAGCTTTATCACTCAA

Gene: SO1389: ROK family protein, in a cluster with chitinase
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1199: ROK family protein, in a cluster with chitinase
 
Shewanella sp W3-18-1

Gene: Sputw3181_2965: ROK family protein, in a cluster with chitinase
*
Shewanella sp ANA-3

Site:
position = -150
score = 4.19521
sequence = AAATGTTATCTTTATCACTCAG

Gene: Shewana3_2985: ROK family protein, in a cluster with chitinase
*
Shewanella sp MR-4

Site:
position = -150
score = 4.19521
sequence = AAATGTTATCTTTATCACTCAG

Gene: Shewmr4_2806: ROK family protein, in a cluster with chitinase
*
Shewanella sp MR-7

Site:
position = -150
score = 4.50488
sequence = AAATGTTATCTTTATCACTCAA

Gene: Shewmr7_2889: ROK family protein, in a cluster with chitinase
*
Shewanella baltica OS155

Site:
position = -180
score = 4.37027
sequence = TTGTGTGATTCTTAGCATAAAA

Gene: Sbal_3084: ROK family protein, in a cluster with chitinase
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_0686: ROK family protein, in a cluster with chitinase
 
Shewanella loihica PV-4

Gene: Shew_0954: ROK family protein, in a cluster with chitinase
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3

Gene: swp_4198: ROK family protein, in a cluster with chitinase
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1026: ROK family protein, in a cluster with chitinase
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1098: ROK family protein, in a cluster with chitinase
ROK family protein, in a cluster with chitinase
 
CRON 33.
ilvC
*
Shewanella oneidensis MR-1

Site:
position = -86
score = 4.04611
sequence = TATAGTGACTTCAATCACAACC

Gene: SO4349: Ketol-acid reductoisomerase (EC 1.1.1.86)
*
Shewanella putrefaciens CN-32

Site:
position = -86
score = 4.30275
sequence = TATAGTGATTTCAATCACAACC

Gene: Sputcn32_3615: Ketol-acid reductoisomerase (EC 1.1.1.86)
*
Shewanella sp W3-18-1

Site:
position = -86
score = 4.30275
sequence = TATAGTGATTTCAATCACAACC

Gene: Sputw3181_3755: Ketol-acid reductoisomerase (EC 1.1.1.86)
*
Shewanella sp ANA-3

Site:
position = -86
score = 4.30275
sequence = TATAGTGATTTCAATCACAACC

Gene: Shewana3_0355: Ketol-acid reductoisomerase (EC 1.1.1.86)
*
Shewanella sp MR-4

Site:
position = -86
score = 4.30275
sequence = TATAGTGATTTCAATCACAACC

Gene: Shewmr4_0361: Ketol-acid reductoisomerase (EC 1.1.1.86)
*
Shewanella sp MR-7

Site:
position = -86
score = 4.30275
sequence = TATAGTGATTTCAATCACAACC

Gene: Shewmr7_3665: Ketol-acid reductoisomerase (EC 1.1.1.86)
*
Shewanella baltica OS155

Site:
position = -85
score = 4.30275
sequence = TATAGTGATTTCAATCACAACC

Gene: Sbal_4032: Ketol-acid reductoisomerase (EC 1.1.1.86)
 
Shewanella denitrificans OS217

Gene: Sden_3415: Ketol-acid reductoisomerase (EC 1.1.1.86)
*
Shewanella frigidimarina NCIMB 400

Site:
position = -85
score = 4.07903
sequence = TATAGTGACTTCAATCACAACG

Gene: Sfri_0421: Ketol-acid reductoisomerase (EC 1.1.1.86)
*
Shewanella amazonensis SB2B

Site:
position = -88
score = 4.41971
sequence = TATAGTGAGTTCAATCACAATC

Gene: Sama_3282: Ketol-acid reductoisomerase (EC 1.1.1.86)
*
Shewanella loihica PV-4

Site:
position = -77
score = 3.80381
sequence = ATAGTTGATCTCATTCACAGCT

Site:
position = -126
score = 3.74563
sequence = CAATGTGACGTTTCGAATATAT

Gene: Shew_0288: Ketol-acid reductoisomerase (EC 1.1.1.86)
 
Shewanella pealeana ATCC 700345

Gene: Spea_0344: Ketol-acid reductoisomerase (EC 1.1.1.86)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3945: Ketol-acid reductoisomerase (EC 1.1.1.86)
*
Shewanella piezotolerans WP3

Site:
position = -77
score = 4.55657
sequence = TATAGTGATCTCAATCACAGCT

Gene: swp_0358: Ketol-acid reductoisomerase (EC 1.1.1.86)
*
Shewanella sediminis HAW-EB3

Site:
position = -78
score = 4.0039
sequence = TATAGTGATCTCAATCACTGCT

Gene: Ssed_4166: Ketol-acid reductoisomerase (EC 1.1.1.86)
*
Shewanella woodyi ATCC 51908

Site:
position = -78
score = 3.49429
sequence = TATAGTGAATTCAATCACTGCT

Gene: Swoo_0441: Ketol-acid reductoisomerase (EC 1.1.1.86)
Ketol-acid reductoisomerase (EC 1.1.1.86)
 
CRON 34.
SO3090
*
Shewanella oneidensis MR-1

Site:
position = -165
score = 4.57773
sequence = AAGTGTGATCTGATTCTAACTT

Gene: SO3090: MoxR-like ATPase in aerotolerance operon
*
Shewanella putrefaciens CN-32

Site:
position = -97
score = 4.57773
sequence = AAGTGTGATCTGATTCTAACTT

Gene: Sputcn32_2461: MoxR-like ATPase in aerotolerance operon
*
Shewanella sp W3-18-1

Site:
position = -97
score = 4.57773
sequence = AAGTGTGATCTGATTCTAACTT

Gene: Sputw3181_1547: MoxR-like ATPase in aerotolerance operon
*
Shewanella sp ANA-3

Site:
position = -160
score = 4.57773
sequence = AAGTGTGATCTGATTCTAACTT

Gene: Shewana3_1459: MoxR-like ATPase in aerotolerance operon
*
Shewanella sp MR-4

Site:
position = -160
score = 4.57773
sequence = AAGTGTGATCTGATTCTAACTT

Gene: Shewmr4_1406: MoxR-like ATPase in aerotolerance operon
*
Shewanella sp MR-7

Site:
position = -160
score = 4.57773
sequence = AAGTGTGATCTGATTCTAACTT

Gene: Shewmr7_1471: MoxR-like ATPase in aerotolerance operon
*
Shewanella baltica OS155

Site:
position = -148
score = 4.57773
sequence = AAGTGTGATCTGATTCTAACTT

Gene: Sbal_2762: MoxR-like ATPase in aerotolerance operon
*
Shewanella denitrificans OS217

Site:
position = -157
score = 4.57773
sequence = AAGTGTGATCTGATTCTAACTT

Gene: Sden_1528: MoxR-like ATPase in aerotolerance operon
*
Shewanella frigidimarina NCIMB 400

Site:
position = -167
score = 4.57773
sequence = AAGTGTGATCTGATTCTAACTT

Gene: Sfri_2678: MoxR-like ATPase in aerotolerance operon
*
Shewanella amazonensis SB2B

Site:
position = -137
score = 4.23195
sequence = AAGTGTGACCCGATTCTAACTT

Gene: Sama_2169: MoxR-like ATPase in aerotolerance operon
*
Shewanella loihica PV-4

Site:
position = -296
score = 4.57773
sequence = AAGTGTGATCTGATTCTAACTT

Gene: Shew_2427: MoxR-like ATPase in aerotolerance operon
*
Shewanella pealeana ATCC 700345

Site:
position = -306
score = 4.57773
sequence = AAGTGTGATCTGATTCTAACTT

Gene: Spea_2600: MoxR-like ATPase in aerotolerance operon
*
Shewanella halifaxensis HAW-EB4

Site:
position = -319
score = 4.57773
sequence = AAGTGTGATCTGATTCTAACTT

Gene: Shal_2672: MoxR-like ATPase in aerotolerance operon
*
Shewanella piezotolerans WP3

Site:
position = -97
score = 4.57773
sequence = AAGTGTGATCTGATTCTAACTT

Gene: swp_3141: MoxR-like ATPase in aerotolerance operon
*
Shewanella sediminis HAW-EB3

Site:
position = -316
score = 4.57773
sequence = AAGTGTGATCTGATTCTAACTT

Gene: Ssed_1627: MoxR-like ATPase in aerotolerance operon
*
Shewanella woodyi ATCC 51908

Site:
position = -306
score = 4.78219
sequence = AAATGTGATCTGATTCTAACTT

Gene: Swoo_3028: MoxR-like ATPase in aerotolerance operon
MoxR-like ATPase in aerotolerance operon
SO3091
 
Shewanella oneidensis MR-1

Gene: SO3091: Conserved hypothetical protein
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2462: Conserved hypothetical protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_1546: Conserved hypothetical protein
 
Shewanella sp ANA-3

Gene: Shewana3_1458: Conserved hypothetical protein
 
Shewanella sp MR-4

Gene: Shewmr4_1405: Conserved hypothetical protein
 
Shewanella sp MR-7

Gene: Shewmr7_1470: Conserved hypothetical protein
 
Shewanella baltica OS155

Gene: Sbal_2763: Conserved hypothetical protein
 
Shewanella denitrificans OS217

Gene: Sden_1527: Conserved hypothetical protein
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2679: Conserved hypothetical protein
 
Shewanella amazonensis SB2B

Gene: Sama_2170: Conserved hypothetical protein
 
Shewanella loihica PV-4

Gene: Shew_2428: Conserved hypothetical protein
 
Shewanella pealeana ATCC 700345

Gene: Spea_2601: Conserved hypothetical protein
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2673: Conserved hypothetical protein
 
Shewanella piezotolerans WP3

Gene: swp_3143: Conserved hypothetical protein
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1626: Conserved hypothetical protein
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3029: Conserved hypothetical protein
Conserved hypothetical protein
SO3092
 
Shewanella oneidensis MR-1

Gene: SO3092: hypothetical protein
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2463: hypothetical protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_1545: hypothetical protein
 
Shewanella sp ANA-3

Gene: Shewana3_1457: hypothetical protein
 
Shewanella sp MR-4

Gene: Shewmr4_1404: hypothetical protein
 
Shewanella sp MR-7

Gene: Shewmr7_1469: hypothetical protein
 
Shewanella baltica OS155

Gene: Sbal_2764: hypothetical protein
 
Shewanella denitrificans OS217

Gene: Sden_1526: hypothetical protein
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2680: hypothetical protein
 
Shewanella amazonensis SB2B

Gene: Sama_2171: hypothetical protein
 
Shewanella loihica PV-4

Gene: Shew_2429: hypothetical protein
 
Shewanella pealeana ATCC 700345

Gene: Spea_2602: hypothetical protein
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2674: hypothetical protein
 
Shewanella piezotolerans WP3

Gene: swp_3144: hypothetical protein
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1625: hypothetical protein
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3030: hypothetical protein
hypothetical protein
SO3093
 
Shewanella oneidensis MR-1

Gene: SO3093: von Willebrand factor type A domain protein
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2464: von Willebrand factor type A domain protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_1544: von Willebrand factor type A domain protein
 
Shewanella sp ANA-3

Gene: Shewana3_1456: von Willebrand factor type A domain protein
 
Shewanella sp MR-4

Gene: Shewmr4_1403: von Willebrand factor type A domain protein
 
Shewanella sp MR-7

Gene: Shewmr7_1468: von Willebrand factor type A domain protein
 
Shewanella baltica OS155

Gene: Sbal_2765: von Willebrand factor type A domain protein
 
Shewanella denitrificans OS217

Gene: Sden_1525: von Willebrand factor type A domain protein
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2681: von Willebrand factor type A domain protein
 
Shewanella amazonensis SB2B

Gene: Sama_2172: von Willebrand factor type A domain protein
 
Shewanella loihica PV-4

Gene: Shew_2430: von Willebrand factor type A domain protein
 
Shewanella pealeana ATCC 700345

Gene: Spea_2603: von Willebrand factor type A domain protein
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2675: von Willebrand factor type A domain protein
 
Shewanella piezotolerans WP3

Gene: swp_3145: von Willebrand factor type A domain protein
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1624: von Willebrand factor type A domain protein
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3031: von Willebrand factor type A domain protein
von Willebrand factor type A domain protein
SO3094
 
Shewanella oneidensis MR-1

Gene: SO3094: TPR domain protein in aerotolerance operon
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2465: TPR domain protein in aerotolerance operon
 
Shewanella sp W3-18-1

Gene: Sputw3181_1543: TPR domain protein in aerotolerance operon
 
Shewanella sp ANA-3

Gene: Shewana3_1455: TPR domain protein in aerotolerance operon
 
Shewanella sp MR-4

Gene: Shewmr4_1402: TPR domain protein in aerotolerance operon
 
Shewanella sp MR-7

Gene: Shewmr7_1467: TPR domain protein in aerotolerance operon
 
Shewanella baltica OS155

Gene: Sbal_2766: TPR domain protein in aerotolerance operon
 
Shewanella denitrificans OS217

Gene: Sden_1524: TPR domain protein in aerotolerance operon
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2682: TPR domain protein in aerotolerance operon
 
Shewanella amazonensis SB2B

Gene: Sama_2173: TPR domain protein in aerotolerance operon
 
Shewanella loihica PV-4

Gene: Shew_2431: TPR domain protein in aerotolerance operon
 
Shewanella pealeana ATCC 700345

Gene: Spea_2604: TPR domain protein in aerotolerance operon
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2676: TPR domain protein in aerotolerance operon
 
Shewanella piezotolerans WP3

Gene: swp_3146: TPR domain protein in aerotolerance operon
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1623: TPR domain protein in aerotolerance operon
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3032: TPR domain protein in aerotolerance operon
TPR domain protein in aerotolerance operon
SO3095
 
Shewanella oneidensis MR-1

Gene: SO3095: hypothetical protein
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2466: hypothetical protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_1542: hypothetical protein
 
Shewanella sp ANA-3

Gene: Shewana3_1454: hypothetical protein
 
Shewanella sp MR-4

Gene: Shewmr4_1401: hypothetical protein
 
Shewanella sp MR-7

Gene: Shewmr7_1466: hypothetical protein
 
Shewanella baltica OS155

Gene: Sbal_2767: hypothetical protein
 
Shewanella denitrificans OS217

Gene: Sden_1523: hypothetical protein
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2683: hypothetical protein
 
Shewanella amazonensis SB2B

Gene: Sama_2174: hypothetical protein
 
Shewanella loihica PV-4

Gene: Shew_2432: hypothetical protein
 
Shewanella pealeana ATCC 700345

Gene: Spea_2605: hypothetical protein
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2677: hypothetical protein
 
Shewanella piezotolerans WP3

Gene: swp_3148: hypothetical protein
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1622: hypothetical protein
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3033: hypothetical protein
hypothetical protein
 
CRON 35.
crp
*
Shewanella oneidensis MR-1

Site:
position = -174
score = 3.54123
sequence = TTAGTTGACTAATATCACTAAA

Gene: SO0624: Cyclic AMP receptor protein Crp
*
Shewanella putrefaciens CN-32

Site:
position = -174
score = 3.54123
sequence = TTAGTTGACTAATATCACTAAA

Gene: Sputcn32_0652: Cyclic AMP receptor protein Crp
*
Shewanella sp W3-18-1

Site:
position = -174
score = 3.54123
sequence = TTAGTTGACTAATATCACTAAA

Gene: Sputw3181_3522: Cyclic AMP receptor protein Crp
*
Shewanella sp ANA-3

Site:
position = -174
score = 3.54123
sequence = TTAGTTGACTAATATCACTAAA

Gene: Shewana3_0617: Cyclic AMP receptor protein Crp
*
Shewanella sp MR-4

Site:
position = -174
score = 3.54123
sequence = TTAGTTGACTAATATCACTAAA

Gene: Shewmr4_0618: Cyclic AMP receptor protein Crp
*
Shewanella sp MR-7

Site:
position = -174
score = 3.54123
sequence = TTAGTTGACTAATATCACTAAA

Gene: Shewmr7_3412: Cyclic AMP receptor protein Crp
*
Shewanella baltica OS155

Site:
position = -174
score = 3.74166
sequence = TTAGTTGACTTAAATCACTAAA

Gene: Sbal_0578: Cyclic AMP receptor protein Crp
*
Shewanella denitrificans OS217

Site:
position = -94
score = 3.5727
sequence = AAACACGATCTTGGTCAAAGTT

Gene: Sden_3190: Cyclic AMP receptor protein Crp
*
Shewanella frigidimarina NCIMB 400

Site:
position = -97
score = 4.02903
sequence = AAATACGATCTCTATCAAAGTT

Gene: Sfri_3292: Cyclic AMP receptor protein Crp
*
Shewanella amazonensis SB2B

Site:
position = -96
score = 3.77298
sequence = AATTTCGATCTGCATCATGGTT

Gene: Sama_3004: Cyclic AMP receptor protein Crp
*
Shewanella loihica PV-4

Site:
position = -238
score = 4.04133
sequence = AGATGTGATATGGGCAACATTG

Gene: Shew_0585: Cyclic AMP receptor protein Crp
*
Shewanella pealeana ATCC 700345

Site:
position = -225
score = 3.58749
sequence = AGATGTGATATAAGCCTAATTG

Gene: Spea_3509: Cyclic AMP receptor protein Crp
*
Shewanella halifaxensis HAW-EB4

Site:
position = -226
score = 3.49835
sequence = AGATGTGATACAAGCCTAATTG

Gene: Shal_3603: Cyclic AMP receptor protein Crp
*
Shewanella piezotolerans WP3

Site:
position = -309
score = 4.17988
sequence = TTTATTGATAAGGTTCAAAAAA

Gene: swp_0755: Cyclic AMP receptor protein Crp
*
Shewanella sediminis HAW-EB3

Site:
position = -173
score = 3.81001
sequence = TTAGTTGACTTATATCACTAAT

Gene: Ssed_3873: Cyclic AMP receptor protein Crp
*
Shewanella woodyi ATCC 51908

Site:
position = -173
score = 3.81001
sequence = TTAGTTGACTTATATCACTAAT

Gene: Swoo_0662: Cyclic AMP receptor protein Crp
Cyclic AMP receptor protein Crp
 
CRON 36.
SO2858
*
Shewanella oneidensis MR-1

Site:
position = -105
score = 4.82761
sequence = TATTGTGAGTAAGTTCGCAAAT

Gene: SO2858: hypothetical protein
*
Shewanella putrefaciens CN-32

Site:
position = -75
score = 4.21636
sequence = AGTCGTGATTGTGCTCACACCA

Gene: Sputcn32_2359: hypothetical protein
*
Shewanella sp W3-18-1

Site:
position = -75
score = 4.21636
sequence = AGTCGTGATTGTGCTCACACCA

Gene: Sputw3181_1650: hypothetical protein
*
Shewanella sp ANA-3

Site:
position = -105
score = 4.03554
sequence = GGATGTGAGCCGCTTCGCAAAT

Gene: Shewana3_1574: hypothetical protein
*
Shewanella sp MR-4

Site:
position = -105
score = 3.93606
sequence = CCGTGTGAGGTATTTCGCAAAT

Gene: Shewmr4_1513: hypothetical protein
*
Shewanella sp MR-7

Site:
position = -105
score = 3.93606
sequence = CCGTGTGAGGTATTTCGCAAAT

Gene: Shewmr7_1580: hypothetical protein
*
Shewanella baltica OS155

Site:
position = -75
score = 4.21636
sequence = AGTCGTGATTGTGCTCACACCA

Gene: Sbal_2639: hypothetical protein
 
Shewanella denitrificans OS217
*
Shewanella frigidimarina NCIMB 400

Site:
position = -237
score = 4.94252
sequence = TTTTGTGATGCAGATCTCAATC

Gene: Sfri_1546: hypothetical protein
 
Shewanella amazonensis SB2B

Gene: Sama_1522: hypothetical protein
 
Shewanella loihica PV-4

Gene: Shew_2372: hypothetical protein
 
Shewanella pealeana ATCC 700345

Gene: Spea_1695: hypothetical protein
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2566: hypothetical protein
 
Shewanella piezotolerans WP3

Gene: swp_1973: hypothetical protein
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1745: hypothetical protein
 
Shewanella woodyi ATCC 51908

Gene: Swoo_2839: hypothetical protein
hypothetical protein
SO2857
 
Shewanella oneidensis MR-1

Gene: SO2857: sodium solute symporter family protein
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2358: sodium solute symporter family protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_1651: sodium solute symporter family protein
 
Shewanella sp ANA-3

Gene: Shewana3_1575: sodium solute symporter family protein
 
Shewanella sp MR-4

Gene: Shewmr4_1514: sodium solute symporter family protein
 
Shewanella sp MR-7

Gene: Shewmr7_1581: sodium solute symporter family protein
 
Shewanella baltica OS155

Gene: Sbal_2638: sodium solute symporter family protein
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1547: sodium solute symporter family protein
 
Shewanella amazonensis SB2B

Gene: Sama_1523: sodium solute symporter family protein
 
Shewanella loihica PV-4

Gene: Shew_2371: sodium solute symporter family protein
 
Shewanella pealeana ATCC 700345

Gene: Spea_1696: sodium solute symporter family protein
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2565: sodium solute symporter family protein
 
Shewanella piezotolerans WP3

Gene: swp_1974: sodium solute symporter family protein
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1746: sodium solute symporter family protein
 
Shewanella woodyi ATCC 51908

Gene: Swoo_2838: sodium solute symporter family protein
sodium solute symporter family protein
SO2856
 
Shewanella oneidensis MR-1

Gene: SO2856: predicted signal-transduction protein containing cAMP-binding and CBS domains
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2357: predicted signal-transduction protein containing cAMP-binding and CBS domains
 
Shewanella sp W3-18-1

Gene: Sputw3181_1652: predicted signal-transduction protein containing cAMP-binding and CBS domains
 
Shewanella sp ANA-3

Gene: Shewana3_1576: predicted signal-transduction protein containing cAMP-binding and CBS domains
 
Shewanella sp MR-4

Gene: Shewmr4_1515: predicted signal-transduction protein containing cAMP-binding and CBS domains
 
Shewanella sp MR-7

Gene: Shewmr7_1582: predicted signal-transduction protein containing cAMP-binding and CBS domains
 
Shewanella baltica OS155

Gene: Sbal_2637: predicted signal-transduction protein containing cAMP-binding and CBS domains
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1548: predicted signal-transduction protein containing cAMP-binding and CBS domains
 
Shewanella amazonensis SB2B

Gene: Sama_1524: predicted signal-transduction protein containing cAMP-binding and CBS domains
 
Shewanella loihica PV-4

Gene: Shew_2369: predicted signal-transduction protein containing cAMP-binding and CBS domains
 
Shewanella pealeana ATCC 700345

Gene: Spea_1697: predicted signal-transduction protein containing cAMP-binding and CBS domains
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2564: predicted signal-transduction protein containing cAMP-binding and CBS domains
 
Shewanella piezotolerans WP3

Gene: swp_1975: predicted signal-transduction protein containing cAMP-binding and CBS domains
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1751: predicted signal-transduction protein containing cAMP-binding and CBS domains
 
Shewanella woodyi ATCC 51908

Gene: Swoo_2835: predicted signal-transduction protein containing cAMP-binding and CBS domains
predicted signal-transduction protein containing cAMP-binding and CBS domains
SO2855
 
Shewanella oneidensis MR-1

Gene: SO2855: DNA polymerase III epsilon subunit (EC 2.7.7.7)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2356: DNA polymerase III epsilon subunit (EC 2.7.7.7)
 
Shewanella sp W3-18-1

Gene: Sputw3181_1653: DNA polymerase III epsilon subunit (EC 2.7.7.7)
 
Shewanella sp ANA-3

Gene: Shewana3_1577: DNA polymerase III epsilon subunit (EC 2.7.7.7)
 
Shewanella sp MR-4

Gene: Shewmr4_1516: DNA polymerase III epsilon subunit (EC 2.7.7.7)
 
Shewanella sp MR-7

Gene: Shewmr7_1583: DNA polymerase III epsilon subunit (EC 2.7.7.7)
 
Shewanella baltica OS155

Gene: Sbal_2636: DNA polymerase III epsilon subunit (EC 2.7.7.7)
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1549: DNA polymerase III epsilon subunit (EC 2.7.7.7)
 
Shewanella amazonensis SB2B

Gene: Sama_1525: DNA polymerase III epsilon subunit (EC 2.7.7.7)
 
Shewanella loihica PV-4

Gene: Shew_2368: DNA polymerase III epsilon subunit (EC 2.7.7.7)
 
Shewanella pealeana ATCC 700345

Gene: Spea_1698: DNA polymerase III epsilon subunit (EC 2.7.7.7)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2563: DNA polymerase III epsilon subunit (EC 2.7.7.7)
 
Shewanella piezotolerans WP3

Gene: swp_1976: DNA polymerase III epsilon subunit (EC 2.7.7.7)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1752: DNA polymerase III epsilon subunit (EC 2.7.7.7)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_2834: DNA polymerase III epsilon subunit (EC 2.7.7.7)
DNA polymerase III epsilon subunit (EC 2.7.7.7)
SO2854
 
Shewanella oneidensis MR-1

Gene: SO2854: hypothetical protein
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3

Gene: Shewana3_1580: hypothetical protein
 
Shewanella sp MR-4

Gene: Shewmr4_1519: hypothetical protein
 
Shewanella sp MR-7

Gene: Shewmr7_1586: hypothetical protein
 
Shewanella baltica OS155

Gene: Sbal_2635: hypothetical protein
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_1526: hypothetical protein
 
Shewanella loihica PV-4

Gene: Shew_2367: hypothetical protein
 
Shewanella pealeana ATCC 700345

Gene: Spea_1699: hypothetical protein
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2560: hypothetical protein
 
Shewanella piezotolerans WP3

Gene: swp_1979: hypothetical protein
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1755: hypothetical protein
 
Shewanella woodyi ATCC 51908

Gene: Swoo_2832: hypothetical protein
hypothetical protein
 
CRON 37.
SO4142
*
Shewanella oneidensis MR-1

Site:
position = -121
score = 3.92872
sequence = GAAAGTGACACACCTCAAATAA

Gene: SO4142: cytochrome c family protein
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
*
Shewanella sp ANA-3

Site:
position = -118
score = 4.18536
sequence = GAAAGTGATACACCTCAAATAA

Gene: Shewana3_3688: cytochrome c family protein
*
Shewanella sp MR-4

Site:
position = -118
score = 4.18536
sequence = GAAAGTGATACACCTCAAATAA

Gene: Shewmr4_3511: cytochrome c family protein
*
Shewanella sp MR-7

Site:
position = -122
score = 4.00757
sequence = GAAGGTGATACACCTCAAATAA

Gene: Shewmr7_0441: cytochrome c family protein
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
*
Shewanella frigidimarina NCIMB 400

Site:
position = -112
score = 4.02774
sequence = GGATATGATCTACTTCAAATTA

Gene: Sfri_3554: cytochrome c family protein
*
Shewanella amazonensis SB2B

Site:
position = -268
score = 3.8573
sequence = AAACGTCACATAGATCACACAC

Gene: Sama_3178: cytochrome c family protein
*
Shewanella loihica PV-4

Site:
position = -113
score = 4.08943
sequence = GAAGGTGATCAACATCAAATTT

Gene: Shew_0516: cytochrome c family protein
 
Shewanella pealeana ATCC 700345
*
Shewanella halifaxensis HAW-EB4

Site:
position = -289
score = 3.78179
sequence = AAGTGTGATCTAGATCTGTTAC

Gene: Shal_0616: cytochrome c family protein
*
Shewanella piezotolerans WP3

Site:
position = -133
score = 3.98105
sequence = GAAAGTGATCGAGCTCAACTAT

Gene: swp_4577: cytochrome c family protein
*
Shewanella sediminis HAW-EB3

Site:
position = -112
score = 4.68668
sequence = AAAGGTGATCAACATCAAATTT

Gene: Ssed_4058: cytochrome c family protein
 
Shewanella woodyi ATCC 51908
cytochrome c family protein
SO4143
 
Shewanella oneidensis MR-1

Gene: SO4143: hypothetical protein
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3

Gene: Shewana3_3689: hypothetical protein
 
Shewanella sp MR-4

Gene: Shewmr4_3512: hypothetical protein
 
Shewanella sp MR-7

Gene: Shewmr7_0440: hypothetical protein
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3555: hypothetical protein
 
Shewanella amazonensis SB2B

Gene: Sama_3179: hypothetical protein
 
Shewanella loihica PV-4

Gene: Shew_0515: hypothetical protein
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0615: hypothetical protein
 
Shewanella piezotolerans WP3

Gene: swp_4578: hypothetical protein
 
Shewanella sediminis HAW-EB3

Gene: Ssed_4059: hypothetical protein
 
Shewanella woodyi ATCC 51908
hypothetical protein
SO4144
 
Shewanella oneidensis MR-1

Gene: SO4144: octaheme tetrathionate reductase
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3

Gene: Shewana3_3690: octaheme tetrathionate reductase
 
Shewanella sp MR-4

Gene: Shewmr4_3513: octaheme tetrathionate reductase
 
Shewanella sp MR-7

Gene: Shewmr7_0439: octaheme tetrathionate reductase
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3556: octaheme tetrathionate reductase
 
Shewanella amazonensis SB2B

Gene: Sama_3180: octaheme tetrathionate reductase
 
Shewanella loihica PV-4

Gene: Shew_0514: octaheme tetrathionate reductase
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0614: octaheme tetrathionate reductase
 
Shewanella piezotolerans WP3

Gene: swp_4579: octaheme tetrathionate reductase
 
Shewanella sediminis HAW-EB3

Gene: Ssed_4060: octaheme tetrathionate reductase
 
Shewanella woodyi ATCC 51908
octaheme tetrathionate reductase
 
CRON 38.
Sputcn32_0539
 
Shewanella oneidensis MR-1
*
Shewanella putrefaciens CN-32

Site:
position = -94
score = 4.27992
sequence = TTACATGATACGCTTCACAATG

Gene: Sputcn32_0539: mechanosensitive ion channel
*
Shewanella sp W3-18-1

Site:
position = -94
score = 4.27992
sequence = TTACATGATACGCTTCACAATG

Gene: Sputw3181_3633: mechanosensitive ion channel
*
Shewanella sp ANA-3

Site:
position = -94
score = 4.27992
sequence = TTACATGATACGCTTCACAATG

Gene: Shewana3_3684: mechanosensitive ion channel
*
Shewanella sp MR-4

Site:
position = -94
score = 4.27992
sequence = TTACATGATACGCTTCACAATG

Gene: Shewmr4_3509: mechanosensitive ion channel
*
Shewanella sp MR-7

Site:
position = -94
score = 4.27992
sequence = TTACATGATACGCTTCACAATG

Gene: Shewmr7_0443: mechanosensitive ion channel
*
Shewanella baltica OS155

Site:
position = -95
score = 4.50296
sequence = TTACATGATACGCTTCACACAT

Gene: Sbal_3856: mechanosensitive ion channel
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3406: mechanosensitive ion channel
 
Shewanella amazonensis SB2B

Gene: Sama_0408: mechanosensitive ion channel
*
Shewanella loihica PV-4

Site:
position = -144
score = 4.10197
sequence = TTGCTTGATATGCTTCACGCTA

Gene: Shew_3394: mechanosensitive ion channel
*
Shewanella pealeana ATCC 700345

Site:
position = -138
score = 4.08475
sequence = AAGCTTGATCCTCTTCACGCTA

Gene: Spea_0457: mechanosensitive ion channel
*
Shewanella halifaxensis HAW-EB4

Site:
position = -137
score = 3.96946
sequence = AAGCATGATCCCCTTCACGCTA

Gene: Shal_0532: mechanosensitive ion channel
 
Shewanella piezotolerans WP3

Gene: swp_4706: mechanosensitive ion channel
*
Shewanella sediminis HAW-EB3

Site:
position = -154
score = 4.16207
sequence = ATTCATGATCCACTTCACCTAG

Gene: Ssed_0457: mechanosensitive ion channel
*
Shewanella woodyi ATCC 51908

Site:
position = -127
score = 3.85254
sequence = ATTCATGATCCTCTTCACGCAG

Gene: Swoo_4512: mechanosensitive ion channel
mechanosensitive ion channel
SO4139
*
Shewanella oneidensis MR-1

Site:
position = -162
score = 4.27992
sequence = TTACATGATACGCTTCACAATG

Gene: SO4139: tetratricopeptide repeat family protein
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0538: tetratricopeptide repeat family protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_3634: tetratricopeptide repeat family protein
 
Shewanella sp ANA-3

Gene: Shewana3_3685: tetratricopeptide repeat family protein
 
Shewanella sp MR-4

Gene: Shewmr4_3510: tetratricopeptide repeat family protein
 
Shewanella sp MR-7

Gene: Shewmr7_0442: tetratricopeptide repeat family protein
 
Shewanella baltica OS155

Gene: Sbal_3857: tetratricopeptide repeat family protein
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4

Gene: Shew_2985: tetratricopeptide repeat family protein
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
tetratricopeptide repeat family protein
 
CRON 39.
icd
*
Shewanella oneidensis MR-1

Site:
position = -149
score = 4.6768
sequence = ATTCGTGATATTGCTCACTATT

Gene: SO1538: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)
*
Shewanella putrefaciens CN-32

Site:
position = -148
score = 4.71092
sequence = AATCGTGATATCGCTCACTATT

Gene: Sputcn32_1286: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)
*
Shewanella sp W3-18-1

Site:
position = -148
score = 4.71092
sequence = AATCGTGATATCGCTCACTATT

Gene: Sputw3181_2820: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)
*
Shewanella sp ANA-3

Site:
position = -149
score = 4.72598
sequence = AATCGTGATATTGCTCACTATT

Gene: Shewana3_2890: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)
*
Shewanella sp MR-4

Site:
position = -149
score = 4.72598
sequence = AATCGTGATATTGCTCACTATT

Gene: Shewmr4_2720: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)
*
Shewanella sp MR-7

Site:
position = -149
score = 4.72598
sequence = AATCGTGATATTGCTCACTATT

Gene: Shewmr7_2791: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)
*
Shewanella baltica OS155

Site:
position = -149
score = 4.72598
sequence = AATCGTGATATTGCTCACTATT

Gene: Sbal_1368: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)
*
Shewanella denitrificans OS217

Site:
position = -143
score = 3.76803
sequence = AAAAGGGATATTTCTCACTAAT

Gene: Sden_2561: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)
*
Shewanella frigidimarina NCIMB 400

Site:
position = -148
score = 4.68422
sequence = TAATGTGATAATACTCACTATT

Gene: Sfri_2779: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)
*
Shewanella amazonensis SB2B

Site:
position = -89
score = 4.51181
sequence = AATCGAGACATAAATCACATAA

Gene: Sama_2423: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)
*
Shewanella loihica PV-4

Site:
position = -150
score = 4.351
sequence = AAACGTGAGATTGCTCACTATT

Gene: Shew_2760: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)
*
Shewanella pealeana ATCC 700345

Site:
position = -146
score = 4.22084
sequence = AAACGTGAGATCGCTCACTCTT

Gene: Spea_2980: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -149
score = 4.351
sequence = AAACGTGAGATTGCTCACTATT

Gene: Shal_3069: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)
*
Shewanella piezotolerans WP3

Site:
position = -293
score = 4.62867
sequence = AAACGTGAGATTGCTCACCTTT

Gene: swp_3606: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)
*
Shewanella sediminis HAW-EB3

Site:
position = -151
score = 4.67738
sequence = AAATGTGAGATTGCTCACTATT

Gene: Ssed_3318: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)
*
Shewanella woodyi ATCC 51908

Site:
position = -148
score = 4.26186
sequence = AAACGTGAGACTGCTCACTATT

Gene: Swoo_3466: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)
Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)
 
CRON 40.
SO2427
*
Shewanella oneidensis MR-1

Site:
position = -319
score = 5.12428
sequence = AAGTGTGATTAAAATCACACTT

Gene: SO2427: TonB-dependent receptor
*
Shewanella putrefaciens CN-32

Site:
position = -274
score = 4.02843
sequence = AAATGTTATTTTATTAACAGAG

Site:
position = -318
score = 5.67063
sequence = TAGTGTGATCTACATCACATAA

Gene: Sputcn32_1940: TonB-dependent receptor
*
Shewanella sp W3-18-1

Site:
position = -318
score = 4.5504
sequence = GCGTGTGATCTATATCACATAA

Gene: Sputw3181_2068: TonB-dependent receptor
*
Shewanella sp ANA-3

Site:
position = -276
score = 4.39394
sequence = AAATGTTATTTTCTTAACAGTT

Site:
position = -320
score = 5.24373
sequence = AAGTGTGACACACATCACATAT

Gene: Shewana3_1958: TonB-dependent receptor
*
Shewanella sp MR-4

Site:
position = -275
score = 3.89706
sequence = AAATGTTATTTTATTAACAGCT

Site:
position = -319
score = 5.61222
sequence = AAATGTGATGTGCGTCACATTT

Gene: Shewmr4_1903: TonB-dependent receptor
*
Shewanella sp MR-7

Site:
position = -319
score = 5.16364
sequence = AAGTGTGACGTGTGTCACATTT

Site:
position = -275
score = 4.33811
sequence = AAATGTTATTTTATTAACAGTA

Gene: Shewmr7_2075: TonB-dependent receptor
*
Shewanella baltica OS155

Site:
position = -317
score = 5.12323
sequence = AAGCGTGATCTGTGTCACATTT

Gene: Sbal_2044: TonB-dependent receptor
 
Shewanella denitrificans OS217
*
Shewanella frigidimarina NCIMB 400

Site:
position = -149
score = 5.04528
sequence = AAATGTGATGTTGTTCACATGT

Site:
position = -4
score = 4.14649
sequence = ATTCATGAGTTCAGTCACATTA

Gene: Sfri_2416: TonB-dependent receptor
*
Shewanella amazonensis SB2B

Site:
position = -301
score = 5.24601
sequence = AAGTGTGATGCACGTCACAAAA

Site:
position = -324
score = 3.80556
sequence = TTAATCGATATGGGTCACAGAA

Gene: Sama_1838: TonB-dependent receptor
*
Shewanella loihica PV-4

Site:
position = -308
score = 5.09145
sequence = TTTTGTGATAATGGTCACACTT

Gene: Shew_2074: TonB-dependent receptor
 
Shewanella pealeana ATCC 700345
*
Shewanella halifaxensis HAW-EB4

Site:
position = -199
score = 4.10655
sequence = ACTTGTGCTGTTTGTCACAATG

Site:
position = -306
score = 5.46305
sequence = AATTGTGATGCGCGTCACAATT

Gene: Shal_1923: TonB-dependent receptor
*
Shewanella piezotolerans WP3

Site:
position = -310
score = 4.66904
sequence = AAGCGTGACCTGTGTCACACTT

Gene: swp_2362: TonB-dependent receptor
*
Shewanella sediminis HAW-EB3

Site:
position = -316
score = 4.61719
sequence = TTTCGTGACGCGCGTCACAGTT

Gene: Ssed_2036: TonB-dependent receptor
*
Shewanella woodyi ATCC 51908

Site:
position = -321
score = 4.8704
sequence = TTCTGTGACCTGTGTCACAAAA

Gene: Swoo_2565: TonB-dependent receptor
TonB-dependent receptor
 
CRON 41.
SO1388
*
Shewanella oneidensis MR-1

Site:
position = -232
score = 4.12802
sequence = TTGAGTGATAAAGCTAACAGTT

Gene: SO1388: Xaa-Pro aminopeptidase (EC 3.4.11.9)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1198: Xaa-Pro aminopeptidase (EC 3.4.11.9)
 
Shewanella sp W3-18-1

Gene: Sputw3181_2966: Xaa-Pro aminopeptidase (EC 3.4.11.9)
*
Shewanella sp ANA-3

Site:
position = -233
score = 4.15463
sequence = CTGAGTGATAAAGATAACATTT

Gene: Shewana3_2986: Xaa-Pro aminopeptidase (EC 3.4.11.9)
*
Shewanella sp MR-4

Site:
position = -233
score = 4.15463
sequence = CTGAGTGATAAAGATAACATTT

Gene: Shewmr4_2807: Xaa-Pro aminopeptidase (EC 3.4.11.9)
*
Shewanella sp MR-7

Site:
position = -233
score = 4.53228
sequence = TTGAGTGATAAAGATAACATTT

Gene: Shewmr7_2890: Xaa-Pro aminopeptidase (EC 3.4.11.9)
*
Shewanella baltica OS155

Site:
position = -234
score = 4.18258
sequence = TTTTATGCTAAGAATCACACAA

Gene: Sbal_3085: Xaa-Pro aminopeptidase (EC 3.4.11.9)
*
Shewanella denitrificans OS217

Site:
position = -161
score = 3.69078
sequence = TATTGTATACAATATCACGTTA

Gene: Sden_0887: Xaa-Pro aminopeptidase (EC 3.4.11.9)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3047: Xaa-Pro aminopeptidase (EC 3.4.11.9)
 
Shewanella amazonensis SB2B

Gene: Sama_0684: Xaa-Pro aminopeptidase (EC 3.4.11.9)
 
Shewanella loihica PV-4

Gene: Shew_0952: Xaa-Pro aminopeptidase (EC 3.4.11.9)
 
Shewanella pealeana ATCC 700345

Gene: Spea_0920: Xaa-Pro aminopeptidase (EC 3.4.11.9)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0972: Xaa-Pro aminopeptidase (EC 3.4.11.9)
 
Shewanella piezotolerans WP3

Gene: swp_4202: Xaa-Pro aminopeptidase (EC 3.4.11.9)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1024: Xaa-Pro aminopeptidase (EC 3.4.11.9)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1096: Xaa-Pro aminopeptidase (EC 3.4.11.9)
Xaa-Pro aminopeptidase (EC 3.4.11.9)
 
CRON 42.
napD
*
Shewanella oneidensis MR-1

Site:
position = -150
score = 3.89406
sequence = AACTTTGATCCCGATCGACTAT

Site:
position = -260
score = 3.931
sequence = TAATGTGATTGGTATAAACCTC

Gene: SO0849: periplasmic nitrate reductase component NapD
*
Shewanella putrefaciens CN-32

Site:
position = -147
score = 3.89406
sequence = AACTTTGATCCCGATCGACTAT

Gene: Sputcn32_3147: periplasmic nitrate reductase component NapD
*
Shewanella sp W3-18-1

Site:
position = -147
score = 3.89406
sequence = AACTTTGATCCCGATCGACTAT

Gene: Sputw3181_0796: periplasmic nitrate reductase component NapD
*
Shewanella sp ANA-3

Site:
position = -149
score = 3.89406
sequence = AACTTTGATCCCGATCGACTAT

Gene: Shewana3_3429: periplasmic nitrate reductase component NapD
*
Shewanella sp MR-4

Site:
position = -149
score = 3.89406
sequence = AACTTTGATCCCGATCGACTAT

Gene: Shewmr4_0705: periplasmic nitrate reductase component NapD
*
Shewanella sp MR-7

Site:
position = -149
score = 3.89406
sequence = AACTTTGATCCCGATCGACTAT

Gene: Shewmr7_3317: periplasmic nitrate reductase component NapD
*
Shewanella baltica OS155

Site:
position = -150
score = 3.98279
sequence = AACTTTGATCCGGATCGACTAT

Gene: Sbal_3510: periplasmic nitrate reductase component NapD
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_2982: periplasmic nitrate reductase component NapD
*
Shewanella loihica PV-4

Site:
position = -154
score = 3.77479
sequence = AACTTTGATCTCGATCTACAAA

Gene: Shew_3205: periplasmic nitrate reductase component NapD
*
Shewanella pealeana ATCC 700345

Site:
position = -173
score = 4.2894
sequence = ATTTGTGAACTAGATCAACACT

Gene: Spea_0624: periplasmic nitrate reductase component NapD
*
Shewanella halifaxensis HAW-EB4

Site:
position = -174
score = 4.1821
sequence = ATCTGTGAATCAGATCACCATG

Gene: Shal_0716: periplasmic nitrate reductase component NapD
 
Shewanella piezotolerans WP3

Gene: swp_4456: periplasmic nitrate reductase component NapD
*
Shewanella sediminis HAW-EB3

Site:
position = -187
score = 4.11887
sequence = ATCTGAGACATAGGTCACACAT

Gene: Ssed_3956: periplasmic nitrate reductase component NapD
*
Shewanella woodyi ATCC 51908

Site:
position = -179
score = 4.43727
sequence = AAATGTGAACTCCATCACGCAC

Site:
position = -155
score = 3.92295
sequence = AATATTGATCTTGATCGACTAA

Gene: Swoo_4109: periplasmic nitrate reductase component NapD
periplasmic nitrate reductase component NapD
napA
 
Shewanella oneidensis MR-1

Gene: SO0848: periplasmic nitrate reductase precursor (EC 1.7.99.4)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3148: periplasmic nitrate reductase precursor (EC 1.7.99.4)
 
Shewanella sp W3-18-1

Gene: Sputw3181_0795: periplasmic nitrate reductase precursor (EC 1.7.99.4)
 
Shewanella sp ANA-3

Gene: Shewana3_3430: periplasmic nitrate reductase precursor (EC 1.7.99.4)
 
Shewanella sp MR-4

Gene: Shewmr4_0704: periplasmic nitrate reductase precursor (EC 1.7.99.4)
 
Shewanella sp MR-7

Gene: Shewmr7_3318: periplasmic nitrate reductase precursor (EC 1.7.99.4)
 
Shewanella baltica OS155

Gene: Sbal_3511: periplasmic nitrate reductase precursor (EC 1.7.99.4)
 
Shewanella denitrificans OS217
*
Shewanella frigidimarina NCIMB 400

Site:
position = -142
score = 4.27412
sequence = AAATGTGACCTTGCACAACTAT

Site:
position = -166
score = 4.2351
sequence = AAATGAGATTTACATCACGCTG

Gene: Sfri_0553: periplasmic nitrate reductase precursor (EC 1.7.99.4)
 
Shewanella amazonensis SB2B

Gene: Sama_2983: periplasmic nitrate reductase precursor (EC 1.7.99.4)
 
Shewanella loihica PV-4

Gene: Shew_3206: periplasmic nitrate reductase precursor (EC 1.7.99.4)
 
Shewanella pealeana ATCC 700345

Gene: Spea_0623: periplasmic nitrate reductase precursor (EC 1.7.99.4)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0715: periplasmic nitrate reductase precursor (EC 1.7.99.4)
 
Shewanella piezotolerans WP3

Gene: swp_4457: periplasmic nitrate reductase precursor (EC 1.7.99.4)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_3957: periplasmic nitrate reductase precursor (EC 1.7.99.4)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_4110: periplasmic nitrate reductase precursor (EC 1.7.99.4)
periplasmic nitrate reductase precursor (EC 1.7.99.4)
napG
 
Shewanella oneidensis MR-1

Gene: SO0847: ferredoxin-type protein NapG (periplasmic nitrate reductase)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3149: ferredoxin-type protein NapG (periplasmic nitrate reductase)
 
Shewanella sp W3-18-1

Gene: Sputw3181_0794: ferredoxin-type protein NapG (periplasmic nitrate reductase)
 
Shewanella sp ANA-3

Gene: Shewana3_3431: ferredoxin-type protein NapG (periplasmic nitrate reductase)
 
Shewanella sp MR-4

Gene: Shewmr4_0703: ferredoxin-type protein NapG (periplasmic nitrate reductase)
 
Shewanella sp MR-7

Gene: Shewmr7_3319: ferredoxin-type protein NapG (periplasmic nitrate reductase)
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_2984: ferredoxin-type protein NapG (periplasmic nitrate reductase)
 
Shewanella loihica PV-4

Gene: Shew_3207: ferredoxin-type protein NapG (periplasmic nitrate reductase)
 
Shewanella pealeana ATCC 700345

Gene: Spea_0622: ferredoxin-type protein NapG (periplasmic nitrate reductase)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0714: ferredoxin-type protein NapG (periplasmic nitrate reductase)
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3

Gene: Ssed_3958: ferredoxin-type protein NapG (periplasmic nitrate reductase)
 
Shewanella woodyi ATCC 51908
ferredoxin-type protein NapG (periplasmic nitrate reductase)
napH
 
Shewanella oneidensis MR-1

Gene: SO0846: polyferredoxin NapH (periplasmic nitrate reductase)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3150: polyferredoxin NapH (periplasmic nitrate reductase)
 
Shewanella sp W3-18-1

Gene: Sputw3181_0793: polyferredoxin NapH (periplasmic nitrate reductase)
 
Shewanella sp ANA-3

Gene: Shewana3_3432: polyferredoxin NapH (periplasmic nitrate reductase)
 
Shewanella sp MR-4

Gene: Shewmr4_0702: polyferredoxin NapH (periplasmic nitrate reductase)
 
Shewanella sp MR-7

Gene: Shewmr7_3320: polyferredoxin NapH (periplasmic nitrate reductase)
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_2985: polyferredoxin NapH (periplasmic nitrate reductase)
 
Shewanella loihica PV-4

Gene: Shew_3208: polyferredoxin NapH (periplasmic nitrate reductase)
 
Shewanella pealeana ATCC 700345

Gene: Spea_0621: polyferredoxin NapH (periplasmic nitrate reductase)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0713: polyferredoxin NapH (periplasmic nitrate reductase)
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3

Gene: Ssed_3959: polyferredoxin NapH (periplasmic nitrate reductase)
 
Shewanella woodyi ATCC 51908
polyferredoxin NapH (periplasmic nitrate reductase)
napB
 
Shewanella oneidensis MR-1

Gene: SO0845: nitrate reductase cytochrome c550-type subunit
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3151: nitrate reductase cytochrome c550-type subunit
 
Shewanella sp W3-18-1

Gene: Sputw3181_0792: nitrate reductase cytochrome c550-type subunit
 
Shewanella sp ANA-3

Gene: Shewana3_3433: nitrate reductase cytochrome c550-type subunit
 
Shewanella sp MR-4

Gene: Shewmr4_0701: nitrate reductase cytochrome c550-type subunit
 
Shewanella sp MR-7

Gene: Shewmr7_3321: nitrate reductase cytochrome c550-type subunit
 
Shewanella baltica OS155

Gene: Sbal_3512: nitrate reductase cytochrome c550-type subunit
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0552: nitrate reductase cytochrome c550-type subunit
 
Shewanella amazonensis SB2B

Gene: Sama_2986: nitrate reductase cytochrome c550-type subunit
 
Shewanella loihica PV-4

Gene: Shew_3209: nitrate reductase cytochrome c550-type subunit
 
Shewanella pealeana ATCC 700345

Gene: Spea_0620: nitrate reductase cytochrome c550-type subunit
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0712: nitrate reductase cytochrome c550-type subunit
 
Shewanella piezotolerans WP3

Gene: swp_4458: nitrate reductase cytochrome c550-type subunit
 
Shewanella sediminis HAW-EB3

Gene: Ssed_3960: nitrate reductase cytochrome c550-type subunit
 
Shewanella woodyi ATCC 51908

Gene: Swoo_4111: nitrate reductase cytochrome c550-type subunit
nitrate reductase cytochrome c550-type subunit
 
CRON 43.
fadI
*
Shewanella oneidensis MR-1

Site:
position = -131
score = 3.87355
sequence = AAGTTAGAATCAGATCACACTT

Gene: SO3089: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
*
Shewanella putrefaciens CN-32

Site:
position = -136
score = 3.87355
sequence = AAGTTAGAATCAGATCACACTT

Gene: Sputcn32_2460: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
*
Shewanella sp W3-18-1

Site:
position = -136
score = 3.87355
sequence = AAGTTAGAATCAGATCACACTT

Gene: Sputw3181_1548: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
*
Shewanella sp ANA-3

Site:
position = -135
score = 3.87355
sequence = AAGTTAGAATCAGATCACACTT

Gene: Shewana3_1460: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
*
Shewanella sp MR-4

Site:
position = -135
score = 3.87355
sequence = AAGTTAGAATCAGATCACACTT

Gene: Shewmr4_1407: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
*
Shewanella sp MR-7

Site:
position = -135
score = 3.87355
sequence = AAGTTAGAATCAGATCACACTT

Gene: Shewmr7_1472: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
*
Shewanella baltica OS155

Site:
position = -136
score = 3.87355
sequence = AAGTTAGAATCAGATCACACTT

Gene: Sbal_2761: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
*
Shewanella denitrificans OS217

Site:
position = -109
score = 3.87355
sequence = AAGTTAGAATCAGATCACACTT

Gene: Sden_1529: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
*
Shewanella frigidimarina NCIMB 400

Site:
position = -104
score = 3.87355
sequence = AAGTTAGAATCAGATCACACTT

Gene: Sfri_2677: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
*
Shewanella amazonensis SB2B

Site:
position = -112
score = 3.61813
sequence = AAGTTAGAATCGGGTCACACTT

Gene: Sama_2168: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
*
Shewanella loihica PV-4

Site:
position = -134
score = 3.87355
sequence = AAGTTAGAATCAGATCACACTT

Gene: Shew_2426: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
*
Shewanella pealeana ATCC 700345

Site:
position = -116
score = 3.87355
sequence = AAGTTAGAATCAGATCACACTT

Gene: Spea_2599: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -119
score = 3.87355
sequence = AAGTTAGAATCAGATCACACTT

Gene: Shal_2671: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
*
Shewanella piezotolerans WP3

Site:
position = -122
score = 3.87355
sequence = AAGTTAGAATCAGATCACACTT

Gene: swp_3140: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
*
Shewanella sediminis HAW-EB3

Site:
position = -151
score = 3.87355
sequence = AAGTTAGAATCAGATCACACTT

Gene: Ssed_1628: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
*
Shewanella woodyi ATCC 51908

Site:
position = -138
score = 4.0711
sequence = AAGTTAGAATCAGATCACATTT

Gene: Swoo_3027: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
3-ketoacyl-CoA thiolase (EC 2.3.1.16)
fadJ
 
Shewanella oneidensis MR-1

Gene: SO3088: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2459: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Shewanella sp W3-18-1

Gene: Sputw3181_1549: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Shewanella sp ANA-3

Gene: Shewana3_1461: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Shewanella sp MR-4

Gene: Shewmr4_1408: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Shewanella sp MR-7

Gene: Shewmr7_1473: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Shewanella baltica OS155

Gene: Sbal_2760: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Shewanella denitrificans OS217

Gene: Sden_1530: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2676: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Shewanella amazonensis SB2B

Gene: Sama_2167: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Shewanella loihica PV-4

Gene: Shew_2425: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Shewanella pealeana ATCC 700345

Gene: Spea_2598: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2670: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Shewanella piezotolerans WP3

Gene: swp_3139: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1629: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3026: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
CRON 44.
SO4606
*
Shewanella oneidensis MR-1

Site:
position = -317
score = 4.22767
sequence = AGAAGTGATCTTGATCAATTTT

Gene: SO4606: cytochrome c oxidase polypeptide II (EC 1.9.3.1)
*
Shewanella putrefaciens CN-32

Site:
position = -309
score = 4.39313
sequence = ATAAGTGATCTTGATCAATATT

Gene: Sputcn32_3782: cytochrome c oxidase polypeptide II (EC 1.9.3.1)
*
Shewanella sp W3-18-1

Site:
position = -309
score = 4.39313
sequence = ATAAGTGATCTTGATCAATATT

Gene: Sputw3181_0133: cytochrome c oxidase polypeptide II (EC 1.9.3.1)
*
Shewanella sp ANA-3

Site:
position = -318
score = 4.22767
sequence = AGAAGTGATCTTGATCAATTTT

Gene: Shewana3_3991: cytochrome c oxidase polypeptide II (EC 1.9.3.1)
*
Shewanella sp MR-4

Site:
position = -318
score = 4.22767
sequence = AGAAGTGATCTTGATCAATTTT

Gene: Shewmr4_3791: cytochrome c oxidase polypeptide II (EC 1.9.3.1)
*
Shewanella sp MR-7

Site:
position = -317
score = 4.22767
sequence = AGAAGTGATCTTGATCAATTTT

Gene: Shewmr7_3864: cytochrome c oxidase polypeptide II (EC 1.9.3.1)
*
Shewanella baltica OS155

Site:
position = -317
score = 4.39313
sequence = ATAAGTGATCTTGATCAATATT

Gene: Sbal_0154: cytochrome c oxidase polypeptide II (EC 1.9.3.1)
*
Shewanella denitrificans OS217

Site:
position = -316
score = 4.4423
sequence = AAAAGTGATCTTGATCAATATT

Gene: Sden_3517: cytochrome c oxidase polypeptide II (EC 1.9.3.1)
*
Shewanella frigidimarina NCIMB 400

Site:
position = -321
score = 3.85098
sequence = CAAAGTGATCTTGATCAATGTT

Gene: Sfri_0258: cytochrome c oxidase polypeptide II (EC 1.9.3.1)
*
Shewanella amazonensis SB2B

Site:
position = -318
score = 4.44888
sequence = TAAAGTGATCTTGATCAATATT

Gene: Sama_3483: cytochrome c oxidase polypeptide II (EC 1.9.3.1)
*
Shewanella loihica PV-4

Site:
position = -321
score = 4.4423
sequence = AAAAGTGATCTTGATCAATATT

Site:
position = -264
score = 4.04584
sequence = TTATTTGTTATATCGCACAATT

Gene: Shew_0125: cytochrome c oxidase polypeptide II (EC 1.9.3.1)
 
Shewanella pealeana ATCC 700345

Gene: Spea_3999: cytochrome c oxidase polypeptide II (EC 1.9.3.1)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0258: cytochrome c oxidase polypeptide II (EC 1.9.3.1)
 
Shewanella piezotolerans WP3

Gene: swp_4823: cytochrome c oxidase polypeptide II (EC 1.9.3.1)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_0198: cytochrome c oxidase polypeptide II (EC 1.9.3.1)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0178: cytochrome c oxidase polypeptide II (EC 1.9.3.1)
cytochrome c oxidase polypeptide II (EC 1.9.3.1)
SO4607
 
Shewanella oneidensis MR-1

Gene: SO4607: cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3783: cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Shewanella sp W3-18-1

Gene: Sputw3181_0132: cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Shewanella sp ANA-3

Gene: Shewana3_3992: cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Shewanella sp MR-4

Gene: Shewmr4_3792: cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Shewanella sp MR-7

Gene: Shewmr7_3865: cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Shewanella baltica OS155

Gene: Sbal_0153: cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Shewanella denitrificans OS217

Gene: Sden_3518: cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0257: cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Shewanella amazonensis SB2B

Gene: Sama_3484: cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Shewanella loihica PV-4

Gene: Shew_0124: cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Shewanella pealeana ATCC 700345

Gene: Spea_4000: cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0257: cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Shewanella piezotolerans WP3

Gene: swp_4824: cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_0197: cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0177: cytochrome c oxidase polypeptide I (EC 1.9.3.1)
cytochrome c oxidase polypeptide I (EC 1.9.3.1)
coxG
 
Shewanella oneidensis MR-1

Gene: SO4608: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3784: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Shewanella sp W3-18-1

Gene: Sputw3181_0131: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Shewanella sp ANA-3

Gene: Shewana3_3993: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Shewanella sp MR-4

Gene: Shewmr4_3793: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Shewanella sp MR-7

Gene: Shewmr7_3866: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Shewanella baltica OS155

Gene: Sbal_0152: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Shewanella denitrificans OS217

Gene: Sden_3519: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0256: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Shewanella amazonensis SB2B

Gene: Sama_3485: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Shewanella loihica PV-4

Gene: Shew_0123: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Shewanella pealeana ATCC 700345

Gene: Spea_4001: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0256: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Shewanella piezotolerans WP3

Gene: swp_4825: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Shewanella sediminis HAW-EB3

Gene: Ssed_0196: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0176: cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
SO4609
 
Shewanella oneidensis MR-1

Gene: SO4609: cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3785: cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Shewanella sp W3-18-1

Gene: Sputw3181_0130: cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Shewanella sp ANA-3

Gene: Shewana3_3994: cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Shewanella sp MR-4

Gene: Shewmr4_3794: cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Shewanella sp MR-7

Gene: Shewmr7_3867: cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Shewanella baltica OS155

Gene: Sbal_0151: cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Shewanella denitrificans OS217

Gene: Sden_3520: cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0255: cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Shewanella amazonensis SB2B

Gene: Sama_3486: cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Shewanella loihica PV-4

Gene: Shew_0122: cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Shewanella pealeana ATCC 700345

Gene: Spea_4002: cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0255: cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Shewanella piezotolerans WP3

Gene: swp_4826: cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_0195: cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0175: cytochrome c oxidase polypeptide III (EC 1.9.3.1)
cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
CRON 45.
hemG
 
Shewanella oneidensis MR-1

Gene: SO3720: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
*
Shewanella putrefaciens CN-32

Site:
position = -207
score = 4.47294
sequence = TTTTGTGAGCAAGCTAAAATTA

Site:
position = -135
score = 3.91378
sequence = AATTGATATTTAAATCACCTAG

Gene: Sputcn32_3038: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
*
Shewanella sp W3-18-1

Site:
position = -207
score = 4.47294
sequence = TTTTGTGAGCAAGCTAAAATTA

Site:
position = -135
score = 3.91378
sequence = AATTGATATTTAAATCACCTAG

Gene: Sputw3181_0907: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
*
Shewanella sp ANA-3

Site:
position = -317
score = 4.12352
sequence = TTTTGTGAGCAAGCTAGAATTA

Gene: Shewana3_0871: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
*
Shewanella sp MR-4

Site:
position = -320
score = 4.12352
sequence = TTTTGTGAGCAAGCTAGAATTA

Gene: Shewmr4_3066: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
*
Shewanella sp MR-7

Site:
position = -318
score = 4.12352
sequence = TTTTGTGAGCAAGCTAGAATTA

Gene: Shewmr7_0906: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
*
Shewanella baltica OS155

Site:
position = -316
score = 4.36986
sequence = TTTTGTGAGACAGTTAAAACTA

Gene: Sbal_3400: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
 
Shewanella denitrificans OS217
*
Shewanella frigidimarina NCIMB 400

Site:
position = -144
score = 4.02008
sequence = TTTTGCGCGGCAGTTCACATTG

Site:
position = -83
score = 4.36624
sequence = TGACGTGATCTGTTTCATGTAA

Gene: Sfri_0813: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
*
Shewanella amazonensis SB2B

Site:
position = -130
score = 3.89764
sequence = AAATGTGAGGCAGTTGGAATTT

Gene: Sama_2882: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
*
Shewanella loihica PV-4

Site:
position = -126
score = 4.09954
sequence = ATTTGTGACATCGGTAAACTTA

Gene: Shew_0678: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
*
Shewanella pealeana ATCC 700345

Site:
position = -140
score = 4.01337
sequence = TTTTGTGAGGTAGGTAAAGCTA

Site:
position = -98
score = 3.77917
sequence = CCTCGTGATCTGTTTCATGTAA

Gene: Spea_0673: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -139
score = 4.01337
sequence = TTTTGTGAGGTAGGTAAAGCTA

Site:
position = -97
score = 3.77917
sequence = CCTCGTGATCTGTTTCATGTAA

Gene: Shal_3525: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
*
Shewanella piezotolerans WP3

Site:
position = -124
score = 3.90822
sequence = TTTTGTGAGGTAGGTAAAGGTA

Site:
position = -77
score = 3.72591
sequence = TGATCTGATTCAATTAAAAATA

Gene: swp_4046: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
*
Shewanella sediminis HAW-EB3

Site:
position = -120
score = 4.85366
sequence = ATTTGTGATGCAGGTAAAATTT

Site:
position = -78
score = 3.99272
sequence = TGCCGTGATCTGTTTCATGTAA

Gene: Ssed_3790: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
*
Shewanella woodyi ATCC 51908

Site:
position = -123
score = 4.31185
sequence = AATTGTGATATAGGTAAGAGTA

Gene: Swoo_0793: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
SO3719
 
Shewanella oneidensis MR-1

Gene: SO3719: hypothetical protein
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3037: hypothetical protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_0908: hypothetical protein
 
Shewanella sp ANA-3

Gene: Shewana3_0872: hypothetical protein
 
Shewanella sp MR-4

Gene: Shewmr4_3065: hypothetical protein
 
Shewanella sp MR-7

Gene: Shewmr7_0907: hypothetical protein
 
Shewanella baltica OS155

Gene: Sbal_3399: hypothetical protein
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0814: hypothetical protein
 
Shewanella amazonensis SB2B

Gene: Sama_2881: hypothetical protein
 
Shewanella loihica PV-4

Gene: Shew_0679: hypothetical protein
 
Shewanella pealeana ATCC 700345

Gene: Spea_0674: hypothetical protein
*2
Shewanella halifaxensis HAW-EB4

Gene: Shal_3524: hypothetical protein

Site:
position = -235
score = 5.33461
sequence = AAGTGTGATATCGCTCACAAAA

Gene: Shal_2707: hypothetical protein
 
Shewanella piezotolerans WP3

Gene: swp_4045: hypothetical protein
 
Shewanella sediminis HAW-EB3

Gene: Ssed_3789: hypothetical protein
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0794: hypothetical protein
hypothetical protein
 
CRON 46.
moaA
*
Shewanella oneidensis MR-1

Site:
position = -220
score = 3.80214
sequence = TTGGGTGAGCACTGTCACAGAT

Gene: SO4452: molybdenum cofactor biosynthesis protein MoaA
*
Shewanella putrefaciens CN-32

Site:
position = -187
score = 3.77281
sequence = TTGGGTGAGGACTGTCACAGAT

Gene: Sputcn32_0389: molybdenum cofactor biosynthesis protein MoaA
*
Shewanella sp W3-18-1

Site:
position = -187
score = 3.77281
sequence = TTGGGTGAGGACTGTCACAGAT

Gene: Sputw3181_0243: molybdenum cofactor biosynthesis protein MoaA
*
Shewanella sp ANA-3

Site:
position = -187
score = 3.80214
sequence = TTGGGTGAGCACTGTCACAGAT

Gene: Shewana3_0274: molybdenum cofactor biosynthesis protein MoaA
*
Shewanella sp MR-4

Site:
position = -187
score = 3.89034
sequence = TTGGGTGAGCGCTGTCACAGTT

Gene: Shewmr4_0273: molybdenum cofactor biosynthesis protein MoaA
*
Shewanella sp MR-7

Site:
position = -187
score = 3.89034
sequence = TTGGGTGAGCGCTGTCACAGTT

Gene: Shewmr7_3748: molybdenum cofactor biosynthesis protein MoaA
*
Shewanella baltica OS155

Site:
position = -187
score = 3.97727
sequence = TTAGGTGAGGACTGTCACAGAT

Gene: Sbal_0284: molybdenum cofactor biosynthesis protein MoaA
*
Shewanella denitrificans OS217

Site:
position = -186
score = 4.27953
sequence = TGAGGTGAGCTGTGTCACAAAA

Gene: Sden_0101: molybdenum cofactor biosynthesis protein MoaA
*
Shewanella frigidimarina NCIMB 400

Site:
position = -186
score = 4.46278
sequence = TAGCGTGAGTCGAGTCACAAAT

Gene: Sfri_0082: molybdenum cofactor biosynthesis protein MoaA
*
Shewanella amazonensis SB2B

Site:
position = -180
score = 3.98696
sequence = CTGAGTGAGCGGCGTCACAATT

Gene: Sama_3524: molybdenum cofactor biosynthesis protein MoaA
*
Shewanella loihica PV-4

Site:
position = -189
score = 4.39672
sequence = CTTCGTGAGCGGTGTCACATTA

Gene: Shew_0087: molybdenum cofactor biosynthesis protein MoaA
*
Shewanella pealeana ATCC 700345

Site:
position = -222
score = 4.1207
sequence = TGCCGTGATAACTGTCACAAAA

Gene: Spea_4120: molybdenum cofactor biosynthesis protein MoaA
*
Shewanella halifaxensis HAW-EB4

Site:
position = -222
score = 4.28976
sequence = TGGCGTGATAACTGTCACAAAA

Gene: Shal_0122: molybdenum cofactor biosynthesis protein MoaA
*
Shewanella piezotolerans WP3

Site:
position = -222
score = 4.28877
sequence = TGAGGTGATTAGTGTCACAAAA

Gene: swp_5009: molybdenum cofactor biosynthesis protein MoaA
*
Shewanella sediminis HAW-EB3

Site:
position = -221
score = 4.36273
sequence = GTATGTGAGGGGTGTCACAAAA

Gene: Ssed_4402: molybdenum cofactor biosynthesis protein MoaA
*
Shewanella woodyi ATCC 51908

Site:
position = -222
score = 4.25203
sequence = GAATGTGAGTGTCGTCACAAAA

Gene: Swoo_4793: molybdenum cofactor biosynthesis protein MoaA
molybdenum cofactor biosynthesis protein MoaA
moaB
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_3525: molybdenum cofactor biosynthesis protein MoaB
 
Shewanella loihica PV-4

Gene: Shew_0088: molybdenum cofactor biosynthesis protein MoaB
 
Shewanella pealeana ATCC 700345

Gene: Spea_4119: molybdenum cofactor biosynthesis protein MoaB
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0123: molybdenum cofactor biosynthesis protein MoaB
 
Shewanella piezotolerans WP3

Gene: swp_5008: molybdenum cofactor biosynthesis protein MoaB
 
Shewanella sediminis HAW-EB3

Gene: Ssed_4401: molybdenum cofactor biosynthesis protein MoaB
 
Shewanella woodyi ATCC 51908

Gene: Swoo_4792: molybdenum cofactor biosynthesis protein MoaB
molybdenum cofactor biosynthesis protein MoaB
moaC
 
Shewanella oneidensis MR-1

Gene: SO4451: molybdenum cofactor biosynthesis protein MoaC
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0390: molybdenum cofactor biosynthesis protein MoaC
 
Shewanella sp W3-18-1

Gene: Sputw3181_0244: molybdenum cofactor biosynthesis protein MoaC
 
Shewanella sp ANA-3

Gene: Shewana3_0275: molybdenum cofactor biosynthesis protein MoaC
 
Shewanella sp MR-4

Gene: Shewmr4_0274: molybdenum cofactor biosynthesis protein MoaC
 
Shewanella sp MR-7

Gene: Shewmr7_3747: molybdenum cofactor biosynthesis protein MoaC
 
Shewanella baltica OS155

Gene: Sbal_0285: molybdenum cofactor biosynthesis protein MoaC
 
Shewanella denitrificans OS217

Gene: Sden_0102: molybdenum cofactor biosynthesis protein MoaC
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0083: molybdenum cofactor biosynthesis protein MoaC
 
Shewanella amazonensis SB2B

Gene: Sama_3526: molybdenum cofactor biosynthesis protein MoaC
 
Shewanella loihica PV-4

Gene: Shew_0089: molybdenum cofactor biosynthesis protein MoaC
 
Shewanella pealeana ATCC 700345

Gene: Spea_4118: molybdenum cofactor biosynthesis protein MoaC
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0124: molybdenum cofactor biosynthesis protein MoaC
 
Shewanella piezotolerans WP3

Gene: swp_5007: molybdenum cofactor biosynthesis protein MoaC
 
Shewanella sediminis HAW-EB3

Gene: Ssed_4400: molybdenum cofactor biosynthesis protein MoaC
 
Shewanella woodyi ATCC 51908

Gene: Swoo_4791: molybdenum cofactor biosynthesis protein MoaC
molybdenum cofactor biosynthesis protein MoaC
moaD
 
Shewanella oneidensis MR-1

Gene: SO4450: molybdenum cofactor biosynthesis protein MoaD
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0391: molybdenum cofactor biosynthesis protein MoaD
 
Shewanella sp W3-18-1

Gene: Sputw3181_0245: molybdenum cofactor biosynthesis protein MoaD
 
Shewanella sp ANA-3

Gene: Shewana3_0276: molybdenum cofactor biosynthesis protein MoaD
 
Shewanella sp MR-4

Gene: Shewmr4_0275: molybdenum cofactor biosynthesis protein MoaD
 
Shewanella sp MR-7

Gene: Shewmr7_3746: molybdenum cofactor biosynthesis protein MoaD
 
Shewanella baltica OS155

Gene: Sbal_0286: molybdenum cofactor biosynthesis protein MoaD
 
Shewanella denitrificans OS217

Gene: Sden_0103: molybdenum cofactor biosynthesis protein MoaD
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0084: molybdenum cofactor biosynthesis protein MoaD
 
Shewanella amazonensis SB2B

Gene: Sama_3527: molybdenum cofactor biosynthesis protein MoaD
 
Shewanella loihica PV-4

Gene: Shew_0090: molybdenum cofactor biosynthesis protein MoaD
 
Shewanella pealeana ATCC 700345

Gene: Spea_4117: molybdenum cofactor biosynthesis protein MoaD
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0125: molybdenum cofactor biosynthesis protein MoaD
 
Shewanella piezotolerans WP3

Gene: swp_5006: molybdenum cofactor biosynthesis protein MoaD
 
Shewanella sediminis HAW-EB3

Gene: Ssed_4399: molybdenum cofactor biosynthesis protein MoaD
 
Shewanella woodyi ATCC 51908

Gene: Swoo_4790: molybdenum cofactor biosynthesis protein MoaD
molybdenum cofactor biosynthesis protein MoaD
moaE
 
Shewanella oneidensis MR-1

Gene: SO4449: molybdenum cofactor biosynthesis protein MoaE
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0392: molybdenum cofactor biosynthesis protein MoaE
 
Shewanella sp W3-18-1

Gene: Sputw3181_0246: molybdenum cofactor biosynthesis protein MoaE
 
Shewanella sp ANA-3

Gene: Shewana3_0277: molybdenum cofactor biosynthesis protein MoaE
 
Shewanella sp MR-4

Gene: Shewmr4_0276: molybdenum cofactor biosynthesis protein MoaE
 
Shewanella sp MR-7

Gene: Shewmr7_3745: molybdenum cofactor biosynthesis protein MoaE
 
Shewanella baltica OS155

Gene: Sbal_0287: molybdenum cofactor biosynthesis protein MoaE
 
Shewanella denitrificans OS217

Gene: Sden_0104: molybdenum cofactor biosynthesis protein MoaE
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0085: molybdenum cofactor biosynthesis protein MoaE
 
Shewanella amazonensis SB2B

Gene: Sama_3528: molybdenum cofactor biosynthesis protein MoaE
 
Shewanella loihica PV-4

Gene: Shew_0091: molybdenum cofactor biosynthesis protein MoaE
 
Shewanella pealeana ATCC 700345

Gene: Spea_4116: molybdenum cofactor biosynthesis protein MoaE
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0126: molybdenum cofactor biosynthesis protein MoaE
 
Shewanella piezotolerans WP3

Gene: swp_5005: molybdenum cofactor biosynthesis protein MoaE
 
Shewanella sediminis HAW-EB3

Gene: Ssed_4398: molybdenum cofactor biosynthesis protein MoaE
 
Shewanella woodyi ATCC 51908

Gene: Swoo_4789: molybdenum cofactor biosynthesis protein MoaE
molybdenum cofactor biosynthesis protein MoaE
modA
 
Shewanella oneidensis MR-1

Gene: SO4448: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0393: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)
 
Shewanella sp W3-18-1

Gene: Sputw3181_0247: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)
 
Shewanella sp ANA-3

Gene: Shewana3_0278: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)
 
Shewanella sp MR-4

Gene: Shewmr4_0277: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)
 
Shewanella sp MR-7

Gene: Shewmr7_3744: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)
 
Shewanella baltica OS155

Gene: Sbal_0288: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)
 
Shewanella denitrificans OS217

Gene: Sden_0105: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0086: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)
 
Shewanella amazonensis SB2B

Gene: Sama_3529: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)
 
Shewanella loihica PV-4

Gene: Shew_0092: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)
 
Shewanella pealeana ATCC 700345

Gene: Spea_4115: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0127: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)
 
Shewanella piezotolerans WP3

Gene: swp_5004: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_4397: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_4788: molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)
molybdenum ABC transporter, substrate-binding protein (TC 3.A.1.8.1)
modB
 
Shewanella oneidensis MR-1

Gene: SO4447: molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0394: molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Shewanella sp W3-18-1

Gene: Sputw3181_0248: molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Shewanella sp ANA-3

Gene: Shewana3_0279: molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Shewanella sp MR-4

Gene: Shewmr4_0278: molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Shewanella sp MR-7

Gene: Shewmr7_3743: molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Shewanella baltica OS155

Gene: Sbal_0289: molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Shewanella denitrificans OS217

Gene: Sden_0106: molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0087: molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Shewanella amazonensis SB2B

Gene: Sama_3530: molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Shewanella loihica PV-4

Gene: Shew_0093: molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Shewanella pealeana ATCC 700345

Gene: Spea_4114: molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0128: molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Shewanella piezotolerans WP3

Gene: swp_5002: molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_4396: molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_4787: molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
modC
 
Shewanella oneidensis MR-1

Gene: SO4446: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0395: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Shewanella sp W3-18-1

Gene: Sputw3181_0249: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Shewanella sp ANA-3

Gene: Shewana3_0280: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Shewanella sp MR-4

Gene: Shewmr4_0279: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Shewanella sp MR-7

Gene: Shewmr7_3742: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Shewanella baltica OS155

Gene: Sbal_0290: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Shewanella denitrificans OS217

Gene: Sden_0107: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0088: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Shewanella amazonensis SB2B

Gene: Sama_3531: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Shewanella loihica PV-4

Gene: Shew_0094: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Shewanella pealeana ATCC 700345

Gene: Spea_4113: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0129: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Shewanella piezotolerans WP3

Gene: swp_5001: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_4395: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_4786: molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
CRON 47.
Shewana3_0095
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
*
Shewanella sp ANA-3

Site:
position = -80
score = 4.84948
sequence = AAATTTGAGCTTGATCACACTA

Gene: Shewana3_0095: hypothetical protein
*
Shewanella sp MR-4

Site:
position = -80
score = 4.84948
sequence = AAATTTGAGCTTGATCACACTA

Gene: Shewmr4_0094: hypothetical protein
*
Shewanella sp MR-7

Site:
position = -80
score = 4.84948
sequence = AAATTTGAGCTTGATCACACTA

Gene: Shewmr7_0089: hypothetical protein
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3964: hypothetical protein
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
hypothetical protein
 
CRON 48.
sel1
*
Shewanella oneidensis MR-1

Site:
position = -267
score = 4.23922
sequence = TTTAGTGATATTAGTCAACTAA

Gene: SO0625: Sel1 domain protein repeat-containing protein precursor
*
Shewanella putrefaciens CN-32

Site:
position = -270
score = 4.23922
sequence = TTTAGTGATATTAGTCAACTAA

Gene: Sputcn32_0653: Sel1 domain protein repeat-containing protein precursor
*
Shewanella sp W3-18-1

Site:
position = -270
score = 4.23922
sequence = TTTAGTGATATTAGTCAACTAA

Gene: Sputw3181_3521: Sel1 domain protein repeat-containing protein precursor
*
Shewanella sp ANA-3

Site:
position = -270
score = 4.23922
sequence = TTTAGTGATATTAGTCAACTAA

Gene: Shewana3_0618: Sel1 domain protein repeat-containing protein precursor
*
Shewanella sp MR-4

Site:
position = -270
score = 4.23922
sequence = TTTAGTGATATTAGTCAACTAA

Gene: Shewmr4_0619: Sel1 domain protein repeat-containing protein precursor
*
Shewanella sp MR-7

Site:
position = -270
score = 4.23922
sequence = TTTAGTGATATTAGTCAACTAA

Gene: Shewmr7_3411: Sel1 domain protein repeat-containing protein precursor
*
Shewanella baltica OS155

Site:
position = -278
score = 4.35121
sequence = TTTAGTGATTTAAGTCAACTAA

Gene: Sbal_0579: Sel1 domain protein repeat-containing protein precursor
 
Shewanella denitrificans OS217

Gene: Sden_3189: Sel1 domain protein repeat-containing protein precursor
*
Shewanella frigidimarina NCIMB 400

Site:
position = -222
score = 4.11507
sequence = AACTTTGATAGAGATCGTATTT

Site:
position = -147
score = 4.28476
sequence = ATTTGTGATGACGGTCGACTTT

Site:
position = -38
score = 3.99702
sequence = TTATTTAATCAGCTTCATAAAT

Gene: Sfri_3291: Sel1 domain protein repeat-containing protein precursor
*
Shewanella amazonensis SB2B

Site:
position = -319
score = 3.84014
sequence = AACCATGATGCAGATCGAAATT

Gene: Sama_3003: Sel1 domain protein repeat-containing protein precursor
*
Shewanella loihica PV-4

Site:
position = -279
score = 3.83192
sequence = ATTAGTAATATATGTCAACTAA

Gene: Shew_0586: Sel1 domain protein repeat-containing protein precursor
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
*
Shewanella piezotolerans WP3

Site:
position = -153
score = 3.82702
sequence = TTTTTTGAACCTTATCAATAAA

Gene: swp_0756: Sel1 domain protein repeat-containing protein precursor
*
Shewanella sediminis HAW-EB3

Site:
position = -296
score = 4.34462
sequence = ATTAGTGATATAAGTCAACTAA

Gene: Ssed_3872: Sel1 domain protein repeat-containing protein precursor
*
Shewanella woodyi ATCC 51908

Site:
position = -298
score = 4.34462
sequence = ATTAGTGATATAAGTCAACTAA

Gene: Swoo_0663: Sel1 domain protein repeat-containing protein precursor
Sel1 domain protein repeat-containing protein precursor
 
CRON 49.
argR
*
Shewanella oneidensis MR-1

Site:
position = -266
score = 4.53368
sequence = ATGTGTGACATGGATCTAATTT

Gene: SO0769: arginine pathway regulatory protein ArgR, repressor of arg regulon
*
Shewanella putrefaciens CN-32

Site:
position = -259
score = 4.17624
sequence = ATGTGTGACATGGATCTAGTTT

Gene: Sputcn32_3220: arginine pathway regulatory protein ArgR, repressor of arg regulon
*
Shewanella sp W3-18-1

Site:
position = -259
score = 4.17624
sequence = ATGTGTGACATGGATCTAGTTT

Gene: Sputw3181_0721: arginine pathway regulatory protein ArgR, repressor of arg regulon
*
Shewanella sp ANA-3

Site:
position = -266
score = 4.53368
sequence = ATGTGTGACATGGATCTAATTT

Gene: Shewana3_3510: arginine pathway regulatory protein ArgR, repressor of arg regulon
*
Shewanella sp MR-4

Site:
position = -266
score = 4.53368
sequence = ATGTGTGACATGGATCTAATTT

Gene: Shewmr4_3340: arginine pathway regulatory protein ArgR, repressor of arg regulon
*
Shewanella sp MR-7

Site:
position = -266
score = 4.53368
sequence = ATGTGTGACATGGATCTAATTT

Gene: Shewmr7_0613: arginine pathway regulatory protein ArgR, repressor of arg regulon
*
Shewanella baltica OS155

Site:
position = -270
score = 4.53368
sequence = ATGTGTGACATGGATCTAATTT

Gene: Sbal_0608: arginine pathway regulatory protein ArgR, repressor of arg regulon
 
Shewanella denitrificans OS217

Gene: Sden_0825: arginine pathway regulatory protein ArgR, repressor of arg regulon
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0640: arginine pathway regulatory protein ArgR, repressor of arg regulon
*
Shewanella amazonensis SB2B

Site:
position = -262
score = 4.03298
sequence = ATTTGTGAGGTAGATCCTCAAA

Gene: Sama_0671: arginine pathway regulatory protein ArgR, repressor of arg regulon
*
Shewanella loihica PV-4

Site:
position = -282
score = 4.59978
sequence = TTATGTGATATAGATCTAGATT

Gene: Shew_0866: arginine pathway regulatory protein ArgR, repressor of arg regulon
 
Shewanella pealeana ATCC 700345

Gene: Spea_0849: arginine pathway regulatory protein ArgR, repressor of arg regulon
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0902: arginine pathway regulatory protein ArgR, repressor of arg regulon
*
Shewanella piezotolerans WP3

Site:
position = -140
score = 3.81151
sequence = ATTTATACTCTACATCATATTT

Gene: swp_4101: arginine pathway regulatory protein ArgR, repressor of arg regulon
*
Shewanella sediminis HAW-EB3

Site:
position = -254
score = 3.75337
sequence = ATTTTTGTTCTACATCAATAAA

Gene: Ssed_0951: arginine pathway regulatory protein ArgR, repressor of arg regulon
*
Shewanella woodyi ATCC 51908

Site:
position = -311
score = 4.47876
sequence = TTTTGTGATGTAGGTCTACATT

Gene: Swoo_1001: arginine pathway regulatory protein ArgR, repressor of arg regulon
arginine pathway regulatory protein ArgR, repressor of arg regulon
 
CRON 50.
SO0439
*
Shewanella oneidensis MR-1

Site:
position = -34
score = 4.426
sequence = ATACGTGATCTGACGCACATCA

Gene: SO0439: hypothetical protein
*
Shewanella putrefaciens CN-32

Site:
position = -90
score = 4.48702
sequence = AAATGTGAACCAGAGCACACTC

Gene: Sputcn32_3403: hypothetical protein
*
Shewanella sp W3-18-1

Site:
position = -90
score = 4.48702
sequence = AAATGTGAACCAGAGCACACTC

Gene: Sputw3181_0540: hypothetical protein
*
Shewanella sp ANA-3

Site:
position = -78
score = 4.22843
sequence = AAGCGTGAGCTAACGCACACAA

Gene: Shewana3_0438: hypothetical protein
*
Shewanella sp MR-4

Site:
position = -77
score = 3.82136
sequence = AAGCGTGAACTTAAGCACACTC

Gene: Shewmr4_0442: hypothetical protein
*
Shewanella sp MR-7

Site:
position = -77
score = 3.82136
sequence = AAGCGTGAACTTAAGCACACTC

Gene: Shewmr7_3587: hypothetical protein
*
Shewanella baltica OS155

Site:
position = -93
score = 4.8117
sequence = AAATGTGACCTAAAGCACATAC

Gene: Sbal_0417: hypothetical protein
 
Shewanella denitrificans OS217
*
Shewanella frigidimarina NCIMB 400

Site:
position = -135
score = 5.2057
sequence = TTTTATGATTTAGATCACAAAA

Gene: Sfri_0491: hypothetical protein
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
*
Shewanella pealeana ATCC 700345

Site:
position = -137
score = 4.75582
sequence = TTTTGTGATCTAAGTAGCAAAA

Gene: Spea_0430: hypothetical protein
*
Shewanella halifaxensis HAW-EB4

Site:
position = -138
score = 4.74247
sequence = TTTTGTGACATAGGTAACACAA

Gene: Shal_0486: hypothetical protein
 
Shewanella piezotolerans WP3

Gene: swp_4727: hypothetical protein
*
Shewanella sediminis HAW-EB3

Site:
position = -105
score = 4.32443
sequence = ATTTGTGACCAAGTTCCCAAAC

Gene: Ssed_3193: hypothetical protein
*
Shewanella woodyi ATCC 51908

Site:
position = -78
score = 3.88288
sequence = AAACAGGACGTAGATCACACTT

Gene: Swoo_0294: hypothetical protein
hypothetical protein
 
CRON 51.
yceI
 
Shewanella oneidensis MR-1

Gene: SO2893: hypothetical protein
*
Shewanella putrefaciens CN-32

Site:
position = -70
score = 3.77562
sequence = TAAATGGATGTAAATCACGATT

Gene: Sputcn32_1651: hypothetical protein
*
Shewanella sp W3-18-1

Site:
position = -70
score = 3.77562
sequence = TAAATGGATGTAAATCACGATT

Gene: Sputw3181_2375: hypothetical protein
*
Shewanella sp ANA-3

Site:
position = -102
score = 4.61453
sequence = TTAGGTGATCTTTGTCACAGAT

Gene: Shewana3_1628: hypothetical protein
*
Shewanella sp MR-4

Site:
position = -103
score = 4.83478
sequence = TTAGGTGATCTTTGTCACAAAT

Gene: Shewmr4_1561: hypothetical protein
*
Shewanella sp MR-7

Site:
position = -103
score = 4.83478
sequence = TTAGGTGATCTTTGTCACAAAT

Gene: Shewmr7_1636: hypothetical protein
*
Shewanella baltica OS155

Site:
position = -105
score = 4.67624
sequence = TTAGGTGATGTGGGTCACGTTT

Gene: Sbal_1772: hypothetical protein
 
Shewanella denitrificans OS217

Gene: Sden_2275: hypothetical protein
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1704: hypothetical protein
 
Shewanella amazonensis SB2B

Gene: Sama_1959: hypothetical protein
 
Shewanella loihica PV-4

Gene: Shew_2223: hypothetical protein
 
Shewanella pealeana ATCC 700345

Gene: Spea_2476: hypothetical protein
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1807: hypothetical protein
*
Shewanella piezotolerans WP3

Site:
position = -42
score = 3.79306
sequence = TACATTGATATCTATCACTATT

Gene: swp_3020: hypothetical protein
 
Shewanella sediminis HAW-EB3

Gene: Ssed_2605: hypothetical protein
 
Shewanella woodyi ATCC 51908

Gene: Swoo_2061: hypothetical protein
hypothetical protein
SO2891
 
Shewanella oneidensis MR-1

Gene: SO2891: type IIA topoisomerase, B subunit
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1652: type IIA topoisomerase, B subunit
 
Shewanella sp W3-18-1

Gene: Sputw3181_2374: type IIA topoisomerase, B subunit
 
Shewanella sp ANA-3

Gene: Shewana3_1629: type IIA topoisomerase, B subunit
 
Shewanella sp MR-4

Gene: Shewmr4_1562: type IIA topoisomerase, B subunit
 
Shewanella sp MR-7

Gene: Shewmr7_1637: type IIA topoisomerase, B subunit
 
Shewanella baltica OS155

Gene: Sbal_1773: type IIA topoisomerase, B subunit
 
Shewanella denitrificans OS217

Gene: Sden_2274: type IIA topoisomerase, B subunit
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1705: type IIA topoisomerase, B subunit
 
Shewanella amazonensis SB2B

Gene: Sama_1958: type IIA topoisomerase, B subunit
 
Shewanella loihica PV-4

Gene: Shew_2222: type IIA topoisomerase, B subunit
*
Shewanella pealeana ATCC 700345

Site:
position = -166
score = 3.83614
sequence = TTACGTGCTGAATTGCAAAATT

Site:
position = -69
score = 3.81606
sequence = AATTGTTACGCATCTTACGCTA

Gene: Spea_2475: type IIA topoisomerase, B subunit
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1808: type IIA topoisomerase, B subunit
 
Shewanella piezotolerans WP3

Gene: swp_3019: type IIA topoisomerase, B subunit
 
Shewanella sediminis HAW-EB3

Gene: Ssed_2604: type IIA topoisomerase, B subunit
 
Shewanella woodyi ATCC 51908

Gene: Swoo_2062: type IIA topoisomerase, B subunit
type IIA topoisomerase, B subunit
 
CRON 52.
SO3914
*
Shewanella oneidensis MR-1

Site:
position = -136
score = 4.01516
sequence = AACAGTGATGCTGATTAAATTA

Gene: SO3914: ferrichrome-iron receptor
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
*
Shewanella sp ANA-3

Site:
position = -135
score = 4.1747
sequence = AATTGTGACTAAGATTAAATTG

Gene: Shewana3_0716: ferrichrome-iron receptor
*
Shewanella sp MR-4

Site:
position = -134
score = 4.46854
sequence = TAATGTGACAAAGATTAAATTA

Gene: Shewmr4_3245: ferrichrome-iron receptor
*
Shewanella sp MR-7

Site:
position = -134
score = 4.85508
sequence = TAATGTGATATGTATTAAATTA

Gene: Shewmr7_0697: ferrichrome-iron receptor
 
Shewanella baltica OS155

Gene: Sbal_3635: ferrichrome-iron receptor
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
ferrichrome-iron receptor
piuC
 
Shewanella oneidensis MR-1

Gene: SO3913: iron-uptake factor PiuC
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3

Gene: Shewana3_0717: iron-uptake factor PiuC
 
Shewanella sp MR-4

Gene: Shewmr4_3244: iron-uptake factor PiuC
 
Shewanella sp MR-7

Gene: Shewmr7_0698: iron-uptake factor PiuC
 
Shewanella baltica OS155

Gene: Sbal_3634: iron-uptake factor PiuC
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
iron-uptake factor PiuC
 
CRON 53.
SO3811
 
Shewanella oneidensis MR-1

Gene: SO3811: lipoprotein, putative
*
Shewanella putrefaciens CN-32

Site:
position = -116
score = 4.38849
sequence = TAATGTGATTGGTATAATATAC

Gene: Sputcn32_0822: lipoprotein, putative
*
Shewanella sp W3-18-1

Site:
position = -116
score = 4.38849
sequence = TAATGTGATTGGTATAATATAC

Gene: Sputw3181_3351: lipoprotein, putative
*
Shewanella sp ANA-3

Site:
position = -142
score = 4.14174
sequence = AATTGTTAAGTATTTCATATTG

Gene: Shewana3_0786: lipoprotein, putative
*
Shewanella sp MR-4

Site:
position = -142
score = 4.14174
sequence = AATTGTTAAGTATTTCATATTG

Gene: Shewmr4_3152: lipoprotein, putative
*
Shewanella sp MR-7

Site:
position = -142
score = 4.14174
sequence = AATTGTTAAGTATTTCATATTG

Gene: Shewmr7_0815: lipoprotein, putative
 
Shewanella baltica OS155

Gene: Sbal_0714: lipoprotein, putative
 
Shewanella denitrificans OS217

Gene: Sden_0774: lipoprotein, putative
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3111: lipoprotein, putative
 
Shewanella amazonensis SB2B

Gene: Sama_2553: lipoprotein, putative
 
Shewanella loihica PV-4

Gene: Shew_2889: lipoprotein, putative
 
Shewanella pealeana ATCC 700345

Gene: Spea_3110: lipoprotein, putative
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3194: lipoprotein, putative
 
Shewanella piezotolerans WP3

Gene: swp_1154: lipoprotein, putative
*
Shewanella sediminis HAW-EB3

Site:
position = -203
score = 4.29747
sequence = TAACGTGATGAAAGTAAAATTT

Gene: Ssed_3439: lipoprotein, putative
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3641: lipoprotein, putative
lipoprotein, putative
ppiA
 
Shewanella oneidensis MR-1

Gene: SO3812: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0821: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)
 
Shewanella sp W3-18-1

Gene: Sputw3181_3352: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)
 
Shewanella sp ANA-3

Gene: Shewana3_0785: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)
 
Shewanella sp MR-4

Gene: Shewmr4_3153: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)
 
Shewanella sp MR-7

Gene: Shewmr7_0814: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)
 
Shewanella baltica OS155

Gene: Sbal_0713: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)
 
Shewanella denitrificans OS217

Gene: Sden_0773: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3112: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)
 
Shewanella amazonensis SB2B

Gene: Sama_2554: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)
 
Shewanella loihica PV-4

Gene: Shew_2890: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)
 
Shewanella pealeana ATCC 700345

Gene: Spea_3111: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3195: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)
 
Shewanella piezotolerans WP3

Gene: swp_1153: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_3440: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3642: peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)
peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)
SO3813
 
Shewanella oneidensis MR-1

Gene: SO3813: hypothetical protein
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0820: hypothetical protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_3353: hypothetical protein
 
Shewanella sp ANA-3

Gene: Shewana3_0784: hypothetical protein
 
Shewanella sp MR-4

Gene: Shewmr4_3154: hypothetical protein
 
Shewanella sp MR-7

Gene: Shewmr7_0813: hypothetical protein
 
Shewanella baltica OS155

Gene: Sbal_0712: hypothetical protein
 
Shewanella denitrificans OS217

Gene: Sden_0772: hypothetical protein
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3113: hypothetical protein
 
Shewanella amazonensis SB2B

Gene: Sama_2555: hypothetical protein
 
Shewanella loihica PV-4

Gene: Shew_2891: hypothetical protein
 
Shewanella pealeana ATCC 700345

Gene: Spea_3112: hypothetical protein
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3196: hypothetical protein
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3

Gene: Ssed_3441: hypothetical protein
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3643: hypothetical protein
hypothetical protein
ampG
 
Shewanella oneidensis MR-1

Gene: SO3814: AmpG permease
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0819: AmpG permease
 
Shewanella sp W3-18-1

Gene: Sputw3181_3354: AmpG permease
 
Shewanella sp ANA-3

Gene: Shewana3_0783: AmpG permease
 
Shewanella sp MR-4

Gene: Shewmr4_3155: AmpG permease
 
Shewanella sp MR-7

Gene: Shewmr7_0812: AmpG permease
*
Shewanella baltica OS155

Site:
position = -218
score = 4.38656
sequence = TTTTGTGATCTCTTTTACTCAA

Gene: Sbal_0711: AmpG permease
 
Shewanella denitrificans OS217

Gene: Sden_0771: AmpG permease
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3114: AmpG permease
 
Shewanella amazonensis SB2B

Gene: Sama_2556: AmpG permease
 
Shewanella loihica PV-4

Gene: Shew_2892: AmpG permease
 
Shewanella pealeana ATCC 700345

Gene: Spea_3113: AmpG permease
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3197: AmpG permease
 
Shewanella piezotolerans WP3

Gene: swp_1152: AmpG permease
 
Shewanella sediminis HAW-EB3

Gene: Ssed_3442: AmpG permease
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3644: AmpG permease
AmpG permease
 
CRON 54.
mviN
*
Shewanella oneidensis MR-1

Site:
position = -49
score = 4.5281
sequence = TTTTTTGAGATGAATCACCTAA

Gene: SO3534: proposed peptidoglycan lipid II flippase MurJ
*
Shewanella putrefaciens CN-32

Site:
position = -49
score = 4.5281
sequence = TTTTTTGAGATGAATCACCTAA

Gene: Sputcn32_1057: proposed peptidoglycan lipid II flippase MurJ
*
Shewanella sp W3-18-1

Site:
position = -49
score = 4.5281
sequence = TTTTTTGAGATGAATCACCTAA

Gene: Sputw3181_3108: proposed peptidoglycan lipid II flippase MurJ
*
Shewanella sp ANA-3

Site:
position = -49
score = 4.5281
sequence = TTTTTTGAGATGAATCACCTAA

Gene: Shewana3_3138: proposed peptidoglycan lipid II flippase MurJ
*
Shewanella sp MR-4

Site:
position = -49
score = 4.5281
sequence = TTTTTTGAGATGAATCACCTAA

Gene: Shewmr4_2959: proposed peptidoglycan lipid II flippase MurJ
*
Shewanella sp MR-7

Site:
position = -49
score = 4.5281
sequence = TTTTTTGAGATGAATCACCTAA

Gene: Shewmr7_3041: proposed peptidoglycan lipid II flippase MurJ
*
Shewanella baltica OS155

Site:
position = -49
score = 4.56797
sequence = TTTTTTGAGATGTATCACCTAA

Gene: Sbal_1052: proposed peptidoglycan lipid II flippase MurJ
 
Shewanella denitrificans OS217

Gene: Sden_2725: proposed peptidoglycan lipid II flippase MurJ
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2892: proposed peptidoglycan lipid II flippase MurJ
 
Shewanella amazonensis SB2B

Gene: Sama_0922: proposed peptidoglycan lipid II flippase MurJ
 
Shewanella loihica PV-4

Gene: Shew_1097: proposed peptidoglycan lipid II flippase MurJ
 
Shewanella pealeana ATCC 700345

Gene: Spea_1081: proposed peptidoglycan lipid II flippase MurJ
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1129: proposed peptidoglycan lipid II flippase MurJ
 
Shewanella piezotolerans WP3

Gene: swp_3731: proposed peptidoglycan lipid II flippase MurJ
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1192: proposed peptidoglycan lipid II flippase MurJ
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1289: proposed peptidoglycan lipid II flippase MurJ
proposed peptidoglycan lipid II flippase MurJ
ribF
 
Shewanella oneidensis MR-1

Gene: SO3533: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1058: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)
 
Shewanella sp W3-18-1

Gene: Sputw3181_3107: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)
 
Shewanella sp ANA-3

Gene: Shewana3_3137: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)
 
Shewanella sp MR-4

Gene: Shewmr4_2958: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)
 
Shewanella sp MR-7

Gene: Shewmr7_3040: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)
 
Shewanella baltica OS155

Gene: Sbal_1053: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)
 
Shewanella denitrificans OS217

Gene: Sden_2724: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2891: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)
 
Shewanella amazonensis SB2B

Gene: Sama_0923: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)
 
Shewanella loihica PV-4

Gene: Shew_1098: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)
 
Shewanella pealeana ATCC 700345

Gene: Spea_1082: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1130: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)
 
Shewanella piezotolerans WP3

Gene: swp_3730: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1193: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1290: riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)
riboflavin kinase (EC 2.7.1.26) / FMN adenylyltransferase (EC 2.7.7.2)
ileS
 
Shewanella oneidensis MR-1

Gene: SO3532: isoleucyl-tRNA synthetase (EC 6.1.1.5)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1059: isoleucyl-tRNA synthetase (EC 6.1.1.5)
 
Shewanella sp W3-18-1

Gene: Sputw3181_3106: isoleucyl-tRNA synthetase (EC 6.1.1.5)
 
Shewanella sp ANA-3

Gene: Shewana3_3136: isoleucyl-tRNA synthetase (EC 6.1.1.5)
 
Shewanella sp MR-4

Gene: Shewmr4_2957: isoleucyl-tRNA synthetase (EC 6.1.1.5)
 
Shewanella sp MR-7

Gene: Shewmr7_3039: isoleucyl-tRNA synthetase (EC 6.1.1.5)
 
Shewanella baltica OS155

Gene: Sbal_1054: isoleucyl-tRNA synthetase (EC 6.1.1.5)
 
Shewanella denitrificans OS217

Gene: Sden_2723: isoleucyl-tRNA synthetase (EC 6.1.1.5)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2890: isoleucyl-tRNA synthetase (EC 6.1.1.5)
 
Shewanella amazonensis SB2B

Gene: Sama_0924: isoleucyl-tRNA synthetase (EC 6.1.1.5)
 
Shewanella loihica PV-4

Gene: Shew_1099: isoleucyl-tRNA synthetase (EC 6.1.1.5)
 
Shewanella pealeana ATCC 700345

Gene: Spea_1083: isoleucyl-tRNA synthetase (EC 6.1.1.5)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1131: isoleucyl-tRNA synthetase (EC 6.1.1.5)
 
Shewanella piezotolerans WP3

Gene: swp_3728: isoleucyl-tRNA synthetase (EC 6.1.1.5)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1194: isoleucyl-tRNA synthetase (EC 6.1.1.5)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1291: isoleucyl-tRNA synthetase (EC 6.1.1.5)
isoleucyl-tRNA synthetase (EC 6.1.1.5)
lspA
 
Shewanella oneidensis MR-1

Gene: SO3531: lipoprotein signal peptidase (EC 3.4.23.36)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1060: lipoprotein signal peptidase (EC 3.4.23.36)
 
Shewanella sp W3-18-1

Gene: Sputw3181_3105: lipoprotein signal peptidase (EC 3.4.23.36)
 
Shewanella sp ANA-3

Gene: Shewana3_3135: lipoprotein signal peptidase (EC 3.4.23.36)
 
Shewanella sp MR-4

Gene: Shewmr4_2956: lipoprotein signal peptidase (EC 3.4.23.36)
 
Shewanella sp MR-7

Gene: Shewmr7_3038: lipoprotein signal peptidase (EC 3.4.23.36)
 
Shewanella baltica OS155

Gene: Sbal_1055: lipoprotein signal peptidase (EC 3.4.23.36)
 
Shewanella denitrificans OS217

Gene: Sden_2722: lipoprotein signal peptidase (EC 3.4.23.36)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2889: lipoprotein signal peptidase (EC 3.4.23.36)
 
Shewanella amazonensis SB2B

Gene: Sama_0925: lipoprotein signal peptidase (EC 3.4.23.36)
 
Shewanella loihica PV-4

Gene: Shew_1100: lipoprotein signal peptidase (EC 3.4.23.36)
 
Shewanella pealeana ATCC 700345

Gene: Spea_1084: lipoprotein signal peptidase (EC 3.4.23.36)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1132: lipoprotein signal peptidase (EC 3.4.23.36)
 
Shewanella piezotolerans WP3

Gene: swp_3727: lipoprotein signal peptidase (EC 3.4.23.36)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1195: lipoprotein signal peptidase (EC 3.4.23.36)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1292: lipoprotein signal peptidase (EC 3.4.23.36)
lipoprotein signal peptidase (EC 3.4.23.36)
fkbP-2
 
Shewanella oneidensis MR-1

Gene: SO3530: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1061: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)
 
Shewanella sp W3-18-1

Gene: Sputw3181_3104: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)
 
Shewanella sp ANA-3

Gene: Shewana3_3134: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)
 
Shewanella sp MR-4

Gene: Shewmr4_2955: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)
 
Shewanella sp MR-7

Gene: Shewmr7_3037: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)
 
Shewanella baltica OS155

Gene: Sbal_1056: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)
 
Shewanella denitrificans OS217

Gene: Sden_2721: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2888: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)
 
Shewanella amazonensis SB2B

Gene: Sama_0926: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)
 
Shewanella loihica PV-4

Gene: Shew_1101: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)
 
Shewanella pealeana ATCC 700345

Gene: Spea_1085: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1133: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)
 
Shewanella piezotolerans WP3

Gene: swp_3725: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1196: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1293: FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)
FKBP-type peptidyl-prolyl cis-trans isomerase slpA (EC 5.2.1.8)
lytB
 
Shewanella oneidensis MR-1

Gene: SO3529: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1062: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)
 
Shewanella sp W3-18-1

Gene: Sputw3181_3103: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)
 
Shewanella sp ANA-3

Gene: Shewana3_3133: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)
 
Shewanella sp MR-4

Gene: Shewmr4_2954: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)
 
Shewanella sp MR-7

Gene: Shewmr7_3036: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)
 
Shewanella baltica OS155

Gene: Sbal_1057: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)
 
Shewanella denitrificans OS217

Gene: Sden_2720: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2887: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)
 
Shewanella amazonensis SB2B

Gene: Sama_0927: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)
 
Shewanella loihica PV-4

Gene: Shew_1102: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)
 
Shewanella pealeana ATCC 700345

Gene: Spea_1086: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1134: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)
 
Shewanella piezotolerans WP3

Gene: swp_3724: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1197: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1294: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)
4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2)
pilV
 
Shewanella oneidensis MR-1

Gene: SO3528: type IV fimbrial biogenesis protein PilV
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1063: type IV fimbrial biogenesis protein PilV
 
Shewanella sp W3-18-1

Gene: Sputw3181_3102: type IV fimbrial biogenesis protein PilV
 
Shewanella sp ANA-3

Gene: Shewana3_3132: type IV fimbrial biogenesis protein PilV
 
Shewanella sp MR-4

Gene: Shewmr4_2953: type IV fimbrial biogenesis protein PilV
 
Shewanella sp MR-7

Gene: Shewmr7_3035: type IV fimbrial biogenesis protein PilV
 
Shewanella baltica OS155

Gene: Sbal_1058: type IV fimbrial biogenesis protein PilV
 
Shewanella denitrificans OS217

Gene: Sden_2719: type IV fimbrial biogenesis protein PilV
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2886: type IV fimbrial biogenesis protein PilV
*
Shewanella amazonensis SB2B

Site:
position = -138
score = 3.85633
sequence = TATTGTTACTGGCAGCAAACAA

Gene: Sama_0928: type IV fimbrial biogenesis protein PilV
 
Shewanella loihica PV-4

Gene: Shew_1103: type IV fimbrial biogenesis protein PilV
 
Shewanella pealeana ATCC 700345

Gene: Spea_1087: type IV fimbrial biogenesis protein PilV
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1135: type IV fimbrial biogenesis protein PilV
 
Shewanella piezotolerans WP3

Gene: swp_3723: type IV fimbrial biogenesis protein PilV
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1198: type IV fimbrial biogenesis protein PilV
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1295: type IV fimbrial biogenesis protein PilV
type IV fimbrial biogenesis protein PilV
pilW
 
Shewanella oneidensis MR-1

Gene: SO3527: type IV fimbrial biogenesis protein PilW
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1064: type IV fimbrial biogenesis protein PilW
 
Shewanella sp W3-18-1

Gene: Sputw3181_3101: type IV fimbrial biogenesis protein PilW
 
Shewanella sp ANA-3

Gene: Shewana3_3131: type IV fimbrial biogenesis protein PilW
 
Shewanella sp MR-4

Gene: Shewmr4_2952: type IV fimbrial biogenesis protein PilW
 
Shewanella sp MR-7

Gene: Shewmr7_3034: type IV fimbrial biogenesis protein PilW
 
Shewanella baltica OS155

Gene: Sbal_1059: type IV fimbrial biogenesis protein PilW
 
Shewanella denitrificans OS217

Gene: Sden_2718: type IV fimbrial biogenesis protein PilW
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2885: type IV fimbrial biogenesis protein PilW
 
Shewanella amazonensis SB2B

Gene: Sama_0929: type IV fimbrial biogenesis protein PilW
 
Shewanella loihica PV-4

Gene: Shew_1104: type IV fimbrial biogenesis protein PilW
 
Shewanella pealeana ATCC 700345

Gene: Spea_1088: type IV fimbrial biogenesis protein PilW
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1136: type IV fimbrial biogenesis protein PilW
 
Shewanella piezotolerans WP3

Gene: swp_3722: type IV fimbrial biogenesis protein PilW
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1199: type IV fimbrial biogenesis protein PilW
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1296: type IV fimbrial biogenesis protein PilW
type IV fimbrial biogenesis protein PilW
pilX
 
Shewanella oneidensis MR-1

Gene: SO3526: type IV fimbrial biogenesis protein PilX
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1065: type IV fimbrial biogenesis protein PilX
 
Shewanella sp W3-18-1

Gene: Sputw3181_3100: type IV fimbrial biogenesis protein PilX
 
Shewanella sp ANA-3

Gene: Shewana3_3130: type IV fimbrial biogenesis protein PilX
 
Shewanella sp MR-4

Gene: Shewmr4_2951: type IV fimbrial biogenesis protein PilX
 
Shewanella sp MR-7

Gene: Shewmr7_3033: type IV fimbrial biogenesis protein PilX
 
Shewanella baltica OS155

Gene: Sbal_1060: type IV fimbrial biogenesis protein PilX
 
Shewanella denitrificans OS217

Gene: Sden_2717: type IV fimbrial biogenesis protein PilX
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2884: type IV fimbrial biogenesis protein PilX
 
Shewanella amazonensis SB2B

Gene: Sama_0930: type IV fimbrial biogenesis protein PilX
 
Shewanella loihica PV-4

Gene: Shew_1105: type IV fimbrial biogenesis protein PilX
 
Shewanella pealeana ATCC 700345

Gene: Spea_1089: type IV fimbrial biogenesis protein PilX
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1137: type IV fimbrial biogenesis protein PilX
 
Shewanella piezotolerans WP3

Gene: swp_3721: type IV fimbrial biogenesis protein PilX
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1200: type IV fimbrial biogenesis protein PilX
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1297: type IV fimbrial biogenesis protein PilX
type IV fimbrial biogenesis protein PilX
pilY1
 
Shewanella oneidensis MR-1

Gene: SO3525: type IV fimbrial biogenesis protein PilY1
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1066: type IV fimbrial biogenesis protein PilY1
 
Shewanella sp W3-18-1

Gene: Sputw3181_3099: type IV fimbrial biogenesis protein PilY1
 
Shewanella sp ANA-3

Gene: Shewana3_3129: type IV fimbrial biogenesis protein PilY1
 
Shewanella sp MR-4

Gene: Shewmr4_2950: type IV fimbrial biogenesis protein PilY1
 
Shewanella sp MR-7

Gene: Shewmr7_3032: type IV fimbrial biogenesis protein PilY1
 
Shewanella baltica OS155

Gene: Sbal_1061: type IV fimbrial biogenesis protein PilY1
 
Shewanella denitrificans OS217

Gene: Sden_2716: type IV fimbrial biogenesis protein PilY1
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2883: type IV fimbrial biogenesis protein PilY1
 
Shewanella amazonensis SB2B

Gene: Sama_0931: type IV fimbrial biogenesis protein PilY1
 
Shewanella loihica PV-4

Gene: Shew_1106: type IV fimbrial biogenesis protein PilY1
 
Shewanella pealeana ATCC 700345

Gene: Spea_1090: type IV fimbrial biogenesis protein PilY1
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1138: type IV fimbrial biogenesis protein PilY1
 
Shewanella piezotolerans WP3

Gene: swp_3720: type IV fimbrial biogenesis protein PilY1
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1201: type IV fimbrial biogenesis protein PilY1
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1298: type IV fimbrial biogenesis protein PilY1
type IV fimbrial biogenesis protein PilY1
pilE
 
Shewanella oneidensis MR-1

Gene: SO3524: type IV pilus biogenesis protein PilE
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1067: type IV pilus biogenesis protein PilE
 
Shewanella sp W3-18-1

Gene: Sputw3181_3098: type IV pilus biogenesis protein PilE
 
Shewanella sp ANA-3

Gene: Shewana3_3128: type IV pilus biogenesis protein PilE
 
Shewanella sp MR-4

Gene: Shewmr4_2949: type IV pilus biogenesis protein PilE
 
Shewanella sp MR-7

Gene: Shewmr7_3031: type IV pilus biogenesis protein PilE
 
Shewanella baltica OS155

Gene: Sbal_1062: type IV pilus biogenesis protein PilE
 
Shewanella denitrificans OS217

Gene: Sden_2715: type IV pilus biogenesis protein PilE
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2882: type IV pilus biogenesis protein PilE
 
Shewanella amazonensis SB2B

Gene: Sama_0932: type IV pilus biogenesis protein PilE
 
Shewanella loihica PV-4

Gene: Shew_1107: type IV pilus biogenesis protein PilE
 
Shewanella pealeana ATCC 700345

Gene: Spea_1091: type IV pilus biogenesis protein PilE
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1139: type IV pilus biogenesis protein PilE
 
Shewanella piezotolerans WP3

Gene: swp_3719: type IV pilus biogenesis protein PilE
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1202: type IV pilus biogenesis protein PilE
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1299: type IV pilus biogenesis protein PilE
type IV pilus biogenesis protein PilE
 
CRON 55.
mdh
*
Shewanella oneidensis MR-1

Site:
position = -47
score = 4.29841
sequence = AAATTAGATCCATGTCACACAT

Gene: SO0770: malate dehydrogenase (EC 1.1.1.37)
*
Shewanella putrefaciens CN-32

Site:
position = -46
score = 3.97202
sequence = AAACTAGATCCATGTCACACAT

Gene: Sputcn32_3219: malate dehydrogenase (EC 1.1.1.37)
*
Shewanella sp W3-18-1

Site:
position = -46
score = 3.97202
sequence = AAACTAGATCCATGTCACACAT

Gene: Sputw3181_0722: malate dehydrogenase (EC 1.1.1.37)
*
Shewanella sp ANA-3

Site:
position = -46
score = 4.29841
sequence = AAATTAGATCCATGTCACACAT

Gene: Shewana3_3509: malate dehydrogenase (EC 1.1.1.37)
*
Shewanella sp MR-4

Site:
position = -46
score = 4.29841
sequence = AAATTAGATCCATGTCACACAT

Gene: Shewmr4_3339: malate dehydrogenase (EC 1.1.1.37)
*
Shewanella sp MR-7

Site:
position = -46
score = 4.29841
sequence = AAATTAGATCCATGTCACACAT

Gene: Shewmr7_0614: malate dehydrogenase (EC 1.1.1.37)
*
Shewanella baltica OS155

Site:
position = -46
score = 4.29841
sequence = AAATTAGATCCATGTCACACAT

Gene: Sbal_0609: malate dehydrogenase (EC 1.1.1.37)
 
Shewanella denitrificans OS217

Gene: Sden_0826: malate dehydrogenase (EC 1.1.1.37)
*
Shewanella frigidimarina NCIMB 400

Site:
position = -45
score = 4.154
sequence = AATTTAGATCTATGTCACAAAC

Gene: Sfri_3173: malate dehydrogenase (EC 1.1.1.37)
*
Shewanella amazonensis SB2B

Site:
position = -46
score = 3.78342
sequence = TTTGAGGATCTACCTCACAAAT

Gene: Sama_0672: malate dehydrogenase (EC 1.1.1.37)
*
Shewanella loihica PV-4

Site:
position = -47
score = 4.46978
sequence = AATCTAGATCTATATCACATAA

Gene: Shew_0867: malate dehydrogenase (EC 1.1.1.37)
 
Shewanella pealeana ATCC 700345

Gene: Spea_0850: malate dehydrogenase (EC 1.1.1.37)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -46
score = 3.88457
sequence = AAGATGGATCTGAATCACAAAA

Gene: Shal_0903: malate dehydrogenase (EC 1.1.1.37)
*
Shewanella piezotolerans WP3

Site:
position = -46
score = 3.92088
sequence = AAAACAGATCTAAATCACAAAA

Gene: swp_4100: malate dehydrogenase (EC 1.1.1.37)
*
Shewanella sediminis HAW-EB3

Site:
position = -136
score = 4.08545
sequence = TTTATTGATGTAGAACAAAAAT

Gene: Ssed_0952: malate dehydrogenase (EC 1.1.1.37)
*
Shewanella woodyi ATCC 51908

Site:
position = -47
score = 3.82399
sequence = AATGTAGACCTACATCACAAAA

Gene: Swoo_1002: malate dehydrogenase (EC 1.1.1.37)
malate dehydrogenase (EC 1.1.1.37)
 
CRON 56.
cytcB
*
Shewanella oneidensis MR-1

Site:
position = -95
score = 4.42458
sequence = AAATATTACCCCGATCACATTA

Gene: SO4666: diheme cytochrome c4
*
Shewanella putrefaciens CN-32

Site:
position = -95
score = 4.32157
sequence = AAATATTACTCCGATCACATTA

Gene: Sputcn32_3908: diheme cytochrome c4
*
Shewanella sp W3-18-1

Site:
position = -95
score = 4.32157
sequence = AAATATTACTCCGATCACATTA

Gene: Sputw3181_0043: diheme cytochrome c4
*
Shewanella sp ANA-3

Site:
position = -95
score = 4.42458
sequence = AAATATTACCCCGATCACATTA

Gene: Shewana3_4111: diheme cytochrome c4
*
Shewanella sp MR-4

Site:
position = -95
score = 4.42458
sequence = AAATATTACCCCGATCACATTA

Gene: Shewmr4_3907: diheme cytochrome c4
*
Shewanella sp MR-7

Site:
position = -95
score = 4.42458
sequence = AAATATTACCCCGATCACATTA

Gene: Shewmr7_3999: diheme cytochrome c4
*
Shewanella baltica OS155

Site:
position = -95
score = 4.32157
sequence = AAATATTACTCCGATCACATTA

Gene: Sbal_0051: diheme cytochrome c4
*
Shewanella denitrificans OS217

Site:
position = -94
score = 3.70779
sequence = AAATATTATTTCGAGCATAATA

Gene: Sden_3622: diheme cytochrome c4
*
Shewanella frigidimarina NCIMB 400

Site:
position = -181
score = 4.34371
sequence = AAATATTAGCCTGATCACATTA

Gene: Sfri_3945: diheme cytochrome c4
*
Shewanella amazonensis SB2B

Site:
position = -95
score = 3.70946
sequence = AAATATTGCCCCGATCACATAT

Gene: Sama_0091: diheme cytochrome c4
*
Shewanella loihica PV-4

Site:
position = -95
score = 4.42458
sequence = AAATATTACCCCGATCACATAA

Gene: Shew_3716: diheme cytochrome c4
*
Shewanella pealeana ATCC 700345

Site:
position = -95
score = 4.42458
sequence = AAATATTACCCCGATCACATAA

Gene: Spea_0100: diheme cytochrome c4
*
Shewanella halifaxensis HAW-EB4

Site:
position = -95
score = 4.42458
sequence = AAATATTACCCCGATCACATAA

Gene: Shal_4222: diheme cytochrome c4
*
Shewanella piezotolerans WP3

Site:
position = -95
score = 4.42458
sequence = AAATATTACCCCGATCACATAA

Gene: swp_5075: diheme cytochrome c4
*
Shewanella sediminis HAW-EB3

Site:
position = -96
score = 4.51372
sequence = AAATATTACCTCGATCACATAA

Gene: Ssed_0094: diheme cytochrome c4
*
Shewanella woodyi ATCC 51908

Site:
position = -157
score = 4.1598
sequence = AAATATGATGTTTTGCACTTTA

Site:
position = -96
score = 4.43127
sequence = AAATATTACCTCGATCACAATA

Gene: Swoo_0057: diheme cytochrome c4
diheme cytochrome c4
 
CRON 57.
SO1821
 
Shewanella oneidensis MR-1

Gene: SO1821: outer membrane porin, putative
*
Shewanella putrefaciens CN-32

Site:
position = -140
score = 4.44343
sequence = TTTTGTGATGTTAATCTACATA

Gene: Sputcn32_1515: outer membrane porin, putative
*
Shewanella sp W3-18-1

Site:
position = -140
score = 4.44343
sequence = TTTTGTGATGTTAATCTACATA

Gene: Sputw3181_2585: outer membrane porin, putative
*
Shewanella sp ANA-3

Site:
position = -140
score = 4.38176
sequence = TTTTGTGATGTTTCTCTACATA

Gene: Shewana3_2628: outer membrane porin, putative
*
Shewanella sp MR-4

Site:
position = -140
score = 4.38176
sequence = TTTTGTGATGTTTCTCTACATA

Gene: Shewmr4_2468: outer membrane porin, putative
*
Shewanella sp MR-7

Site:
position = -140
score = 4.38176
sequence = TTTTGTGATGTTTCTCTACATA

Gene: Shewmr7_2536: outer membrane porin, putative
*
Shewanella baltica OS155

Site:
position = -143
score = 4.54093
sequence = TTTTGTGATGTTAATCGACATA

Gene: Sbal_1631: outer membrane porin, putative
 
Shewanella denitrificans OS217
*
Shewanella frigidimarina NCIMB 400

Site:
position = -307
score = 4.35854
sequence = AGTCGCGATCTACATCAAATAA

Site:
position = -140
score = 4.16268
sequence = TTATATGAGATATATCGCCTTT

Gene: Sfri_3603: outer membrane porin, putative
*
Shewanella amazonensis SB2B

Site:
position = -140
score = 4.53854
sequence = TGTTGTGATTTTTAACACGTTT

Site:
position = -168
score = 3.88342
sequence = TTATCTGATAGAGATTTCAATT

Gene: Sama_1251: outer membrane porin, putative
 
Shewanella loihica PV-4

Gene: Shew_2481: outer membrane porin, putative
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3

Gene: Ssed_2557: outer membrane porin, putative
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3084: outer membrane porin, putative
outer membrane porin, putative
 
CRON 58.
ygbA
*
Shewanella oneidensis MR-1

Site:
position = -97
score = 4.05487
sequence = TTTTGTGCGCACCTTCATAAAT

Gene: SO0324: nitrosative stress induced protein
*
Shewanella putrefaciens CN-32

Site:
position = -96
score = 4.05487
sequence = TTTTGTGCGCACCTTCATAAAT

Gene: Sputcn32_3663: nitrosative stress induced protein
*
Shewanella sp W3-18-1

Site:
position = -96
score = 4.05487
sequence = TTTTGTGCGCACCTTCATAAAT

Gene: Sputw3181_3804: nitrosative stress induced protein
*
Shewanella sp ANA-3

Site:
position = -97
score = 4.06993
sequence = TTTTGTGCGCATCTTCATAAAT

Gene: Shewana3_3845: nitrosative stress induced protein
*
Shewanella sp MR-4

Site:
position = -97
score = 4.06993
sequence = TTTTGTGCGCATCTTCATAAAT

Gene: Shewmr4_3649: nitrosative stress induced protein
*
Shewanella sp MR-7

Site:
position = -97
score = 4.06993
sequence = TTTTGTGCGCATCTTCATAAAT

Gene: Shewmr7_0295: nitrosative stress induced protein
*
Shewanella baltica OS155

Site:
position = -96
score = 4.05487
sequence = TTTTGTGCGCACCTTCATAAAT

Gene: Sbal_4067: nitrosative stress induced protein
 
Shewanella denitrificans OS217
*
Shewanella frigidimarina NCIMB 400

Site:
position = -142
score = 3.98547
sequence = TTTTGCGATCCCAACCTCAAAA

Gene: Sfri_0404: nitrosative stress induced protein
*
Shewanella amazonensis SB2B

Site:
position = -94
score = 3.59739
sequence = TTTTGTGCGCATCTTCATGCTT

Gene: Sama_3326: nitrosative stress induced protein
*
Shewanella loihica PV-4

Site:
position = -96
score = 4.06993
sequence = TTTTGTGCGCATCTTCATAATT

Gene: Shew_0259: nitrosative stress induced protein
*
Shewanella pealeana ATCC 700345

Site:
position = -96
score = 3.89312
sequence = TTTTGTGCACATCTTCAAAGTT

Gene: Spea_0303: nitrosative stress induced protein
*
Shewanella halifaxensis HAW-EB4

Site:
position = -96
score = 3.99827
sequence = TTTTGTGCACATCTTCAAACTT

Gene: Shal_3986: nitrosative stress induced protein
*
Shewanella piezotolerans WP3

Site:
position = -96
score = 4.03726
sequence = TTTTGTGCGCACCTTCAAACTT

Gene: swp_2171: nitrosative stress induced protein
*
Shewanella sediminis HAW-EB3

Site:
position = -187
score = 3.90078
sequence = TTTTGTGCACATCTTCATACTT

Gene: Ssed_4199: nitrosative stress induced protein
*
Shewanella woodyi ATCC 51908

Site:
position = -82
score = 3.43868
sequence = TTCTGTGCGCACCTTCATAGAT

Gene: Swoo_0395: nitrosative stress induced protein
nitrosative stress induced protein
 
CRON 59.
astC
*
Shewanella oneidensis MR-1

Site:
position = -142
score = 4.04968
sequence = AACTGGTATTTTGATCACAATT

Gene: SO0617: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)
*
Shewanella putrefaciens CN-32

Site:
position = -142
score = 4.13212
sequence = AACTGGTATTTTGATCACATTT

Gene: Sputcn32_0645: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)
*
Shewanella sp W3-18-1

Site:
position = -142
score = 4.13212
sequence = AACTGGTATTTTGATCACATTT

Gene: Sputw3181_3529: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)
*
Shewanella sp ANA-3

Site:
position = -142
score = 4.04968
sequence = AACTGGTATTTTGATCACAATT

Gene: Shewana3_0610: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)
*
Shewanella sp MR-4

Site:
position = -142
score = 4.04968
sequence = AACTGGTATTTTGATCACAATT

Gene: Shewmr4_0611: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)
*
Shewanella sp MR-7

Site:
position = -308
score = 3.8086
sequence = AATTGTGTAGTTATTCATATTC

Gene: Shewmr7_3419: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)
*
Shewanella baltica OS155

Site:
position = -142
score = 4.13212
sequence = AACTGGTATTTTGATCACATTT

Gene: Sbal_0571: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)
*
Shewanella denitrificans OS217

Site:
position = -136
score = 4.13212
sequence = AACTGGTATTTTGATCACATTT

Gene: Sden_3193: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)
*
Shewanella frigidimarina NCIMB 400

Site:
position = -137
score = 4.13212
sequence = AACTGGTATTTTGATCACATTT

Gene: Sfri_3299: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)
*
Shewanella amazonensis SB2B

Site:
position = -142
score = 4.03462
sequence = AACTGGTATTTCGATCACAATT

Gene: Sama_3011: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)
*
Shewanella loihica PV-4

Site:
position = -140
score = 3.77468
sequence = AACTGGTATTTTGATCACGTTT

Gene: Shew_0578: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)
*
Shewanella pealeana ATCC 700345

Site:
position = -138
score = 4.13212
sequence = AACTGGTATTTTGATCACATTT

Gene: Spea_3516: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -138
score = 3.68727
sequence = AACTGGCATTCTGATCACATTT

Gene: Shal_3610: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)
*
Shewanella piezotolerans WP3

Site:
position = -140
score = 4.13212
sequence = AACTGGTATTTTGATCACATTT

Gene: swp_0747: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)
*
Shewanella sediminis HAW-EB3

Site:
position = -141
score = 4.13212
sequence = AACTGGTATTTTGATCACATTT

Site:
position = -121
score = 3.90743
sequence = TTTCGTTATTAATGTCACTTAA

Gene: Ssed_0809: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)
*
Shewanella woodyi ATCC 51908

Site:
position = -172
score = 4.29072
sequence = ATATGTGCTGCTGATCTTATTT

Gene: Swoo_0655: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)
Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)
astA
 
Shewanella oneidensis MR-1

Gene: SO0618: Arginine N-succinyltransferase (EC 2.3.1.109)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0646: Arginine N-succinyltransferase (EC 2.3.1.109)
 
Shewanella sp W3-18-1

Gene: Sputw3181_3528: Arginine N-succinyltransferase (EC 2.3.1.109)
 
Shewanella sp ANA-3

Gene: Shewana3_0611: Arginine N-succinyltransferase (EC 2.3.1.109)
 
Shewanella sp MR-4

Gene: Shewmr4_0612: Arginine N-succinyltransferase (EC 2.3.1.109)
 
Shewanella sp MR-7

Gene: Shewmr7_3418: Arginine N-succinyltransferase (EC 2.3.1.109)
 
Shewanella baltica OS155

Gene: Sbal_0572: Arginine N-succinyltransferase (EC 2.3.1.109)
 
Shewanella denitrificans OS217

Gene: Sden_3192: Arginine N-succinyltransferase (EC 2.3.1.109)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3298: Arginine N-succinyltransferase (EC 2.3.1.109)
 
Shewanella amazonensis SB2B

Gene: Sama_3010: Arginine N-succinyltransferase (EC 2.3.1.109)
 
Shewanella loihica PV-4

Gene: Shew_0579: Arginine N-succinyltransferase (EC 2.3.1.109)
 
Shewanella pealeana ATCC 700345

Gene: Spea_3515: Arginine N-succinyltransferase (EC 2.3.1.109)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3609: Arginine N-succinyltransferase (EC 2.3.1.109)
 
Shewanella piezotolerans WP3

Gene: swp_0748: Arginine N-succinyltransferase (EC 2.3.1.109)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_0810: Arginine N-succinyltransferase (EC 2.3.1.109)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0656: Arginine N-succinyltransferase (EC 2.3.1.109)
Arginine N-succinyltransferase (EC 2.3.1.109)
astD
 
Shewanella oneidensis MR-1

Gene: SO0619: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0647: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)
 
Shewanella sp W3-18-1

Gene: Sputw3181_3527: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)
 
Shewanella sp ANA-3

Gene: Shewana3_0612: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)
 
Shewanella sp MR-4

Gene: Shewmr4_0613: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)
 
Shewanella sp MR-7

Gene: Shewmr7_3417: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)
 
Shewanella baltica OS155

Gene: Sbal_0573: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)
 
Shewanella denitrificans OS217

Gene: Sden_3191: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3297: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)
 
Shewanella amazonensis SB2B

Gene: Sama_3009: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)
 
Shewanella loihica PV-4

Gene: Shew_0580: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)
 
Shewanella pealeana ATCC 700345

Gene: Spea_3514: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3608: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)
 
Shewanella piezotolerans WP3

Gene: swp_0749: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_0811: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0657: Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)
Succinylglutamic semialdehyde dehydrogenase (EC 1.2.1.71)
SO0620
 
Shewanella oneidensis MR-1

Gene: SO0620: FIG008480: hypothetical protein
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0648: FIG008480: hypothetical protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_3526: FIG008480: hypothetical protein
 
Shewanella sp ANA-3

Gene: Shewana3_0613: FIG008480: hypothetical protein
 
Shewanella sp MR-4

Gene: Shewmr4_0614: FIG008480: hypothetical protein
 
Shewanella sp MR-7

Gene: Shewmr7_3416: FIG008480: hypothetical protein
 
Shewanella baltica OS155

Gene: Sbal_0574: FIG008480: hypothetical protein
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3296: FIG008480: hypothetical protein
 
Shewanella amazonensis SB2B

Gene: Sama_3008: FIG008480: hypothetical protein
 
Shewanella loihica PV-4

Gene: Shew_0581: FIG008480: hypothetical protein
 
Shewanella pealeana ATCC 700345

Gene: Spea_3513: FIG008480: hypothetical protein
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3607: FIG008480: hypothetical protein
 
Shewanella piezotolerans WP3

Gene: swp_0750: FIG008480: hypothetical protein
 
Shewanella sediminis HAW-EB3

Gene: Ssed_0812: FIG008480: hypothetical protein
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0658: FIG008480: hypothetical protein
FIG008480: hypothetical protein
 
CRON 60.
scyA
*
Shewanella oneidensis MR-1

Site:
position = -234
score = 3.96983
sequence = CAATTTGATATGGTTCCAATAA

Site:
position = -125
score = 4.12482
sequence = TGCTGAGATTCTAATCACAAAA

Gene: SO0264: cytochrome c-type protein
*
Shewanella putrefaciens CN-32

Site:
position = -229
score = 4.04351
sequence = CAATTTGATGTGGTTCCAATAA

Site:
position = -129
score = 3.74717
sequence = CGCTGAGATTCTAATCACAAAA

Gene: Sputcn32_3726: cytochrome c-type protein
*
Shewanella sp W3-18-1

Site:
position = -229
score = 4.04351
sequence = CAATTTGATGTGGTTCCAATAA

Site:
position = -129
score = 3.74717
sequence = CGCTGAGATTCTAATCACAAAA

Gene: Sputw3181_0189: cytochrome c-type protein
*
Shewanella sp ANA-3

Site:
position = -234
score = 4.04351
sequence = CAATTTGATGTGGTTCCAATAA

Site:
position = -125
score = 4.12482
sequence = TGCTGAGATTCTAATCACAAAA

Gene: Shewana3_0232: cytochrome c-type protein
*
Shewanella sp MR-4

Site:
position = -234
score = 4.04351
sequence = CAATTTGATGTGGTTCCAATAA

Site:
position = -125
score = 4.12482
sequence = TGCTGAGATTCTAATCACAAAA

Gene: Shewmr4_0232: cytochrome c-type protein
*
Shewanella sp MR-7

Site:
position = -234
score = 4.04351
sequence = CAATTTGATGTGGTTCCAATAA

Site:
position = -125
score = 3.74717
sequence = CGCTGAGATTCTAATCACAAAA

Gene: Shewmr7_0227: cytochrome c-type protein
*
Shewanella baltica OS155

Site:
position = -228
score = 3.94327
sequence = CAATATGATGTGGTTCCAATAA

Site:
position = -128
score = 4.52076
sequence = TGTTGAGATTCTAATCACAAAA

Gene: Sbal_0229: cytochrome c-type protein
*
Shewanella denitrificans OS217

Site:
position = -131
score = 3.79793
sequence = AGCTGGGAGGCTTATCACAAAA

Site:
position = -109
score = 4.10054
sequence = AGGTGTGATTTTATTAACTTTA

Gene: Sden_3568: cytochrome c-type protein
*
Shewanella frigidimarina NCIMB 400

Site:
position = -233
score = 3.91585
sequence = CAATTTGATATGGTTCCAAAAT

Site:
position = -133
score = 4.09514
sequence = AGCTGAGATTGTTATCACAAAA

Gene: Sfri_0180: cytochrome c-type protein
*
Shewanella amazonensis SB2B

Site:
position = -225
score = 3.99267
sequence = CAATTTGATGCAGTTCCAATAA

Gene: Sama_0246: cytochrome c-type protein
*
Shewanella loihica PV-4

Site:
position = -131
score = 4.83681
sequence = AATTCTGATATTAATCACAAAA

Site:
position = -242
score = 3.80276
sequence = CAATTTGATATGCTTCCAAAAA

Gene: Shew_0191: cytochrome c-type protein
*
Shewanella pealeana ATCC 700345

Site:
position = -230
score = 4.38557
sequence = CAATTTGATGTAGTTCGAATAT

Site:
position = -130
score = 3.96819
sequence = TGGCGAGATTAATATCACAAAA

Gene: Spea_0216: cytochrome c-type protein
*
Shewanella halifaxensis HAW-EB4

Site:
position = -230
score = 4.38557
sequence = CAATTTGATGTAGTTCGAATAT

Gene: Shal_4103: cytochrome c-type protein
*
Shewanella piezotolerans WP3

Site:
position = -131
score = 4.80485
sequence = TAACGCGATTTAAATCACAAAT

Site:
position = -231
score = 4.38557
sequence = CAATTTGATGTAGTTCGAATAT

Gene: swp_2044: cytochrome c-type protein
*
Shewanella sediminis HAW-EB3

Site:
position = -145
score = 4.39142
sequence = AGCTTTGATTGAAATCACAAAA

Gene: Ssed_4286: cytochrome c-type protein
*
Shewanella woodyi ATCC 51908

Site:
position = -256
score = 3.80276
sequence = CAATTTGATATGCTTCCAAAAA

Site:
position = -144
score = 3.94285
sequence = TACTTTGATTAAAGTCATAAAA

Gene: Swoo_4658: cytochrome c-type protein
cytochrome c-type protein
 
CRON 61.
sodB
*
Shewanella oneidensis MR-1

Site:
position = -91
score = 4.26429
sequence = AACAATGATTCACATCACAAAT

Gene: SO2881: superoxide dismutase [Fe] (EC 1.15.1.1)
*
Shewanella putrefaciens CN-32

Site:
position = -91
score = 4.26429
sequence = AACAATGATTCACATCACAAAT

Gene: Sputcn32_1687: superoxide dismutase [Fe] (EC 1.15.1.1)
*
Shewanella sp W3-18-1

Site:
position = -91
score = 4.26429
sequence = AACAATGATTCACATCACAAAT

Gene: Sputw3181_2338: superoxide dismutase [Fe] (EC 1.15.1.1)
*
Shewanella sp ANA-3

Site:
position = -91
score = 4.26429
sequence = AACAATGATTCACATCACAAAT

Gene: Shewana3_1639: superoxide dismutase [Fe] (EC 1.15.1.1)
*
Shewanella sp MR-4

Site:
position = -91
score = 4.26429
sequence = AACAATGATTCACATCACAAAT

Gene: Shewmr4_1572: superoxide dismutase [Fe] (EC 1.15.1.1)
*
Shewanella sp MR-7

Site:
position = -91
score = 4.26429
sequence = AACAATGATTCACATCACAAAT

Gene: Shewmr7_1647: superoxide dismutase [Fe] (EC 1.15.1.1)
*
Shewanella baltica OS155

Site:
position = -90
score = 4.26429
sequence = AACAATGATTCACATCACAAAT

Gene: Sbal_1782: superoxide dismutase [Fe] (EC 1.15.1.1)
*
Shewanella denitrificans OS217

Site:
position = -106
score = 4.30949
sequence = AACAATGATGCACATCACAAAA

Gene: Sden_1639: superoxide dismutase [Fe] (EC 1.15.1.1)
*
Shewanella frigidimarina NCIMB 400

Site:
position = -102
score = 4.23581
sequence = AACAATGATTCACATCACAAAA

Gene: Sfri_1747: superoxide dismutase [Fe] (EC 1.15.1.1)
*
Shewanella amazonensis SB2B

Site:
position = -91
score = 4.2131
sequence = AAGAATGATTCACATCACAGAT

Gene: Sama_1920: superoxide dismutase [Fe] (EC 1.15.1.1)
*
Shewanella loihica PV-4

Site:
position = -89
score = 3.79477
sequence = AACAATGATTCACATCACAACT

Gene: Shew_1834: superoxide dismutase [Fe] (EC 1.15.1.1)
 
Shewanella pealeana ATCC 700345

Gene: Spea_1963: superoxide dismutase [Fe] (EC 1.15.1.1)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -93
score = 3.73953
sequence = AACAATGATACACTTCACAACT

Gene: Shal_2336: superoxide dismutase [Fe] (EC 1.15.1.1)
 
Shewanella piezotolerans WP3

Gene: swp_2754: superoxide dismutase [Fe] (EC 1.15.1.1)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_2445: superoxide dismutase [Fe] (EC 1.15.1.1)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_2159: superoxide dismutase [Fe] (EC 1.15.1.1)
superoxide dismutase [Fe] (EC 1.15.1.1)
 
CRON 62.
ccmA
*
Shewanella oneidensis MR-1

Site:
position = -222
score = 4.2202
sequence = TTTTGTGATTAGAATCTCAGCA

Gene: SO0263: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
*
Shewanella putrefaciens CN-32

Site:
position = -213
score = 3.91053
sequence = TTTTGTGATTAGAATCTCAGCG

Gene: Sputcn32_3727: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
*
Shewanella sp W3-18-1

Site:
position = -213
score = 3.91053
sequence = TTTTGTGATTAGAATCTCAGCG

Gene: Sputw3181_0188: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
*
Shewanella sp ANA-3

Site:
position = -222
score = 4.2202
sequence = TTTTGTGATTAGAATCTCAGCA

Gene: Shewana3_0231: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
*
Shewanella sp MR-4

Site:
position = -222
score = 4.2202
sequence = TTTTGTGATTAGAATCTCAGCA

Gene: Shewmr4_0231: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
*
Shewanella sp MR-7

Site:
position = -222
score = 3.91053
sequence = TTTTGTGATTAGAATCTCAGCG

Gene: Shewmr7_0226: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
*
Shewanella baltica OS155

Site:
position = -212
score = 4.44046
sequence = TTTTGTGATTAGAATCTCAACA

Gene: Sbal_0228: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
*
Shewanella denitrificans OS217

Site:
position = -186
score = 3.9967
sequence = TTTTGTGATAAGCCTCCCAGCT

Gene: Sden_3569: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
*
Shewanella frigidimarina NCIMB 400

Site:
position = -213
score = 4.15994
sequence = TTTTGTGATAACAATCTCAGCT

Gene: Sfri_0179: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
*
Shewanella amazonensis SB2B

Site:
position = -207
score = 3.79572
sequence = TTTTGTGAGTTCCCTCCCAGCT

Gene: Sama_0245: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
*
Shewanella loihica PV-4

Site:
position = -223
score = 4.83884
sequence = TTTTGTGATTAATATCAGAATT

Gene: Shew_0190: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
*
Shewanella pealeana ATCC 700345

Site:
position = -112
score = 3.75256
sequence = ATATTCGAACTACATCAAATTG

Site:
position = -212
score = 4.13455
sequence = TTTTGTGATATTAATCTCGCCA

Gene: Spea_0215: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
*
Shewanella halifaxensis HAW-EB4

Site:
position = -212
score = 3.937
sequence = TTTTGTGACATAAACCGTACTA

Site:
position = -112
score = 3.75256
sequence = ATATTCGAACTACATCAAATTG

Gene: Shal_4104: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
*
Shewanella piezotolerans WP3

Site:
position = -112
score = 3.75256
sequence = ATATTCGAACTACATCAAATTG

Site:
position = -212
score = 5.00451
sequence = ATTTGTGATTTAAATCGCGTTA

Gene: swp_2043: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
*
Shewanella sediminis HAW-EB3

Site:
position = -223
score = 4.49775
sequence = TTTTGTGATTTCAATCAAAGCT

Gene: Ssed_4287: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
*
Shewanella woodyi ATCC 51908

Site:
position = -224
score = 4.15542
sequence = TTTTATGACTTTAATCAAAGTA

Gene: Swoo_4659: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
ccmB
 
Shewanella oneidensis MR-1

Gene: SO0262: ABC transporter involved in cytochrome c biogenesis, CcmB subunit
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3728: ABC transporter involved in cytochrome c biogenesis, CcmB subunit
 
Shewanella sp W3-18-1

Gene: Sputw3181_0187: ABC transporter involved in cytochrome c biogenesis, CcmB subunit
 
Shewanella sp ANA-3

Gene: Shewana3_0230: ABC transporter involved in cytochrome c biogenesis, CcmB subunit
 
Shewanella sp MR-4

Gene: Shewmr4_0230: ABC transporter involved in cytochrome c biogenesis, CcmB subunit
 
Shewanella sp MR-7

Gene: Shewmr7_0225: ABC transporter involved in cytochrome c biogenesis, CcmB subunit
 
Shewanella baltica OS155

Gene: Sbal_0227: ABC transporter involved in cytochrome c biogenesis, CcmB subunit
 
Shewanella denitrificans OS217

Gene: Sden_3570: ABC transporter involved in cytochrome c biogenesis, CcmB subunit
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0178: ABC transporter involved in cytochrome c biogenesis, CcmB subunit
 
Shewanella amazonensis SB2B

Gene: Sama_0244: ABC transporter involved in cytochrome c biogenesis, CcmB subunit
 
Shewanella loihica PV-4

Gene: Shew_0189: ABC transporter involved in cytochrome c biogenesis, CcmB subunit
 
Shewanella pealeana ATCC 700345

Gene: Spea_0214: ABC transporter involved in cytochrome c biogenesis, CcmB subunit
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_4105: ABC transporter involved in cytochrome c biogenesis, CcmB subunit
 
Shewanella piezotolerans WP3

Gene: swp_2042: ABC transporter involved in cytochrome c biogenesis, CcmB subunit
 
Shewanella sediminis HAW-EB3

Gene: Ssed_4288: ABC transporter involved in cytochrome c biogenesis, CcmB subunit
 
Shewanella woodyi ATCC 51908

Gene: Swoo_4660: ABC transporter involved in cytochrome c biogenesis, CcmB subunit
ABC transporter involved in cytochrome c biogenesis, CcmB subunit
ccmC
 
Shewanella oneidensis MR-1

Gene: SO0261: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3729: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
 
Shewanella sp W3-18-1

Gene: Sputw3181_0186: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
 
Shewanella sp ANA-3

Gene: Shewana3_0229: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
 
Shewanella sp MR-4

Gene: Shewmr4_0229: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
 
Shewanella sp MR-7

Gene: Shewmr7_0224: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
 
Shewanella baltica OS155

Gene: Sbal_0226: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
 
Shewanella denitrificans OS217

Gene: Sden_3571: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0177: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
 
Shewanella amazonensis SB2B

Gene: Sama_0243: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
 
Shewanella loihica PV-4

Gene: Shew_0188: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
 
Shewanella pealeana ATCC 700345

Gene: Spea_0213: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_4106: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
 
Shewanella piezotolerans WP3

Gene: swp_2041: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
 
Shewanella sediminis HAW-EB3

Gene: Ssed_4289: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
 
Shewanella woodyi ATCC 51908

Gene: Swoo_4661: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
ccmD
 
Shewanella oneidensis MR-1

Gene: SO0260: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3730: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
 
Shewanella sp W3-18-1

Gene: Sputw3181_0185: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
 
Shewanella sp ANA-3

Gene: Shewana3_0228: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
 
Shewanella sp MR-4

Gene: Shewmr4_0228: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
 
Shewanella sp MR-7

Gene: Shewmr7_0223: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
 
Shewanella baltica OS155

Gene: Sbal_0225: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
 
Shewanella denitrificans OS217

Gene: Sden_3572: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0176: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
 
Shewanella amazonensis SB2B

Gene: Sama_0242: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
 
Shewanella loihica PV-4

Gene: Shew_0187: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
 
Shewanella pealeana ATCC 700345

Gene: Spea_0212: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_4107: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
 
Shewanella piezotolerans WP3

Gene: swp_2040: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
 
Shewanella sediminis HAW-EB3

Gene: Ssed_4290: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
 
Shewanella woodyi ATCC 51908

Gene: Swoo_4662: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
ccmE
 
Shewanella oneidensis MR-1

Gene: SO0259: cytochrome c-type biogenesis protein CcmE, heme chaperone
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3731: cytochrome c-type biogenesis protein CcmE, heme chaperone
 
Shewanella sp W3-18-1

Gene: Sputw3181_0184: cytochrome c-type biogenesis protein CcmE, heme chaperone
 
Shewanella sp ANA-3

Gene: Shewana3_0227: cytochrome c-type biogenesis protein CcmE, heme chaperone
 
Shewanella sp MR-4

Gene: Shewmr4_0227: cytochrome c-type biogenesis protein CcmE, heme chaperone
 
Shewanella sp MR-7

Gene: Shewmr7_0222: cytochrome c-type biogenesis protein CcmE, heme chaperone
 
Shewanella baltica OS155

Gene: Sbal_0224: cytochrome c-type biogenesis protein CcmE, heme chaperone
 
Shewanella denitrificans OS217

Gene: Sden_3573: cytochrome c-type biogenesis protein CcmE, heme chaperone
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0175: cytochrome c-type biogenesis protein CcmE, heme chaperone
 
Shewanella amazonensis SB2B

Gene: Sama_0241: cytochrome c-type biogenesis protein CcmE, heme chaperone
 
Shewanella loihica PV-4

Gene: Shew_0186: cytochrome c-type biogenesis protein CcmE, heme chaperone
 
Shewanella pealeana ATCC 700345

Gene: Spea_0211: cytochrome c-type biogenesis protein CcmE, heme chaperone
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_4108: cytochrome c-type biogenesis protein CcmE, heme chaperone
 
Shewanella piezotolerans WP3

Gene: swp_2039: cytochrome c-type biogenesis protein CcmE, heme chaperone
 
Shewanella sediminis HAW-EB3

Gene: Ssed_4291: cytochrome c-type biogenesis protein CcmE, heme chaperone
 
Shewanella woodyi ATCC 51908

Gene: Swoo_4663: cytochrome c-type biogenesis protein CcmE, heme chaperone
cytochrome c-type biogenesis protein CcmE, heme chaperone
 
CRON 63.
rarD
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4

Gene: Shew_3322: RarD protein
*
Shewanella pealeana ATCC 700345

Site:
position = -85
score = 3.9001
sequence = CAAGGTGATTCAAGTCACACTC

Gene: Spea_1861: RarD protein
*
Shewanella halifaxensis HAW-EB4

Site:
position = -85
score = 4.2445
sequence = CAGAGTGATTCAAGTCACACTT

Gene: Shal_2568: RarD protein
 
Shewanella piezotolerans WP3
*
Shewanella sediminis HAW-EB3

Site:
position = -88
score = 4.77918
sequence = TAGAGTGATCCAGCTCACATAC

Gene: Ssed_0706: RarD protein
*
Shewanella woodyi ATCC 51908

Site:
position = -44
score = 4.50668
sequence = CATAGTGATCAATATCACATTC

Gene: Swoo_4258: RarD protein
RarD protein
 
CRON 64.
nqrA-2
*
Shewanella oneidensis MR-1

Site:
position = -129
score = 4.34811
sequence = CAGCGTGATTGCGATCGCATTT

Gene: SO1103: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)
*
Shewanella putrefaciens CN-32

Site:
position = -129
score = 4.34811
sequence = CAGCGTGATTGCGATCGCATTT

Gene: Sputcn32_0940: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)
*
Shewanella sp W3-18-1

Site:
position = -129
score = 4.34811
sequence = CAGCGTGATTGCGATCGCATTT

Gene: Sputw3181_3236: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)
*
Shewanella sp ANA-3

Site:
position = -129
score = 4.34811
sequence = CAGCGTGATTGCGATCGCATTT

Gene: Shewana3_0938: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)
*
Shewanella sp MR-4

Site:
position = -129
score = 4.34811
sequence = CAGCGTGATTGCGATCGCATTT

Gene: Shewmr4_0936: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)
*
Shewanella sp MR-7

Site:
position = -129
score = 4.34811
sequence = CAGCGTGATTGCGATCGCATTT

Gene: Shewmr7_0974: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)
*
Shewanella baltica OS155

Site:
position = -128
score = 4.34811
sequence = CAGCGTGATTGCGATCGCATTT

Gene: Sbal_0924: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)
*
Shewanella denitrificans OS217

Site:
position = -128
score = 4.31963
sequence = CAGCGTGATTGCGATCGCATTA

Gene: Sden_0982: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)
*
Shewanella frigidimarina NCIMB 400

Site:
position = -127
score = 4.27497
sequence = CAGCGTGATTATGATCGCATTT

Gene: Sfri_0949: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)
*
Shewanella amazonensis SB2B

Site:
position = -127
score = 4.34811
sequence = CAGCGTGATTGCGATCGCATTT

Gene: Sama_2539: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)
*
Shewanella loihica PV-4

Site:
position = -131
score = 4.34811
sequence = CAGCGTGATTGCGATCGCATTT

Site:
position = -73
score = 4.13073
sequence = ATGTTTGAAATCTATCTCATTT

Gene: Shew_2881: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)
*
Shewanella pealeana ATCC 700345

Site:
position = -133
score = 4.42614
sequence = CAGCGTGATTCTGATCGCATTT

Gene: Spea_3103: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -127
score = 3.73326
sequence = CAGCGTGATTACAGTCGCACTT

Gene: Shal_3187: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)
*
Shewanella piezotolerans WP3

Site:
position = -132
score = 4.34811
sequence = CAGCGTGATTGCGATCGCATTT

Gene: swp_1167: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)
*
Shewanella sediminis HAW-EB3

Site:
position = -130
score = 4.13099
sequence = CAGCGTGATTGCGGTCGCATTT

Gene: Ssed_3431: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)
*
Shewanella woodyi ATCC 51908

Site:
position = -46
score = 4.04855
sequence = CAGCGTGATTGCGGTCGCAAAT

Gene: Swoo_3617: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)
Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)
nqrB-2
 
Shewanella oneidensis MR-1

Gene: SO1104: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0941: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)
 
Shewanella sp W3-18-1

Gene: Sputw3181_3235: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)
 
Shewanella sp ANA-3

Gene: Shewana3_0939: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)
 
Shewanella sp MR-4

Gene: Shewmr4_0937: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)
 
Shewanella sp MR-7

Gene: Shewmr7_0975: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)
 
Shewanella baltica OS155

Gene: Sbal_0925: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)
 
Shewanella denitrificans OS217

Gene: Sden_0983: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0950: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)
 
Shewanella amazonensis SB2B

Gene: Sama_2538: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)
 
Shewanella loihica PV-4

Gene: Shew_2880: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)
 
Shewanella pealeana ATCC 700345

Gene: Spea_3102: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3186: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)
 
Shewanella piezotolerans WP3

Gene: swp_1168: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_3430: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3616: Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)
Na(+)-translocating NADH-quinone reductase subunit B (EC 1.6.5.-)
nqrC-2
 
Shewanella oneidensis MR-1

Gene: SO1105: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0942: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)
 
Shewanella sp W3-18-1

Gene: Sputw3181_3234: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)
 
Shewanella sp ANA-3

Gene: Shewana3_0940: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)
 
Shewanella sp MR-4

Gene: Shewmr4_0938: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)
 
Shewanella sp MR-7

Gene: Shewmr7_0976: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)
 
Shewanella baltica OS155

Gene: Sbal_0926: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)
 
Shewanella denitrificans OS217

Gene: Sden_0984: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0951: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)
 
Shewanella amazonensis SB2B

Gene: Sama_2537: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)
 
Shewanella loihica PV-4

Gene: Shew_2879: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)
 
Shewanella pealeana ATCC 700345

Gene: Spea_3101: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3185: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)
 
Shewanella piezotolerans WP3

Gene: swp_1169: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_3429: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3615: Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)
Na(+)-translocating NADH-quinone reductase subunit C (EC 1.6.5.-)
nqrD-1
 
Shewanella oneidensis MR-1

Gene: SO1106: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0943: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)
 
Shewanella sp W3-18-1

Gene: Sputw3181_3233: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)
 
Shewanella sp ANA-3

Gene: Shewana3_0941: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)
 
Shewanella sp MR-4

Gene: Shewmr4_0939: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)
 
Shewanella sp MR-7

Gene: Shewmr7_0977: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)
 
Shewanella baltica OS155

Gene: Sbal_0927: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)
 
Shewanella denitrificans OS217

Gene: Sden_0985: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0952: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)
 
Shewanella amazonensis SB2B

Gene: Sama_2536: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)
 
Shewanella loihica PV-4

Gene: Shew_2878: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)
 
Shewanella pealeana ATCC 700345

Gene: Spea_3100: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3184: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)
 
Shewanella piezotolerans WP3

Gene: swp_1170: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_3428: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3614: Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)
Na(+)-translocating NADH-quinone reductase subunit D (EC 1.6.5.-)
nqrE-2
 
Shewanella oneidensis MR-1

Gene: SO1107: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0944: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)
 
Shewanella sp W3-18-1

Gene: Sputw3181_3232: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)
 
Shewanella sp ANA-3

Gene: Shewana3_0942: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)
 
Shewanella sp MR-4

Gene: Shewmr4_0940: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)
 
Shewanella sp MR-7

Gene: Shewmr7_0978: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)
 
Shewanella baltica OS155

Gene: Sbal_0928: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)
 
Shewanella denitrificans OS217

Gene: Sden_0986: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0953: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)
 
Shewanella amazonensis SB2B

Gene: Sama_2535: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)
 
Shewanella loihica PV-4

Gene: Shew_2877: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)
 
Shewanella pealeana ATCC 700345

Gene: Spea_3099: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3183: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)
 
Shewanella piezotolerans WP3

Gene: swp_1171: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_3427: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3613: Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)
Na(+)-translocating NADH-quinone reductase subunit E (EC 1.6.5.-)
nqrF-2
 
Shewanella oneidensis MR-1

Gene: SO1108: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0945: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)
 
Shewanella sp W3-18-1

Gene: Sputw3181_3231: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)
 
Shewanella sp ANA-3

Gene: Shewana3_0943: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)
 
Shewanella sp MR-4

Gene: Shewmr4_0941: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)
 
Shewanella sp MR-7

Gene: Shewmr7_0979: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)
 
Shewanella baltica OS155

Gene: Sbal_0929: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)
 
Shewanella denitrificans OS217

Gene: Sden_0987: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0954: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)
 
Shewanella amazonensis SB2B

Gene: Sama_2534: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)
 
Shewanella loihica PV-4

Gene: Shew_2876: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)
 
Shewanella pealeana ATCC 700345

Gene: Spea_3098: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3182: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)
 
Shewanella piezotolerans WP3

Gene: swp_1172: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_3426: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3612: Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)
Na(+)-translocating NADH-quinone reductase subunit F (EC 1.6.5.-)
 
CRON 65.
hemC
*
Shewanella oneidensis MR-1

Site:
position = -132
score = 4.52477
sequence = AAATGAGAGGTCCATCACACTT

Site:
position = -172
score = 3.8681
sequence = GATTGTGCTCATGTTAACACTT

Gene: SO4313: Porphobilinogen deaminase (EC 2.5.1.61)
*
Shewanella putrefaciens CN-32

Site:
position = -173
score = 4.13546
sequence = AAGTGTGCTTATGTTAACACTT

Site:
position = -133
score = 5.19295
sequence = AAATGAGATCTGCATCACATTT

Gene: Sputcn32_3587: Porphobilinogen deaminase (EC 2.5.1.61)
*
Shewanella sp W3-18-1

Site:
position = -173
score = 4.13546
sequence = AAGTGTGCTTATGTTAACACTT

Site:
position = -133
score = 5.19295
sequence = AAATGAGATCTGCATCACATTT

Gene: Sputw3181_3726: Porphobilinogen deaminase (EC 2.5.1.61)
*
Shewanella sp ANA-3

Site:
position = -172
score = 4.23847
sequence = AAGTGTGCTCATGTTAACACTT

Site:
position = -132
score = 4.26867
sequence = AAATGAGAAGTTCGTCACACTT

Gene: Shewana3_0386: Porphobilinogen deaminase (EC 2.5.1.61)
*
Shewanella sp MR-4

Site:
position = -132
score = 4.26867
sequence = AAATGAGAAGTTCGTCACACTT

Site:
position = -172
score = 4.23847
sequence = AAGTGTGCTCATGTTAACACTT

Gene: Shewmr4_0388: Porphobilinogen deaminase (EC 2.5.1.61)
*
Shewanella sp MR-7

Site:
position = -132
score = 4.26867
sequence = AAATGAGAAGTTCGTCACACTT

Site:
position = -172
score = 4.23847
sequence = AAGTGTGCTCATGTTAACACTT

Gene: Shewmr7_3638: Porphobilinogen deaminase (EC 2.5.1.61)
*
Shewanella baltica OS155

Site:
position = -132
score = 4.91933
sequence = AAATGTGAAGTCCGTCACACTT

Gene: Sbal_4000: Porphobilinogen deaminase (EC 2.5.1.61)
*
Shewanella denitrificans OS217

Site:
position = -85
score = 3.90673
sequence = AAATCTGCTTTGCTTCAAACAT

Gene: Sden_0388: Porphobilinogen deaminase (EC 2.5.1.61)
*
Shewanella frigidimarina NCIMB 400

Site:
position = -167
score = 3.96383
sequence = AATGGTGATCATCGTAGCATTT

Gene: Sfri_0440: Porphobilinogen deaminase (EC 2.5.1.61)
*
Shewanella amazonensis SB2B

Site:
position = -89
score = 5.14021
sequence = ATTTGCGATAGAGATCACATTT

Gene: Sama_3254: Porphobilinogen deaminase (EC 2.5.1.61)
*
Shewanella loihica PV-4

Site:
position = -119
score = 4.7007
sequence = ATTTGAGAGCTGGATCACACTT

Gene: Shew_0318: Porphobilinogen deaminase (EC 2.5.1.61)
*
Shewanella pealeana ATCC 700345

Site:
position = -133
score = 4.98423
sequence = AAATGCGATCAAGATCACACTT

Gene: Spea_0373: Porphobilinogen deaminase (EC 2.5.1.61)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -133
score = 5.10167
sequence = AAATGTGATCAACATCACGCTT

Gene: Shal_3917: Porphobilinogen deaminase (EC 2.5.1.61)
*
Shewanella piezotolerans WP3

Site:
position = -40
score = 4.29959
sequence = AAATGTAATCCGTATCGCAACA

Gene: swp_0402: Porphobilinogen deaminase (EC 2.5.1.61)
*
Shewanella sediminis HAW-EB3

Site:
position = -133
score = 4.87801
sequence = AAATGAGATCAAGATCACACTT

Gene: Ssed_4133: Porphobilinogen deaminase (EC 2.5.1.61)
*
Shewanella woodyi ATCC 51908

Site:
position = -229
score = 4.62137
sequence = AAATGAGACCAAGATCACACTT

Gene: Swoo_0483: Porphobilinogen deaminase (EC 2.5.1.61)
Porphobilinogen deaminase (EC 2.5.1.61)
hemD
 
Shewanella oneidensis MR-1

Gene: SO4314: Uroporphyrinogen-III synthase (EC 4.2.1.75)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3588: Uroporphyrinogen-III synthase (EC 4.2.1.75)
 
Shewanella sp W3-18-1

Gene: Sputw3181_3727: Uroporphyrinogen-III synthase (EC 4.2.1.75)
 
Shewanella sp ANA-3

Gene: Shewana3_0385: Uroporphyrinogen-III synthase (EC 4.2.1.75)
 
Shewanella sp MR-4

Gene: Shewmr4_0387: Uroporphyrinogen-III synthase (EC 4.2.1.75)
 
Shewanella sp MR-7

Gene: Shewmr7_3639: Uroporphyrinogen-III synthase (EC 4.2.1.75)
 
Shewanella baltica OS155

Gene: Sbal_4001: Uroporphyrinogen-III synthase (EC 4.2.1.75)
 
Shewanella denitrificans OS217

Gene: Sden_0387: Uroporphyrinogen-III synthase (EC 4.2.1.75)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0439: Uroporphyrinogen-III synthase (EC 4.2.1.75)
 
Shewanella amazonensis SB2B

Gene: Sama_3255: Uroporphyrinogen-III synthase (EC 4.2.1.75)
 
Shewanella loihica PV-4

Gene: Shew_0317: Uroporphyrinogen-III synthase (EC 4.2.1.75)
 
Shewanella pealeana ATCC 700345

Gene: Spea_0372: Uroporphyrinogen-III synthase (EC 4.2.1.75)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3918: Uroporphyrinogen-III synthase (EC 4.2.1.75)
 
Shewanella piezotolerans WP3

Gene: swp_0400: Uroporphyrinogen-III synthase (EC 4.2.1.75)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_4134: Uroporphyrinogen-III synthase (EC 4.2.1.75)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0482: Uroporphyrinogen-III synthase (EC 4.2.1.75)
Uroporphyrinogen-III synthase (EC 4.2.1.75)
hemX
 
Shewanella oneidensis MR-1

Gene: SO4315: Homolog of E. coli HemX protein
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3589: Homolog of E. coli HemX protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_3728: Homolog of E. coli HemX protein
 
Shewanella sp ANA-3

Gene: Shewana3_0384: Homolog of E. coli HemX protein
 
Shewanella sp MR-4

Gene: Shewmr4_0386: Homolog of E. coli HemX protein
 
Shewanella sp MR-7

Gene: Shewmr7_3640: Homolog of E. coli HemX protein
 
Shewanella baltica OS155

Gene: Sbal_4002: Homolog of E. coli HemX protein
 
Shewanella denitrificans OS217

Gene: Sden_0386: Homolog of E. coli HemX protein
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0438: Homolog of E. coli HemX protein
 
Shewanella amazonensis SB2B

Gene: Sama_3256: Homolog of E. coli HemX protein
 
Shewanella loihica PV-4

Gene: Shew_0316: Homolog of E. coli HemX protein
 
Shewanella pealeana ATCC 700345

Gene: Spea_0371: Homolog of E. coli HemX protein
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3919: Homolog of E. coli HemX protein
 
Shewanella piezotolerans WP3

Gene: swp_0399: Homolog of E. coli HemX protein
 
Shewanella sediminis HAW-EB3

Gene: Ssed_4135: Homolog of E. coli HemX protein
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0481: Homolog of E. coli HemX protein
Homolog of E. coli HemX protein
hemY
 
Shewanella oneidensis MR-1

Gene: SO4316: HemY domain-containing protein
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3590: HemY domain-containing protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_3729: HemY domain-containing protein
 
Shewanella sp ANA-3

Gene: Shewana3_0383: HemY domain-containing protein
 
Shewanella sp MR-4

Gene: Shewmr4_0385: HemY domain-containing protein
 
Shewanella sp MR-7

Gene: Shewmr7_3641: HemY domain-containing protein
 
Shewanella baltica OS155

Gene: Sbal_4003: HemY domain-containing protein
 
Shewanella denitrificans OS217

Gene: Sden_0385: HemY domain-containing protein
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0437: HemY domain-containing protein
 
Shewanella amazonensis SB2B

Gene: Sama_3257: HemY domain-containing protein
 
Shewanella loihica PV-4

Gene: Shew_0315: HemY domain-containing protein
 
Shewanella pealeana ATCC 700345

Gene: Spea_0370: HemY domain-containing protein
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3920: HemY domain-containing protein
 
Shewanella piezotolerans WP3

Gene: swp_0398: HemY domain-containing protein
 
Shewanella sediminis HAW-EB3

Gene: Ssed_4136: HemY domain-containing protein
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0480: HemY domain-containing protein
HemY domain-containing protein
 
CRON 66.