Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MntR - Corynebacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Corynebacterium amycolatum SK46 5 1
Corynebacterium aurimucosum ATCC 700975 5 2
Corynebacterium diphtheriae NCTC 13129 7 2
Corynebacterium efficiens YS-314 1 1
Corynebacterium glutamicum ATCC 13032 1 1
Corynebacterium jeikeium K411 6 3
Corynebacterium kroppenstedtii DSM 44385 6 3
Corynebacterium urealyticum DSM 7109 2 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
mntA
*
Corynebacterium amycolatum SK46

Site:
position = -153
score = 6.11441
sequence = AAGTTCAATGGGTTGAAAAT

Gene: CORAM0001_0534: Manganese ABC transporter, substrate-binding protein
 
Corynebacterium aurimucosum ATCC 700975
*
Corynebacterium diphtheriae NCTC 13129

Site:
position = -91
score = 5.64255
sequence = AAATTCAATACGCTGAACAG

Gene: DIP0615: Manganese ABC transporter, substrate-binding protein
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109

Gene: cur_1147: Manganese ABC transporter, substrate-binding protein
Manganese ABC transporter, substrate-binding protein
mntB
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_0535: Manganese ABC transporter, ATP-binding protein
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP0616: Manganese ABC transporter, ATP-binding protein
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109

Gene: cur_1146: Manganese ABC transporter, ATP-binding protein
Manganese ABC transporter, ATP-binding protein
mntC
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_0536: Manganese ABC transporter, permease protein 1
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP0617: Manganese ABC transporter, permease protein 1
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109

Gene: cur_1145: Manganese ABC transporter, permease protein 1
Manganese ABC transporter, permease protein 1
mntD
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_0537: Manganese ABC transporter, permease protein 2
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP0618: Manganese ABC transporter, permease protein 2
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109

Gene: cur_1144: Manganese ABC transporter, permease protein 2
Manganese ABC transporter, permease protein 2
mntR
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_0538: Mn-dependent transcriptional regulator MntR, DtxR family
*
Corynebacterium aurimucosum ATCC 700975

Site:
position = -76
score = 6.49088
sequence = ATGTTCAATGGATTGAACTT

Gene: cauri_0335: Mn-dependent transcriptional regulator MntR, DtxR family
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP0619: Mn-dependent transcriptional regulator MntR, DtxR family
 
Corynebacterium efficiens YS-314

Gene: CE0651: Mn-dependent transcriptional regulator MntR, DtxR family
 
Corynebacterium glutamicum ATCC 13032

Gene: cg0741: Mn-dependent transcriptional regulator MntR, DtxR family
*
Corynebacterium jeikeium K411

Site:
position = -86
score = 6.15268
sequence = ATGTTCAATGTATTGAACAA

Gene: jk1485: Mn-dependent transcriptional regulator MntR, DtxR family
*
Corynebacterium kroppenstedtii DSM 44385

Site:
position = -143
score = 5.71292
sequence = AAGTTCAATGCAATGTATTT

Gene: ckrop_1571: Mn-dependent transcriptional regulator MntR, DtxR family
 
Corynebacterium urealyticum DSM 7109

Gene: cur_0586: Mn-dependent transcriptional regulator MntR, DtxR family
Mn-dependent transcriptional regulator MntR, DtxR family
 
CRON 2.
mtsA
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032
*
Corynebacterium jeikeium K411

Site:
position = -57
score = 6.35707
sequence = TTGTTCAATACATTGAACAT

Site:
position = -18
score = 4.57856
sequence = AGGTTTATTACCTTGAAAAT

Gene: jk1486: Manganese ABC transporter, substrate-binding protein
*
Corynebacterium kroppenstedtii DSM 44385

Site:
position = -177
score = 5.90017
sequence = AAATACATTGCATTGAACTT

Gene: ckrop_1572: Manganese ABC transporter, substrate-binding protein
 
Corynebacterium urealyticum DSM 7109
Manganese ABC transporter, substrate-binding protein
mtsB
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411

Gene: jk1487: Manganese ABC transporter, ATP-binding protein
 
Corynebacterium kroppenstedtii DSM 44385

Gene: ckrop_1573: Manganese ABC transporter, ATP-binding protein
*
Corynebacterium urealyticum DSM 7109

Site:
position = -56
score = 6.63223
sequence = AAGTTCAATACATTGAACTT

Gene: cur_0526: Manganese ABC transporter, ATP-binding protein
Manganese ABC transporter, ATP-binding protein
mtsC
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411

Gene: jk1488: Manganese ABC transporter, permease protein
 
Corynebacterium kroppenstedtii DSM 44385

Gene: ckrop_1574: Manganese ABC transporter, permease protein
 
Corynebacterium urealyticum DSM 7109
Manganese ABC transporter, permease protein
mtsCA
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109

Gene: cur_0525: Manganese ABC transporter, permease and substrate-binding protein
Manganese ABC transporter, permease and substrate-binding protein
 
CRON 3.
mntT
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_0972: Predicted manganese transporter
 
Corynebacterium diphtheriae NCTC 13129
*
Corynebacterium efficiens YS-314

Site:
position = -34
score = 6.03261
sequence = ATGTTCATGCCATTGAACAT

Gene: CE1566: Predicted manganese transporter
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -34
score = 6.30795
sequence = CTGTTCAATGCGTTGAACAT

Gene: cg1623: Predicted manganese transporter
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Predicted manganese transporter
 
CRON 4.
mntM
 
Corynebacterium amycolatum SK46
*
Corynebacterium aurimucosum ATCC 700975

Site:
position = -51
score = 6.66413
sequence = AAGTTCAATCCATTGAACAT

Gene: cauri_0334: Manganese ABC transporter, substrate-binding protein
 2
Corynebacterium diphtheriae NCTC 13129

Gene: DIP0169: Manganese ABC transporter, substrate-binding protein

Gene: DIP0173: Manganese ABC transporter, substrate-binding protein
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Manganese ABC transporter, substrate-binding protein
mntN
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_0333: Manganese ABC transporter, ATP-binding protein
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP0170: Manganese ABC transporter, ATP-binding protein
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Manganese ABC transporter, ATP-binding protein
mntO
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_0332: Manganese ABC transporter, permease protein 2
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP0171: Manganese ABC transporter, permease protein 2
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Manganese ABC transporter, permease protein 1
mntQ
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_0331: Manganese ABC transporter, permease protein 2
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP0172: Manganese ABC transporter, permease protein 2
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Manganese ABC transporter, permease protein 2
 
CRON 5.
nrdI2
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_1892: Ribonucleotide reduction protein NrdI
*
Corynebacterium diphtheriae NCTC 13129

Site:
position = -81
score = 6.7456
sequence = AAGTTCAATGCATTGAACTT

Gene: DIP1923: Ribonucleotide reduction protein NrdI
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032
*
Corynebacterium jeikeium K411

Site:
position = -123
score = 5.16116
sequence = AAGTTCAATACATTGTTGTT

Site:
position = -100
score = 4.80419
sequence = AAGTTCGGGTCATTGAACTT

Gene: jk0226: Ribonucleotide reduction protein NrdI
*
Corynebacterium kroppenstedtii DSM 44385

Site:
position = -72
score = 5.63145
sequence = AAGTTCAAGCCATTGAATAA

Gene: ckrop_3000: Ribonucleotide reduction protein NrdI
 
Corynebacterium urealyticum DSM 7109

Gene: cur_0129: Ribonucleotide reduction protein NrdI
Ribonucleotide reduction protein NrdI
nrdF2
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_1416: Ribonucleoside-diphosphate reductase, beta subunit
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_1894: Ribonucleoside-diphosphate reductase, beta subunit
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP1924: Ribonucleoside-diphosphate reductase, beta subunit
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411

Gene: jk0225: Ribonucleoside-diphosphate reductase, beta subunit
 
Corynebacterium kroppenstedtii DSM 44385

Gene: ckrop_0016: Ribonucleoside-diphosphate reductase, beta subunit
 
Corynebacterium urealyticum DSM 7109

Gene: cur_0128: Ribonucleoside-diphosphate reductase, beta subunit
Ribonucleoside-diphosphate reductase, beta subunit
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD