Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog UxuR - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Glucuronate utilization
Effector: Aldotetraouronic acid
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Anoxybacillus flavithermus WK1
Bacillus amyloliquefaciens FZB42
Bacillus cereus ATCC 14579
Bacillus clausii KSM-K16 8 3
Bacillus halodurans C-125 6 2
Bacillus licheniformis DSM 13 6 1
Bacillus pumilus SAFR-032
Bacillus subtilis subsp. subtilis str. 168
Geobacillus kaustophilus HTA426
Oceanobacillus iheyensis HTE831
Paenibacillus sp. JDR-2 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
uxuR2
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
*
Bacillus clausii KSM-K16

Site:
position = -62
score = 5.7713
sequence = CTACCATATTTGTATGGTAG

Gene: ABC4047: Transcriptional regulator of glucuronate utilization, GntR family
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Transcriptional regulator of glucuronate utilization, GntR family
uxuP2
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC4046: Predicted glucuronate TRAP-type transporter, periplasmic component
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Predicted glucuronate TRAP-type transporter, periplasmic component
uxuQ2
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC4045: Predicted glucuronate TRAP-type transporter, small permease component
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Predicted glucuronate TRAP-type transporter, small permease component
uxuM2
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC4044: Predicted glucuronate TRAP-type transporter, large permease component
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Predicted glucuronate TRAP-type transporter, large permease component
 
CRON 2.
uxuR
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
*
Bacillus clausii KSM-K16

Site:
position = -31
score = 5.39918
sequence = CTACCATACTAGTATAAGTA

Gene: ABC0604: Transcriptional regulator of glucuronate utilization, GntR family
 
Bacillus halodurans C-125

Gene: BH1062: Transcriptional regulator of glucuronate utilization, GntR family
*
Bacillus licheniformis DSM 13

Site:
position = -44
score = 5.99049
sequence = CAGCCATACTTGTATGGTAG

Gene: BLi01354: Transcriptional regulator of glucuronate utilization, GntR family
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
*
Paenibacillus sp. JDR-2

Site:
position = -53
score = 4.66189
sequence = CAAGAATACAAGTAAAGTAA

Gene: Pjdr2_0332: Transcriptional regulator of glucuronate utilization, GntR family
Transcriptional regulator of glucuronate utilization, GntR family
uxmD
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_017960: Predicted mannuronate dehydrogenase (EC 1.1.1.131)
 
Bacillus cereus ATCC 14579
*
Bacillus clausii KSM-K16

Site:
position = -146
score = 5.99917
sequence = CTACCACACTTGTATGGTAG

Gene: ABC0630: Predicted mannuronate dehydrogenase (EC 1.1.1.131)
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13

Gene: BLi01355: Predicted mannuronate dehydrogenase (EC 1.1.1.131)
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Predicted mannuronate dehydrogenase (EC 1.1.1.131)
uxuA
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_017980: Mannonate dehydratase (EC 4.2.1.8)
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC0631: Mannonate dehydratase (EC 4.2.1.8)
*
Bacillus halodurans C-125

Site:
position = -45
score = 5.59622
sequence = TATGTATACTAGTATGGTTA

Gene: BH1063: Mannonate dehydratase (EC 4.2.1.8)
 
Bacillus licheniformis DSM 13

Gene: BLi01356: Mannonate dehydratase (EC 4.2.1.8)
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_0333: Mannonate dehydratase (EC 4.2.1.8)
Mannonate dehydratase (EC 4.2.1.8)
uxuB
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_017990: D-mannonate oxidoreductase (EC 1.1.1.57)
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC0632: D-mannonate oxidoreductase (EC 1.1.1.57)
 
Bacillus halodurans C-125

Gene: BH1067: D-mannonate oxidoreductase (EC 1.1.1.57)
 
Bacillus licheniformis DSM 13

Gene: BLi01357: D-mannonate oxidoreductase (EC 1.1.1.57)
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_0334: D-mannonate oxidoreductase (EC 1.1.1.57)
D-mannonate oxidoreductase (EC 1.1.1.57)
yjmD2
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13

Gene: BLi01358: Oxidoreductase, zinc-binding dehydrogenase family (EC 1.1.1.-)
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Oxidoreductase, zinc-binding dehydrogenase family (EC 1.1.1.-)
exuT
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_018010: Hexuronate transporter
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13

Gene: BLi01359: Hexuronate transporter
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Hexuronate transporter
BH1064
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC0724: Putative aldotetraouronic acid ABC transporter, substrate-binding protein
*
Bacillus halodurans C-125

Site:
position = -186
score = 6.10062
sequence = CTACCATACTAGTATGATTA

Gene: BH1064: Putative aldotetraouronic acid ABC transporter, substrate-binding protein
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 3
Paenibacillus sp. JDR-2

Gene: Pjdr2_0687: Putative aldotetraouronic acid ABC transporter, substrate-binding protein

Gene: Pjdr2_0823: Putative aldotetraouronic acid ABC transporter, substrate-binding protein

Gene: Pjdr2_0953: Putative aldotetraouronic acid ABC transporter, substrate-binding protein
Putative aldotetraouronic acid ABC transporter, substrate-binding protein
BH1065
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC0727: Putative aldotetraouronic acid ABC transporter, permease component
 
Bacillus halodurans C-125

Gene: BH1065: Putative aldotetraouronic acid ABC transporter, permease component
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 2
Paenibacillus sp. JDR-2

Gene: Pjdr2_0690: Putative aldotetraouronic acid ABC transporter, permease component

Gene: Pjdr2_0821: Putative aldotetraouronic acid ABC transporter, permease component
Putative aldotetraouronic acid ABC transporter, permease component
BH1066
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC0728: Putative aldotetraouronic acid ABC transporter, permease component
 
Bacillus halodurans C-125

Gene: BH1066: Putative aldotetraouronic acid ABC transporter, permease component
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 2
Paenibacillus sp. JDR-2

Gene: Pjdr2_0691: Putative aldotetraouronic acid ABC transporter, permease component

Gene: Pjdr2_0822: Putative aldotetraouronic acid ABC transporter, permease component
Putative aldotetraouronic acid ABC transporter, permease component
xynB
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16
 
Bacillus halodurans C-125

Gene: BH1068: Beta-xylosidase
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Beta-xylosidase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD