Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PaaR - Comamonadaceae

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Phylum: Betaproteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 13 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acidovorax avenae subsp. citrulli AAC00-1
Acidovorax sp. JS42
Comamonas testosteroni KF-1
Delftia acidovorans SPH-1 15 3
Leptothrix cholodnii SP-6 13 3
Methylibium petroleiphilum PM1 10 2
Polaromonas naphthalenivorans CJ2
Polaromonas sp. JS666
Rhodoferax ferrireducens DSM 15236
Variovorax paradoxus S110 15 2
Verminephrobacter eiseniae EF01-2 12 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
paaF
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
*
Delftia acidovorans SPH-1

Site:
position = -71
score = 5.20424
sequence = ATTTACCGACCATTCGGTAAAT

Gene: Daci_0568: Enoyl-CoA hydratase (EC 4.2.1.17)
*
Leptothrix cholodnii SP-6

Site:
position = -42
score = 5.76971
sequence = ATTTACCTACCGGTCGGTCAAG

Gene: Lcho_2405: Enoyl-CoA hydratase (EC 4.2.1.17)
*
Methylibium petroleiphilum PM1

Site:
position = -85
score = 5.66643
sequence = GTCTACCGACTGGTCGGTCAAT

Gene: Mpe_A0984: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
*
Variovorax paradoxus S110

Site:
position = -48
score = 5.49521
sequence = ATCTACCGGACGGTCGGTCAAT

Site:
position = -52
score = 4.62868
sequence = TAAAATCTACCGGACGGTCGGT

Gene: Vapar_1238: Enoyl-CoA hydratase (EC 4.2.1.17)
*
Verminephrobacter eiseniae EF01-2

Site:
position = -102
score = 5.49521
sequence = ATCTACCGCACGGTCGGTCAAT

Gene: Veis_3942: Enoyl-CoA hydratase (EC 4.2.1.17)
Enoyl-CoA hydratase (EC 4.2.1.17)
paaY
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1

Gene: Daci_0569: thioesterase superfamily protein
 
Leptothrix cholodnii SP-6

Gene: Lcho_2404: thioesterase superfamily protein
 
Methylibium petroleiphilum PM1

Gene: Mpe_A0985: thioesterase superfamily protein
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_1237: thioesterase superfamily protein
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_3943: thioesterase superfamily protein
thioesterase superfamily protein
paaK
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
*2
Delftia acidovorans SPH-1

Gene: Daci_0570: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)

Site:
position = -59
score = 5.72992
sequence = TCCTACCGTCCGGTCGGTCAAT

Site:
position = -63
score = 4.56736
sequence = ATAATCCTACCGTCCGGTCGGT

Gene: Daci_0809: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Leptothrix cholodnii SP-6

Gene: Lcho_2403: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Methylibium petroleiphilum PM1

Gene: Mpe_A0986: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_1236: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_3944: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
paaA
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1

Gene: Daci_0810: Phenylacetate-CoA oxygenase, PaaA subunit
*
Leptothrix cholodnii SP-6

Site:
position = -48
score = 6.29162
sequence = ATTTACCGACCGGACGGTCAAT

Gene: Lcho_3574: Phenylacetate-CoA oxygenase, PaaA subunit
 
Methylibium petroleiphilum PM1

Gene: Mpe_A0987: Phenylacetate-CoA oxygenase, PaaA subunit
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_1235: Phenylacetate-CoA oxygenase, PaaA subunit
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_3945: Phenylacetate-CoA oxygenase, PaaA subunit
Phenylacetate-CoA oxygenase, PaaA subunit
paaB
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1

Gene: Daci_0811: Phenylacetate-CoA oxygenase, PaaB subunit
 
Leptothrix cholodnii SP-6

Gene: Lcho_3573: Phenylacetate-CoA oxygenase, PaaB subunit
 
Methylibium petroleiphilum PM1

Gene: Mpe_A0988: Phenylacetate-CoA oxygenase, PaaB subunit
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_1234: Phenylacetate-CoA oxygenase, PaaB subunit
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_3946: Phenylacetate-CoA oxygenase, PaaB subunit
Phenylacetate-CoA oxygenase, PaaB subunit
paaC
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1

Gene: Daci_0812: Phenylacetate-CoA oxygenase, PaaC subunit
 
Leptothrix cholodnii SP-6

Gene: Lcho_3572: Phenylacetate-CoA oxygenase, PaaC subunit
 
Methylibium petroleiphilum PM1

Gene: Mpe_A0989: Phenylacetate-CoA oxygenase, PaaC subunit
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_1233: Phenylacetate-CoA oxygenase, PaaC subunit
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_3947: Phenylacetate-CoA oxygenase, PaaC subunit
Phenylacetate-CoA oxygenase, PaaC subunit
paaD
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1

Gene: Daci_0813: Phenylacetate-CoA oxygenase, PaaD subunit
 
Leptothrix cholodnii SP-6

Gene: Lcho_3571: Phenylacetate-CoA oxygenase, PaaD subunit
 
Methylibium petroleiphilum PM1

Gene: Mpe_A0990: Phenylacetate-CoA oxygenase, PaaD subunit
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_1232: Phenylacetate-CoA oxygenase, PaaD subunit
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_3948: Phenylacetate-CoA oxygenase, PaaD subunit
Phenylacetate-CoA oxygenase, PaaD subunit
paaE
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1

Gene: Daci_0814: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Leptothrix cholodnii SP-6

Gene: Lcho_3569: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Methylibium petroleiphilum PM1

Gene: Mpe_A0991: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_1231: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_3949: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
livK
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1

Gene: Daci_0572: Putative branched-chain amino acid ABC transporter, substrate-binding component
 
Leptothrix cholodnii SP-6

Gene: Lcho_2401: Putative branched-chain amino acid ABC transporter, substrate-binding component
 
Methylibium petroleiphilum PM1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_1230: Putative branched-chain amino acid ABC transporter, substrate-binding component
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_3951: Putative branched-chain amino acid ABC transporter, substrate-binding component
Putative branched-chain amino acid ABC transporter, substrate-binding component
livH
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1

Gene: Daci_0573: Putative branched-chain amino acid ABC transporter, permease component
 
Leptothrix cholodnii SP-6
 
Methylibium petroleiphilum PM1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_1229: Putative branched-chain amino acid ABC transporter, permease component
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_3952: Putative branched-chain amino acid ABC transporter, permease component
Putative branched-chain amino acid ABC transporter, permease component
livM
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1

Gene: Daci_0574: Putative branched-chain amino acid ABC transporter, ATPase component
 
Leptothrix cholodnii SP-6
 
Methylibium petroleiphilum PM1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_1228: Putative branched-chain amino acid ABC transporter, ATPase component
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_3953: Putative branched-chain amino acid ABC transporter, ATPase component
Putative branched-chain amino acid ABC transporter, ATPase component
livF
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1

Gene: Daci_0575: Putative branched-chain amino acid ABC transporter, permease component 2
 
Leptothrix cholodnii SP-6
 
Methylibium petroleiphilum PM1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_1227: Putative branched-chain amino acid ABC transporter, permease component 2
 
Verminephrobacter eiseniae EF01-2
Putative branched-chain amino acid ABC transporter, permease component 2
paaZ
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
*
Delftia acidovorans SPH-1

Site:
position = -111
score = 5.9813
sequence = ATTGACCGACCGGACGGTAGGA

Gene: Daci_0808: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
 
Leptothrix cholodnii SP-6

Gene: Lcho_3568: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
 
Methylibium petroleiphilum PM1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_1226: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
 
Verminephrobacter eiseniae EF01-2
Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
paaR
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 2
Delftia acidovorans SPH-1

Gene: Daci_0807: Transcriptional regulator of phenylacetic acid degradation, TetR family

Gene: Daci_0571: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Leptothrix cholodnii SP-6

Gene: Lcho_2402: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Methylibium petroleiphilum PM1

Gene: Mpe_A0992: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_1240: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_3950: Transcriptional regulator of phenylacetic acid degradation, TetR family
Transcriptional regulator of phenylacetic acid degradation, TetR family
Lcho_0276
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6

Gene: Lcho_3570: hypothetical protein
 
Methylibium petroleiphilum PM1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
hypothetical protein
paaY2
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
*
Leptothrix cholodnii SP-6

Site:
position = -115
score = 5.54802
sequence = CTTGACCGACCGGTAGGTAAAT

Gene: Lcho_2406: phenylacetic acid degradation protein PaaY
*
Methylibium petroleiphilum PM1

Site:
position = -78
score = 5.58326
sequence = ATTGACCGACCAGTCGGTAGAC

Gene: Mpe_A0983: phenylacetic acid degradation protein PaaY
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
*
Variovorax paradoxus S110

Site:
position = -101
score = 5.43112
sequence = ATTGACCGACCGTCCGGTAGAT

Gene: Vapar_1239: phenylacetic acid degradation protein PaaY
 
Verminephrobacter eiseniae EF01-2
phenylacetic acid degradation protein PaaY
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD