Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PaaR - Rhodobacterales

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Phylum: Alphaproteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 13 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Rhodobacter sphaeroides 2.4.1
Paracoccus denitrificans PD1222 21 4
Jannaschia sp. CCS1
Rhodobacterales bacterium HTCC2654 6 2
Oceanicola granulosus HTCC2516
Oceanicola batsensis HTCC2597
Loktanella vestfoldensis SKA53
Roseovarius sp. 217
Roseovarius nubinhibens ISM
Sulfitobacter sp. EE-36
Silicibacter TM1040 6 2
Silicibacter pomeroyi DSS-3 7 3
Roseobacter sp. MED193 6 2
Hyphomonas neptunium ATCC 15444
Oceanicaulis alexandrii HTCC2633
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
paaF
 
Rhodobacter sphaeroides 2.4.1
*
Paracoccus denitrificans PD1222

Site:
position = -74
score = 6.57811
sequence = ATTGACCGGCCGGTCGGTTTAT

Gene: Pden_4799: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Jannaschia sp. CCS1
*
Rhodobacterales bacterium HTCC2654

Site:
position = -54
score = 6.12994
sequence = ATTGACCGACCAGTCGGTTTAA

Gene: RB2654_06379: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Oceanicola granulosus HTCC2516
 
Oceanicola batsensis HTCC2597
 
Loktanella vestfoldensis SKA53
 
Roseovarius sp. 217
 
Roseovarius nubinhibens ISM
 
Sulfitobacter sp. EE-36
*
Silicibacter TM1040

Site:
position = -78
score = 6.71466
sequence = ATTGACCGTCCGGTCGGTTTAT

Gene: TM1040_0438: Enoyl-CoA hydratase (EC 4.2.1.17)
*
Silicibacter pomeroyi DSS-3

Site:
position = -61
score = 6.4464
sequence = ATTGACCAACCGTTCGGTTTAT

Gene: SPO0740: Enoyl-CoA hydratase (EC 4.2.1.17)
*
Roseobacter sp. MED193

Site:
position = -95
score = 6.71466
sequence = ATTGACCGTCCGGTCGGTTTAT

Gene: MED193_17309: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Enoyl-CoA hydratase (EC 4.2.1.17)
paaY
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_4800: thioesterase superfamily protein
 
Jannaschia sp. CCS1

Gene: Jann_0657: thioesterase superfamily protein
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_06374: thioesterase superfamily protein
 
Oceanicola granulosus HTCC2516
 
Oceanicola batsensis HTCC2597
 
Loktanella vestfoldensis SKA53
 
Roseovarius sp. 217
 
Roseovarius nubinhibens ISM
 
Sulfitobacter sp. EE-36

Gene: EE36_06318: thioesterase superfamily protein
 
Silicibacter TM1040

Gene: TM1040_0439: thioesterase superfamily protein
 
Silicibacter pomeroyi DSS-3

Gene: SPO0741: thioesterase superfamily protein
 
Roseobacter sp. MED193

Gene: MED193_17314: thioesterase superfamily protein
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
thioesterase superfamily protein
paaK
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_4801: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Jannaschia sp. CCS1

Gene: Jann_0656: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_06369: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Oceanicola granulosus HTCC2516
 
Oceanicola batsensis HTCC2597
 
Loktanella vestfoldensis SKA53
 
Roseovarius sp. 217
 
Roseovarius nubinhibens ISM
 
Sulfitobacter sp. EE-36

Gene: EE36_06323: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Silicibacter TM1040

Gene: TM1040_0440: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Silicibacter pomeroyi DSS-3

Gene: SPO0742: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Roseobacter sp. MED193

Gene: MED193_17319: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
paaR
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_4802: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_06364: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Oceanicola granulosus HTCC2516
 
Oceanicola batsensis HTCC2597
 
Loktanella vestfoldensis SKA53
 
Roseovarius sp. 217
 
Roseovarius nubinhibens ISM
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040

Gene: TM1040_0441: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Silicibacter pomeroyi DSS-3

Gene: SPO0743: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Roseobacter sp. MED193

Gene: MED193_17324: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Transcriptional regulator of phenylacetic acid degradation, TetR family
 
CRON 2.
paaJ
 
Rhodobacter sphaeroides 2.4.1
*
Paracoccus denitrificans PD1222

Site:
position = -61
score = 6.02649
sequence = ATTGACCAATCGGTCGGTGAAT

Gene: Pden_4811: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_06329: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
 
Oceanicola granulosus HTCC2516
 
Oceanicola batsensis HTCC2597
 
Loktanella vestfoldensis SKA53
 
Roseovarius sp. 217
 
Roseovarius nubinhibens ISM
 
Sulfitobacter sp. EE-36

Gene: EE36_06698: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3

Gene: SPO0758: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
 
Roseobacter sp. MED193

Gene: MED193_10303: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
paaA
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_4810: Phenylacetate-CoA oxygenase, PaaA subunit
 
Jannaschia sp. CCS1

Gene: Jann_0655: Phenylacetate-CoA oxygenase, PaaA subunit
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_06334: Phenylacetate-CoA oxygenase, PaaA subunit
 
Oceanicola granulosus HTCC2516
 
Oceanicola batsensis HTCC2597
 
Loktanella vestfoldensis SKA53
 
Roseovarius sp. 217
 
Roseovarius nubinhibens ISM
 
Sulfitobacter sp. EE-36

Gene: EE36_06703: Phenylacetate-CoA oxygenase, PaaA subunit
 
Silicibacter TM1040

Gene: TM1040_3724: Phenylacetate-CoA oxygenase, PaaA subunit
 
Silicibacter pomeroyi DSS-3

Gene: SPO0757: Phenylacetate-CoA oxygenase, PaaA subunit
 
Roseobacter sp. MED193

Gene: MED193_10308: Phenylacetate-CoA oxygenase, PaaA subunit
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Phenylacetate-CoA oxygenase, PaaA subunit
paaB
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_4809: Phenylacetate-CoA oxygenase, PaaB subunit
 
Jannaschia sp. CCS1

Gene: Jann_0654: Phenylacetate-CoA oxygenase, PaaB subunit
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_06339: Phenylacetate-CoA oxygenase, PaaB subunit
 
Oceanicola granulosus HTCC2516
 
Oceanicola batsensis HTCC2597
 
Loktanella vestfoldensis SKA53
 
Roseovarius sp. 217
 
Roseovarius nubinhibens ISM
 
Sulfitobacter sp. EE-36

Gene: EE36_06708: Phenylacetate-CoA oxygenase, PaaB subunit
 
Silicibacter TM1040

Gene: TM1040_3725: Phenylacetate-CoA oxygenase, PaaB subunit
 
Silicibacter pomeroyi DSS-3

Gene: SPO0756: Phenylacetate-CoA oxygenase, PaaB subunit
 
Roseobacter sp. MED193

Gene: MED193_10318: Phenylacetate-CoA oxygenase, PaaB subunit
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Phenylacetate-CoA oxygenase, PaaB subunit
paaC
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_4808: Phenylacetate-CoA oxygenase, PaaC subunit
 
Jannaschia sp. CCS1

Gene: Jann_0653: Phenylacetate-CoA oxygenase, PaaC subunit
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_06344: Phenylacetate-CoA oxygenase, PaaC subunit
 
Oceanicola granulosus HTCC2516
 
Oceanicola batsensis HTCC2597
 
Loktanella vestfoldensis SKA53
 
Roseovarius sp. 217
 
Roseovarius nubinhibens ISM
 
Sulfitobacter sp. EE-36

Gene: EE36_06713: Phenylacetate-CoA oxygenase, PaaC subunit
 
Silicibacter TM1040

Gene: TM1040_3726: Phenylacetate-CoA oxygenase, PaaC subunit
 
Silicibacter pomeroyi DSS-3

Gene: SPO0755: Phenylacetate-CoA oxygenase, PaaC subunit
 
Roseobacter sp. MED193

Gene: MED193_10323: Phenylacetate-CoA oxygenase, PaaC subunit
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Phenylacetate-CoA oxygenase, PaaC subunit
paaD
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_4807: Phenylacetate-CoA oxygenase, PaaD subunit
 
Jannaschia sp. CCS1

Gene: Jann_0652: Phenylacetate-CoA oxygenase, PaaD subunit
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_06349: Phenylacetate-CoA oxygenase, PaaD subunit
 
Oceanicola granulosus HTCC2516
 
Oceanicola batsensis HTCC2597
 
Loktanella vestfoldensis SKA53
 
Roseovarius sp. 217
 
Roseovarius nubinhibens ISM
 
Sulfitobacter sp. EE-36

Gene: EE36_06718: Phenylacetate-CoA oxygenase, PaaD subunit
 
Silicibacter TM1040

Gene: TM1040_3727: Phenylacetate-CoA oxygenase, PaaD subunit
 
Silicibacter pomeroyi DSS-3

Gene: SPO0754: Phenylacetate-CoA oxygenase, PaaD subunit
 
Roseobacter sp. MED193

Gene: MED193_10328: Phenylacetate-CoA oxygenase, PaaD subunit
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Phenylacetate-CoA oxygenase, PaaD subunit
paaE
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_4806: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Jannaschia sp. CCS1

Gene: Jann_0651: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_06354: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Oceanicola granulosus HTCC2516
 
Oceanicola batsensis HTCC2597
 
Loktanella vestfoldensis SKA53
 
Roseovarius sp. 217
 
Roseovarius nubinhibens ISM
 
Sulfitobacter sp. EE-36

Gene: EE36_06723: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Silicibacter TM1040

Gene: TM1040_3728: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Silicibacter pomeroyi DSS-3

Gene: SPO0753: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Roseobacter sp. MED193

Gene: MED193_10333: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Pden_4805
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_4805: Phenylacetic acid catabolic protein
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_06359: Phenylacetic acid catabolic protein
 
Oceanicola granulosus HTCC2516
 
Oceanicola batsensis HTCC2597
 
Loktanella vestfoldensis SKA53
 
Roseovarius sp. 217
 
Roseovarius nubinhibens ISM
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3

Gene: SPO0752: Phenylacetic acid catabolic protein
 
Roseobacter sp. MED193

Gene: MED193_10338: Phenylacetic acid catabolic protein
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Phenylacetic acid catabolic protein
paaZ
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_4804: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
 
Jannaschia sp. CCS1

Gene: Jann_0658: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Rhodobacterales bacterium HTCC2654

Site:
position = -66
score = 6.12994
sequence = TTAAACCGACTGGTCGGTCAAT

Gene: RB2654_06384: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
 
Oceanicola granulosus HTCC2516
 
Oceanicola batsensis HTCC2597
 
Loktanella vestfoldensis SKA53
 
Roseovarius sp. 217
 
Roseovarius nubinhibens ISM
 
Sulfitobacter sp. EE-36

Gene: EE36_06728: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Silicibacter TM1040

Site:
position = -104
score = 6.71466
sequence = ATAAACCGACCGGACGGTCAAT

Gene: TM1040_0437: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Silicibacter pomeroyi DSS-3

Site:
position = -90
score = 5.35525
sequence = ATTGACCGACCGTTCGGTCGCG

Gene: SPO0735: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Roseobacter sp. MED193

Site:
position = -114
score = 6.71466
sequence = ATAAACCGACCGGACGGTCAAT

Gene: MED193_17304: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
paaX
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_4812: Phenylacetic acid degradation operon negative regulatory protein paaX
 
Jannaschia sp. CCS1

Gene: Jann_0659: Phenylacetic acid degradation operon negative regulatory protein paaX
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_06389: Phenylacetic acid degradation operon negative regulatory protein paaX
 
Oceanicola granulosus HTCC2516
 
Oceanicola batsensis HTCC2597
 
Loktanella vestfoldensis SKA53
 
Roseovarius sp. 217
 
Roseovarius nubinhibens ISM
 
Sulfitobacter sp. EE-36

Gene: EE36_06733: Phenylacetic acid degradation operon negative regulatory protein paaX
 
Silicibacter TM1040

Gene: TM1040_0436: Phenylacetic acid degradation operon negative regulatory protein paaX
 
Silicibacter pomeroyi DSS-3

Gene: SPO0734: Phenylacetic acid degradation operon negative regulatory protein paaX
 
Roseobacter sp. MED193

Gene: MED193_17299: Phenylacetic acid degradation operon negative regulatory protein paaX
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Phenylacetic acid degradation operon negative regulatory protein paaX
Pden_4813
 
Rhodobacter sphaeroides 2.4.1
*
Paracoccus denitrificans PD1222

Site:
position = -74
score = 5.89843
sequence = ATTGACCGACCGAACGGTTAAC

Gene: Pden_4813: Penicillin G acylase
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Oceanicola batsensis HTCC2597
 
Loktanella vestfoldensis SKA53
 
Roseovarius sp. 217
 
Roseovarius nubinhibens ISM
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Penicillin G acylase
 
CRON 3.
paaZ2
 
Rhodobacter sphaeroides 2.4.1
*
Paracoccus denitrificans PD1222

Site:
position = -20
score = 6.57811
sequence = ATAAACCGACCGGCCGGTCAAT

Gene: paaZ2: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Oceanicola batsensis HTCC2597
 
Loktanella vestfoldensis SKA53
 
Roseovarius sp. 217
 
Roseovarius nubinhibens ISM
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
livK
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_4797: Putative branched-chain amino acid ABC transporter, substrate-binding component
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Oceanicola batsensis HTCC2597
 
Loktanella vestfoldensis SKA53
 
Roseovarius sp. 217
 
Roseovarius nubinhibens ISM
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Putative branched-chain amino acid ABC transporter, substrate-binding component
livH
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_4796: Putative branched-chain amino acid ABC transporter, permease component
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Oceanicola batsensis HTCC2597
 
Loktanella vestfoldensis SKA53
 
Roseovarius sp. 217
 
Roseovarius nubinhibens ISM
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Putative branched-chain amino acid ABC transporter, permease component
livF
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_4795: Putative branched-chain amino acid ABC transporter, permease component 2
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Oceanicola batsensis HTCC2597
 
Loktanella vestfoldensis SKA53
 
Roseovarius sp. 217
 
Roseovarius nubinhibens ISM
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Putative branched-chain amino acid ABC transporter, permease component 2
livM1
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_4794: utative branched-chain amino acid ABC transporter, ATPase component 1
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Oceanicola batsensis HTCC2597
 
Loktanella vestfoldensis SKA53
 
Roseovarius sp. 217
 
Roseovarius nubinhibens ISM
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
utative branched-chain amino acid ABC transporter, ATPase component 1
livM2
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_4793: utative branched-chain amino acid ABC transporter, ATPase component 2
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Oceanicola batsensis HTCC2597
 
Loktanella vestfoldensis SKA53
 
Roseovarius sp. 217
 
Roseovarius nubinhibens ISM
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
utative branched-chain amino acid ABC transporter, ATPase component 2
fadB
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_3535: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Paracoccus denitrificans PD1222

Gene: Pden_4792: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Oceanicola batsensis HTCC2597
 
Loktanella vestfoldensis SKA53
 
Roseovarius sp. 217
 
Roseovarius nubinhibens ISM
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Enoyl-CoA hydratase (EC 4.2.1.17)
 
CRON 4.
paaG
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_0201: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Oceanicola batsensis HTCC2597

Gene: OB2597_18651: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Loktanella vestfoldensis SKA53
 
Roseovarius sp. 217
 
Roseovarius nubinhibens ISM
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
*
Silicibacter pomeroyi DSS-3

Site:
position = -63
score = 6.4464
sequence = ATAAACCGAACGGTTGGTCAAT

Gene: SPO0739: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Enoyl-CoA hydratase (EC 4.2.1.17)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD