Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PaaR - Ralstonia

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Phylum: Betaproteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 18 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Cupriavidus taiwanensis 11 3
Ralstonia eutropha H16 11 3
Ralstonia eutropha JMP134 11 3
Ralstonia metallidurans CH34 11 3
Ralstonia pickettii 12J 9 3
Ralstonia solanacearum GMI1000 9 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
paaA
*
Cupriavidus taiwanensis

Site:
position = -83
score = 6.22724
sequence = ATTGACCGACCGGTCGGCTTAT

Gene: RALTA_A2973: Phenylacetate-CoA oxygenase, PaaA subunit
*
Ralstonia eutropha H16

Site:
position = -79
score = 5.73852
sequence = ATTGACCGACCGGTCGGCATAT

Gene: H16_A3520: Phenylacetate-CoA oxygenase, PaaA subunit
*
Ralstonia eutropha JMP134

Site:
position = -95
score = 6.22724
sequence = ATTGACCGACCGGTCGGCTTAT

Gene: Reut_A3206: Phenylacetate-CoA oxygenase, PaaA subunit
*
Ralstonia metallidurans CH34

Site:
position = -113
score = 6.76152
sequence = ATTGACCGACCGGTCGGTTTAT

Gene: Rmet_3369: Phenylacetate-CoA oxygenase, PaaA subunit
*
Ralstonia pickettii 12J

Site:
position = -96
score = 6.34603
sequence = ATTGACCGACCGGTCGGACGGT

Gene: Rpic_4567: Phenylacetate-CoA oxygenase, PaaA subunit
*
Ralstonia solanacearum GMI1000

Site:
position = -97
score = 6.30204
sequence = ATTGACCGACCGGTCGGACGAT

Gene: RSp0604: Phenylacetate-CoA oxygenase, PaaA subunit
Phenylacetate-CoA oxygenase, PaaA subunit
paaB
 
Cupriavidus taiwanensis

Gene: RALTA_A2974: Phenylacetate-CoA oxygenase, PaaB subunit
 
Ralstonia eutropha H16

Gene: H16_A3521: Phenylacetate-CoA oxygenase, PaaB subunit
 
Ralstonia eutropha JMP134

Gene: Reut_A3207: Phenylacetate-CoA oxygenase, PaaB subunit
 
Ralstonia metallidurans CH34

Gene: Rmet_3370: Phenylacetate-CoA oxygenase, PaaB subunit
 
Ralstonia pickettii 12J

Gene: Rpic_4566: Phenylacetate-CoA oxygenase, PaaB subunit
 
Ralstonia solanacearum GMI1000

Gene: RSp0605: Phenylacetate-CoA oxygenase, PaaB subunit
Phenylacetate-CoA oxygenase, PaaB subunit
paaC
 
Cupriavidus taiwanensis

Gene: RALTA_A2975: Phenylacetate-CoA oxygenase, PaaC subunit
 
Ralstonia eutropha H16

Gene: H16_A3522: Phenylacetate-CoA oxygenase, PaaC subunit
 
Ralstonia eutropha JMP134

Gene: Reut_A3208: Phenylacetate-CoA oxygenase, PaaC subunit
 
Ralstonia metallidurans CH34

Gene: Rmet_3371: Phenylacetate-CoA oxygenase, PaaC subunit
 
Ralstonia pickettii 12J

Gene: Rpic_4565: Phenylacetate-CoA oxygenase, PaaC subunit
 
Ralstonia solanacearum GMI1000

Gene: RSp0606: Phenylacetate-CoA oxygenase, PaaC subunit
Phenylacetate-CoA oxygenase, PaaC subunit
paaD
 
Cupriavidus taiwanensis

Gene: RALTA_A2976: Phenylacetate-CoA oxygenase, PaaD subunit
 
Ralstonia eutropha H16

Gene: H16_A3523: Phenylacetate-CoA oxygenase, PaaD subunit
 
Ralstonia eutropha JMP134

Gene: Reut_A3209: Phenylacetate-CoA oxygenase, PaaD subunit
 
Ralstonia metallidurans CH34

Gene: Rmet_3372: Phenylacetate-CoA oxygenase, PaaD subunit
 
Ralstonia pickettii 12J

Gene: Rpic_4564: Phenylacetate-CoA oxygenase, PaaD subunit
 
Ralstonia solanacearum GMI1000

Gene: RSp0607: Phenylacetate-CoA oxygenase, PaaD subunit
Phenylacetate-CoA oxygenase, PaaD subunit
paaE
 
Cupriavidus taiwanensis

Gene: RALTA_A2977: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Ralstonia eutropha H16

Gene: H16_A3524: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Ralstonia eutropha JMP134

Gene: Reut_A3210: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Ralstonia metallidurans CH34

Gene: Rmet_3373: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Ralstonia pickettii 12J

Gene: Rpic_4563: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Ralstonia solanacearum GMI1000

Gene: RSp0608: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
paaW
 
Cupriavidus taiwanensis

Gene: RALTA_A2978: Protein of unknown function DUF3658/DUF1835
 
Ralstonia eutropha H16

Gene: H16_A3525: Protein of unknown function DUF3658/DUF1835
 
Ralstonia eutropha JMP134

Gene: Reut_A3211: Protein of unknown function DUF3658/DUF1835
 
Ralstonia metallidurans CH34

Gene: Rmet_3374: Protein of unknown function DUF3658/DUF1835
 
Ralstonia pickettii 12J

Gene: Rpic_3378: Protein of unknown function DUF3658/DUF1835
 
Ralstonia solanacearum GMI1000

Gene: RS00547: Protein of unknown function DUF3658/DUF1835
Protein of unknown function DUF3658/DUF1835
paaR
 
Cupriavidus taiwanensis

Gene: RALTA_A2979: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Ralstonia eutropha H16

Gene: H16_A3526: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Ralstonia eutropha JMP134

Gene: Reut_A3212: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Ralstonia metallidurans CH34

Gene: Rmet_3375: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Ralstonia pickettii 12J

Gene: Rpic_4562: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Ralstonia solanacearum GMI1000

Gene: RS03754: Transcriptional regulator of phenylacetic acid degradation, TetR family
Transcriptional regulator of phenylacetic acid degradation, TetR family
 
CRON 2.
paaF2
 
Cupriavidus taiwanensis

Gene: RALTA_A2759: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Ralstonia eutropha H16

Gene: H16_A3307: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Ralstonia eutropha JMP134

Gene: Reut_A3010: Enoyl-CoA hydratase (EC 4.2.1.17)
*
Ralstonia metallidurans CH34

Site:
position = -149
score = 6.06377
sequence = ATTAACCGACCAGTCGGTCGGC

Gene: Rmet_3162: Enoyl-CoA hydratase (EC 4.2.1.17)
*
Ralstonia pickettii 12J

Site:
position = -53
score = 6.45764
sequence = ATTAACCGACCGGTTGGTCGGC

Gene: Rpic_3114: Enoyl-CoA hydratase (EC 4.2.1.17)
*
Ralstonia solanacearum GMI1000

Site:
position = -53
score = 6.45764
sequence = ATTAACCGACCGGTTGGTCGGC

Gene: RSc2872: Enoyl-CoA hydratase (EC 4.2.1.17)
Enoyl-CoA hydratase (EC 4.2.1.17)
 
CRON 3.
paaG
*
Cupriavidus taiwanensis

Site:
position = -31
score = 6.57466
sequence = ATTAACCGACCGATCGGTTGGT

Gene: RALTA_A0085: Enoyl-CoA hydratase (EC 4.2.1.17)
*
Ralstonia eutropha H16

Site:
position = -72
score = 6.20418
sequence = ATTAACCGACCGATCGGTTGGC

Gene: H16_A0142: Enoyl-CoA hydratase (EC 4.2.1.17)
*
Ralstonia eutropha JMP134

Site:
position = -73
score = 6.37111
sequence = ATTTACCGACCGGCCGGTTGGT

Gene: Reut_A0110: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Ralstonia metallidurans CH34

Gene: Rmet_0080: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Ralstonia pickettii 12J

Gene: Rpic_0159: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Ralstonia solanacearum GMI1000

Gene: RS03271: Enoyl-CoA hydratase (EC 4.2.1.17)
Enoyl-CoA hydratase (EC 4.2.1.17)
 
CRON 4.
paaF
*
Cupriavidus taiwanensis

Site:
position = -89
score = 5.69244
sequence = GCCGACCGACTGGTCGGTTTAT

Gene: RALTA_A2763: Enoyl-CoA hydratase (EC 4.2.1.17)
*
Ralstonia eutropha H16

Site:
position = -90
score = 5.69244
sequence = GCCGACCGACTGGTCGGTTTAT

Gene: H16_A3311: Enoyl-CoA hydratase (EC 4.2.1.17)
*
Ralstonia eutropha JMP134

Site:
position = -61
score = 6.1825
sequence = ACCGACCGATCGGTCGGTTAAT

Gene: Reut_A3015: Enoyl-CoA hydratase (EC 4.2.1.17)
*
Ralstonia metallidurans CH34

Site:
position = -100
score = 5.81944
sequence = GCCGACCGACTGGTCGGTTAAT

Gene: Rmet_3163: Enoyl-CoA hydratase (EC 4.2.1.17)
*
Ralstonia pickettii 12J

Site:
position = -52
score = 6.23932
sequence = GCCGACCAACCGGTCGGTTAAT

Gene: Rpic_3115: Enoyl-CoA hydratase (EC 4.2.1.17)
*
Ralstonia solanacearum GMI1000

Site:
position = -48
score = 6.23932
sequence = GCCGACCAACCGGTCGGTTAAT

Gene: RSc2873: Enoyl-CoA hydratase (EC 4.2.1.17)
Enoyl-CoA hydratase (EC 4.2.1.17)
paaY
 
Cupriavidus taiwanensis

Gene: RALTA_A2764: thioesterase superfamily protein
 
Ralstonia eutropha H16

Gene: H16_A3312: thioesterase superfamily protein
 
Ralstonia eutropha JMP134

Gene: Reut_A3016: thioesterase superfamily protein
 
Ralstonia metallidurans CH34

Gene: Rmet_3164: thioesterase superfamily protein
 
Ralstonia pickettii 12J

Gene: Rpic_3116: thioesterase superfamily protein
 
Ralstonia solanacearum GMI1000

Gene: RSc2874: thioesterase superfamily protein
thioesterase superfamily protein
paaK
 
Cupriavidus taiwanensis

Gene: RALTA_A2765: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Ralstonia eutropha H16

Gene: H16_A3313: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Ralstonia eutropha JMP134

Gene: Reut_A3017: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Ralstonia metallidurans CH34

Gene: Rmet_3165: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Ralstonia pickettii 12J

Gene: Rpic_3117: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Ralstonia solanacearum GMI1000

Gene: RSc2875: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD