Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PaaR - Rhizobiales

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Phylum: Alphaproteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Nitrobacter winogradskyi Nb-255
Bradyrhizobium sp. BTAi1
Bradyrhizobium japonicum USDA 110
Rhodopseudomonas palustris CGA009 15 5
Bartonella quintana str. Toulouse
Brucella melitensis 16M
Mesorhizobium loti MAFF303099
Mesorhizobium sp. BNC1
Agrobacterium tumefaciens str. C58 (Cereon)
Azorhizobium caulinodans ORS 571
Rhizobium etli CFN 42
Rhizobium leguminosarum bv. viciae 3841
Rhizobium sp. NGR234 13 3
Sinorhizobium meliloti 1021
Xanthobacter autotrophicus Py2 19 4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
livK
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium sp. BTAi1
 
Bradyrhizobium japonicum USDA 110
*
Rhodopseudomonas palustris CGA009

Site:
position = -144
score = 6.31073
sequence = ATTGACCGACCGTTCGGTTAAG

Gene: RPA4019: Putative branched-chain amino acid ABC transporter, substrate-binding component
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Sinorhizobium meliloti 1021
*
Xanthobacter autotrophicus Py2

Site:
position = -175
score = 5.29137
sequence = ATTGTCCGTCTGGTCGATCAAT

Site:
position = -117
score = 6.65276
sequence = ATTGACCATCCGGTCGGTCAAT

Gene: Xaut_0893: Putative branched-chain amino acid ABC transporter, substrate-binding component
Putative branched-chain amino acid ABC transporter, substrate-binding component
livH
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium sp. BTAi1
 
Bradyrhizobium japonicum USDA 110
 
Rhodopseudomonas palustris CGA009

Gene: RPA4020: Putative branched-chain amino acid ABC transporter, permease component
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2

Gene: Xaut_0892: Putative branched-chain amino acid ABC transporter, permease component
Putative branched-chain amino acid ABC transporter, permease component
livF
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium sp. BTAi1
 
Bradyrhizobium japonicum USDA 110
 
Rhodopseudomonas palustris CGA009

Gene: RPA4021: Putative branched-chain amino acid ABC transporter, permease component 2
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2

Gene: Xaut_0891: Putative branched-chain amino acid ABC transporter, permease component 2
Putative branched-chain amino acid ABC transporter, permease component 2
livM1
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium sp. BTAi1
 
Bradyrhizobium japonicum USDA 110
 
Rhodopseudomonas palustris CGA009

Gene: RPA4022: utative branched-chain amino acid ABC transporter, ATPase component 1
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2

Gene: Xaut_0890: utative branched-chain amino acid ABC transporter, ATPase component 1
utative branched-chain amino acid ABC transporter, ATPase component 1
livM2
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium sp. BTAi1
 
Bradyrhizobium japonicum USDA 110
 
Rhodopseudomonas palustris CGA009

Gene: RPA4023: utative branched-chain amino acid ABC transporter, ATPase component 2
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2

Gene: Xaut_0889: utative branched-chain amino acid ABC transporter, ATPase component 2
utative branched-chain amino acid ABC transporter, ATPase component 2
 
CRON 2.
paaG
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium sp. BTAi1
 
Bradyrhizobium japonicum USDA 110
 
Rhodopseudomonas palustris CGA009
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
*
Rhizobium sp. NGR234

Site:
position = -51
score = 6.46543
sequence = ATAAACCGACCGGTCAGTCAAT

Gene: NGR_c26080: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Sinorhizobium meliloti 1021

Gene: SMb21632: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Xanthobacter autotrophicus Py2
Enoyl-CoA hydratase (EC 4.2.1.17)
 
CRON 3.
blr2890
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium sp. BTAi1
 
Bradyrhizobium japonicum USDA 110
 
Rhodopseudomonas palustris CGA009
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
*
Rhizobium sp. NGR234

Site:
position = -53
score = 5.72292
sequence = TCTGACCGATCGGTCGGTTAAT

Gene: NGR_c26200: putative beta-ketoadipyl CoA thiolase
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
putative beta-ketoadipyl CoA thiolase
paaA
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium sp. BTAi1

Gene: BBta_2865: Phenylacetate-CoA oxygenase, PaaA subunit
 
Bradyrhizobium japonicum USDA 110

Gene: blr2891: Phenylacetate-CoA oxygenase, PaaA subunit
*
Rhodopseudomonas palustris CGA009

Site:
position = -53
score = 5.90246
sequence = ATTGACCGTCCAATTGGTCAAT

Gene: RPA3768: Phenylacetate-CoA oxygenase, PaaA subunit
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234

Gene: NGR_c26190: Phenylacetate-CoA oxygenase, PaaA subunit
 
Sinorhizobium meliloti 1021

Gene: SMb21640: Phenylacetate-CoA oxygenase, PaaA subunit
 
Xanthobacter autotrophicus Py2

Gene: Xaut_0896: Phenylacetate-CoA oxygenase, PaaA subunit
Phenylacetate-CoA oxygenase, PaaA subunit
paaB
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium sp. BTAi1

Gene: BBta_2866: Phenylacetate-CoA oxygenase, PaaB subunit
 
Bradyrhizobium japonicum USDA 110

Gene: bsr2892: Phenylacetate-CoA oxygenase, PaaB subunit
 
Rhodopseudomonas palustris CGA009

Gene: RPA3767: Phenylacetate-CoA oxygenase, PaaB subunit
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234

Gene: NGR_c26180: Phenylacetate-CoA oxygenase, PaaB subunit
 
Sinorhizobium meliloti 1021

Gene: SMb21639: Phenylacetate-CoA oxygenase, PaaB subunit
 
Xanthobacter autotrophicus Py2

Gene: Xaut_0897: Phenylacetate-CoA oxygenase, PaaB subunit
Phenylacetate-CoA oxygenase, PaaB subunit
paaC
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium sp. BTAi1

Gene: BBta_2867: Phenylacetate-CoA oxygenase, PaaC subunit
 
Bradyrhizobium japonicum USDA 110

Gene: blr2893: Phenylacetate-CoA oxygenase, PaaC subunit
 
Rhodopseudomonas palustris CGA009

Gene: RPA3766: Phenylacetate-CoA oxygenase, PaaC subunit
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234

Gene: NGR_c26170: Phenylacetate-CoA oxygenase, PaaC subunit
 
Sinorhizobium meliloti 1021

Gene: SMb21638: Phenylacetate-CoA oxygenase, PaaC subunit
 
Xanthobacter autotrophicus Py2

Gene: Xaut_0898: Phenylacetate-CoA oxygenase, PaaC subunit
Phenylacetate-CoA oxygenase, PaaC subunit
paaD
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium sp. BTAi1

Gene: BBta_2868: Phenylacetate-CoA oxygenase, PaaD subunit
 
Bradyrhizobium japonicum USDA 110

Gene: blr2894: Phenylacetate-CoA oxygenase, PaaD subunit
 
Rhodopseudomonas palustris CGA009

Gene: RPA3765: Phenylacetate-CoA oxygenase, PaaD subunit
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234

Gene: NGR_c26160: Phenylacetate-CoA oxygenase, PaaD subunit
 
Sinorhizobium meliloti 1021

Gene: SMb21637: Phenylacetate-CoA oxygenase, PaaD subunit
 
Xanthobacter autotrophicus Py2

Gene: Xaut_0899: Phenylacetate-CoA oxygenase, PaaD subunit
Phenylacetate-CoA oxygenase, PaaD subunit
paaE
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium sp. BTAi1

Gene: BBta_2869: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Bradyrhizobium japonicum USDA 110

Gene: blr2895: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Rhodopseudomonas palustris CGA009

Gene: RPA3764: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234

Gene: NGR_c26150: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Sinorhizobium meliloti 1021

Gene: SMb21636: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_0900: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
NGR_c26140
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium sp. BTAi1
 
Bradyrhizobium japonicum USDA 110
 
Rhodopseudomonas palustris CGA009
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234

Gene: NGR_c26140: ring-oxidation complex protein 1 in the phenylacetic acid catabolism pathway
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
ring-oxidation complex protein 1 in the phenylacetic acid catabolism pathway
paaZ
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium sp. BTAi1
 
Bradyrhizobium japonicum USDA 110
*
Rhodopseudomonas palustris CGA009

Site:
position = -108
score = 5.68053
sequence = ATTGAACGATCGGTCAGTCAAT

Gene: RPA1725: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234

Gene: NGR_c26130: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
 
Sinorhizobium meliloti 1021

Gene: SM_b21635: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*2
Xanthobacter autotrophicus Py2

Site:
position = -166
score = 6.21572
sequence = ATTAACCGATCGATCGGTTAAT

Gene: Xaut_0904: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ

Gene: Xaut_0907: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
paaR
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium sp. BTAi1
 
Bradyrhizobium japonicum USDA 110
*
Rhodopseudomonas palustris CGA009

Site:
position = -91
score = 5.90246
sequence = ATTGACCAATTGGACGGTCAAT

Gene: RPA3769: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234

Gene: NGR_c26120: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Sinorhizobium meliloti 1021
*
Xanthobacter autotrophicus Py2

Site:
position = -118
score = 6.65276
sequence = ATTGACCGACCGGATGGTCAAT

Site:
position = -60
score = 5.29137
sequence = ATTGATCGACCAGACGGACAAT

Gene: Xaut_0894: Transcriptional regulator of phenylacetic acid degradation, TetR family
Transcriptional regulator of phenylacetic acid degradation, TetR family
paaX
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium sp. BTAi1

Gene: BBta_2864: Phenylacetic acid degradation operon negative regulatory protein PaaX
 
Bradyrhizobium japonicum USDA 110

Gene: blr2890: Phenylacetic acid degradation operon negative regulatory protein PaaX
 
Rhodopseudomonas palustris CGA009
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234

Gene: NGR_b11470: Phenylacetic acid degradation operon negative regulatory protein PaaX
 
Sinorhizobium meliloti 1021

Gene: SMb21641: Phenylacetic acid degradation operon negative regulatory protein PaaX
 
Xanthobacter autotrophicus Py2

Gene: Xaut_0895: Phenylacetic acid degradation operon negative regulatory protein PaaX
Phenylacetic acid degradation operon negative regulatory protein PaaX
paaF
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium sp. BTAi1
 
Bradyrhizobium japonicum USDA 110
 
Rhodopseudomonas palustris CGA009
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
*
Rhizobium sp. NGR234

Site:
position = -70
score = 6.46543
sequence = ATTGACTGACCGGTCGGTTTAT

Gene: NGR_c26090: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Sinorhizobium meliloti 1021

Gene: SMb21633: Enoyl-CoA hydratase (EC 4.2.1.17)
*
Xanthobacter autotrophicus Py2

Site:
position = -60
score = 6.21572
sequence = ATTAACCGATCGATCGGTTAAT

Gene: Xaut_0903: Enoyl-CoA hydratase (EC 4.2.1.17)
Enoyl-CoA hydratase (EC 4.2.1.17)
paaY
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium sp. BTAi1

Gene: BBta_2871: thioesterase superfamily protein
 
Bradyrhizobium japonicum USDA 110

Gene: blr2896: thioesterase superfamily protein
*
Rhodopseudomonas palustris CGA009

Site:
position = -138
score = 5.68053
sequence = ATTGACTGACCGATCGTTCAAT

Gene: RPA1724: thioesterase superfamily protein
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234

Gene: NGR_c26100: thioesterase superfamily protein
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2

Gene: Xaut_0902: thioesterase superfamily protein
thioesterase superfamily protein
paaK
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium sp. BTAi1

Gene: BBta_2870: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Bradyrhizobium japonicum USDA 110

Gene: blr2897: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Rhodopseudomonas palustris CGA009

Gene: RPA1723: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234

Gene: NGR_c26110: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2

Gene: Xaut_0901: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
paaJ
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium sp. BTAi1
 
Bradyrhizobium japonicum USDA 110
 
Rhodopseudomonas palustris CGA009
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2

Gene: Xaut_0905: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
fadB
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium sp. BTAi1
 
Bradyrhizobium japonicum USDA 110
 
Rhodopseudomonas palustris CGA009
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2

Gene: Xaut_0906: 3-hydroxyacyl-CoA dehydrogenase NAD-binding
3-hydroxyacyl-CoA dehydrogenase NAD-binding
blr2898
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium sp. BTAi1
 
Bradyrhizobium japonicum USDA 110

Gene: blr2898: putative zinc binding dehydrogenase
 
Rhodopseudomonas palustris CGA009

Gene: RPA1726: putative zinc binding dehydrogenase
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
putative zinc binding dehydrogenase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD