Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur2 - Various betaproteobacteria

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Thiobacillus denitrificans
Methylobacillus flagellatus KT
Methylophilales bacterium HTCC2181
Methylotenera mobilis JLW8
Nitrosomonas europaea ATCC 19718
Nitrosospira multiformis ATCC 25196
Chromobacterium violaceum ATCC 12472 5 1
Laribacter hongkongensis HLHK9 6 1
Neisseria meningitidis MC58 4 3
Azoarcus sp. EbN1
Dechloromonas aromatica RCB
Thauera sp. MZ1T
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
zur2
 
Thiobacillus denitrificans
 
Methylobacillus flagellatus KT
 
Methylophilales bacterium HTCC2181
 
Methylotenera mobilis JLW8
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
*
Chromobacterium violaceum ATCC 12472

Site:
position = -137
score = 6.18878
sequence = GCGATGTTATACAGTAACATTAT

Gene: CV3068: Zinc uptake regulation protein Zur
*
Laribacter hongkongensis HLHK9

Site:
position = -47
score = 5.56123
sequence = GTTACGGCATAACATAACGAAAT

Gene: LHK_01344: Zinc uptake regulation protein Zur
 
Neisseria meningitidis MC58

Gene: NMB1266: Zinc uptake regulation protein Zur
 
Azoarcus sp. EbN1
 
Dechloromonas aromatica RCB
 
Thauera sp. MZ1T
Zinc uptake regulation protein Zur
yciC
 
Thiobacillus denitrificans
 
Methylobacillus flagellatus KT
 
Methylophilales bacterium HTCC2181
 
Methylotenera mobilis JLW8
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Chromobacterium violaceum ATCC 12472

Gene: CV3067: Putative zinc chaperone, COG0523 family
 
Laribacter hongkongensis HLHK9

Gene: LHK_01345: Putative zinc chaperone, COG0523 family
 
Neisseria meningitidis MC58

Gene: NMB1263: Putative zinc chaperone, COG0523 family
 
Azoarcus sp. EbN1
 
Dechloromonas aromatica RCB
 
Thauera sp. MZ1T
Putative zinc chaperone, COG0523 family
LHK_01346
 
Thiobacillus denitrificans
 
Methylobacillus flagellatus KT
 
Methylophilales bacterium HTCC2181
 
Methylotenera mobilis JLW8
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Chromobacterium violaceum ATCC 12472
 
Laribacter hongkongensis HLHK9

Gene: LHK_01346: Hypothetical protein
 
Neisseria meningitidis MC58
 
Azoarcus sp. EbN1
 
Dechloromonas aromatica RCB
 
Thauera sp. MZ1T
Hypothetical protein
znuC
 
Thiobacillus denitrificans
 
Methylobacillus flagellatus KT
 
Methylophilales bacterium HTCC2181
 
Methylotenera mobilis JLW8
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Chromobacterium violaceum ATCC 12472

Gene: CV3066: Zinc ABC transporter, ATP-binding protein ZnuC
 
Laribacter hongkongensis HLHK9

Gene: LHK_01347: Zinc ABC transporter, ATP-binding protein ZnuC
*
Neisseria meningitidis MC58

Site:
position = -148
score = 5.8021
sequence = CAAACGTTATACAGTATCATATC

Gene: NMB0588: Zinc ABC transporter, ATP-binding protein ZnuC
 
Azoarcus sp. EbN1

Gene: ebA1812: Zinc ABC transporter, ATP-binding protein ZnuC
 
Dechloromonas aromatica RCB
 
Thauera sp. MZ1T

Gene: Tmz1t_3498: Zinc ABC transporter, ATP-binding protein ZnuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
 
Thiobacillus denitrificans
 
Methylobacillus flagellatus KT
 
Methylophilales bacterium HTCC2181
 
Methylotenera mobilis JLW8
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Chromobacterium violaceum ATCC 12472

Gene: CV3065: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Laribacter hongkongensis HLHK9

Gene: LHK_01348: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Neisseria meningitidis MC58

Gene: NMB0587: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Azoarcus sp. EbN1

Gene: ebA1813: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Dechloromonas aromatica RCB
 
Thauera sp. MZ1T

Gene: Tmz1t_3499: Zinc ABC transporter, inner membrane permease protein ZnuB
Zinc ABC transporter, inner membrane permease protein ZnuB
znuA
 
Thiobacillus denitrificans
 
Methylobacillus flagellatus KT
 
Methylophilales bacterium HTCC2181
 
Methylotenera mobilis JLW8
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Chromobacterium violaceum ATCC 12472

Gene: CV3064: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Laribacter hongkongensis HLHK9

Gene: LHK_01349: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Neisseria meningitidis MC58

Site:
position = -49
score = 5.64634
sequence = GGCTTGTTTTACCATAACAGATG

Gene: NMB0586: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Azoarcus sp. EbN1

Gene: ebA1814: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Dechloromonas aromatica RCB
 
Thauera sp. MZ1T

Gene: Tmz1t_3500: Zinc ABC transporter, periplasmic-binding protein ZnuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
 
CRON 2.
omr
 
Thiobacillus denitrificans
 
Methylobacillus flagellatus KT
 
Methylophilales bacterium HTCC2181
 
Methylotenera mobilis JLW8
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Chromobacterium violaceum ATCC 12472
 
Laribacter hongkongensis HLHK9
*
Neisseria meningitidis MC58

Site:
position = -47
score = 6.42966
sequence = GTAATGTTATATAATAACAAACT

Gene: NMB0964: Predicted zinc-related TonB-dependent outer membrane transporter
 
Azoarcus sp. EbN1
 
Dechloromonas aromatica RCB
 
Thauera sp. MZ1T
Predicted zinc-related TonB-dependent outer membrane transporter
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD