Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PaaR - Burkholderia

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Phylum: Betaproteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 27 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Burkholderia pseudomallei K96243 13 3
Burkholderia mallei ATCC 23344 13 3
Burkholderia sp. 383 16 4
Burkholderia cepacia AMMD 16 4
Burkholderia glumae BGR1 12 3
Burkholderia vietnamiensis G4 16 4
Burkholderia xenovorans LB400 13 3
Burkholderia phymatum STM815 13 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
paaH
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
*
Burkholderia sp. 383

Site:
position = -60
score = 6.30544
sequence = ATATACCGACCGGTCGGTTTAT

Gene: Bcep18194_B1317: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
*
Burkholderia cepacia AMMD

Site:
position = -61
score = 6.57719
sequence = ATCTACCGACCGGTCGGTTTAT

Gene: Bamb_3960: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Burkholderia glumae BGR1
*
Burkholderia vietnamiensis G4

Site:
position = -61
score = 6.57719
sequence = ATCTACCGACCGGTCGGTTTAT

Gene: Bcep1808_5069: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815
3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
paaK2
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383

Gene: Bcep18194_B1318: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Burkholderia cepacia AMMD

Gene: Bamb_3959: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Burkholderia glumae BGR1
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_5068: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815
Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
paaF2
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383

Gene: Bcep18194_B1319: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Burkholderia cepacia AMMD

Gene: Bamb_3958: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Burkholderia glumae BGR1
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_5067: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815
Enoyl-CoA hydratase (EC 4.2.1.17)
 
CRON 2.
paaZ
*
Burkholderia pseudomallei K96243

Site:
position = -64
score = 6.41721
sequence = TCCGACCAACCGGTCGGTTAAT

Gene: BPSL3041: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Burkholderia mallei ATCC 23344

Site:
position = -64
score = 6.01431
sequence = TCCGACTAACCGGTCGGTTAAT

Gene: BMAA0543: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Burkholderia sp. 383

Site:
position = -63
score = 6.41721
sequence = TCCGACCAACCGGTCGGTTAAT

Gene: Bcep18194_A3630: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Burkholderia cepacia AMMD

Site:
position = -63
score = 6.41721
sequence = TCCGACCAACCGGTCGGTTAAT

Gene: Bamb_0448: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Burkholderia glumae BGR1

Site:
position = -70
score = 6.23932
sequence = GCCGACCAACCGGTCGGTTAAT

Gene: bglu_1g04490: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Burkholderia vietnamiensis G4

Site:
position = -63
score = 6.41721
sequence = TCCGACCAACCGGTCGGTTAAT

Gene: Bcep1808_0520: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Burkholderia xenovorans LB400

Site:
position = -66
score = 6.18713
sequence = CCCAACCAACCGGTCGGTCAAT

Gene: Bxe_A0470: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Burkholderia phymatum STM815

Site:
position = -68
score = 6.55019
sequence = ACCAACCAACCGGTCGGTCAAT

Gene: Bphy_2689: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
paaJ
 
Burkholderia pseudomallei K96243

Gene: BPSL3042: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
 
Burkholderia mallei ATCC 23344

Gene: BMAA0542: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
 
Burkholderia sp. 383

Gene: Bcep18194_A3629: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
 
Burkholderia cepacia AMMD

Gene: Bamb_0447: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
 
Burkholderia glumae BGR1
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_0519: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
 
Burkholderia xenovorans LB400

Gene: Bxe_A0469: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
 
Burkholderia phymatum STM815

Gene: Bphy_2690: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
paaF
 
Burkholderia pseudomallei K96243

Gene: BPSL3043: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Burkholderia mallei ATCC 23344

Gene: BMAA0541: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Burkholderia sp. 383

Gene: Bcep18194_A3628: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Burkholderia cepacia AMMD

Gene: Bamb_0446: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Burkholderia glumae BGR1

Gene: bglu_1g04480: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_0518: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Burkholderia xenovorans LB400

Gene: Bxe_A0468: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Burkholderia phymatum STM815

Gene: Bphy_2691: Enoyl-CoA hydratase (EC 4.2.1.17)
Enoyl-CoA hydratase (EC 4.2.1.17)
paaY
 
Burkholderia pseudomallei K96243

Gene: BPSL3044: thioesterase superfamily protein
 
Burkholderia mallei ATCC 23344

Gene: BMAA0539.1: thioesterase superfamily protein
 
Burkholderia sp. 383

Gene: Bcep18194_A3627: thioesterase superfamily protein
 
Burkholderia cepacia AMMD

Gene: Bamb_0445: thioesterase superfamily protein
 
Burkholderia glumae BGR1

Gene: bglu_1g04470: thioesterase superfamily protein
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_0517: thioesterase superfamily protein
 
Burkholderia xenovorans LB400

Gene: Bxe_A0467: thioesterase superfamily protein
 
Burkholderia phymatum STM815

Gene: Bphy_2692: thioesterase superfamily protein
thioesterase superfamily protein
paaK
 
Burkholderia pseudomallei K96243

Gene: BPSL3045: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Burkholderia mallei ATCC 23344

Gene: BMAA0539: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Burkholderia sp. 383

Gene: Bcep18194_A3626: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Burkholderia cepacia AMMD

Gene: Bamb_0444: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Burkholderia glumae BGR1

Gene: bglu_1g04460: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_0516: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Burkholderia xenovorans LB400

Gene: Bxe_A0466: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Burkholderia phymatum STM815

Gene: Bphy_2693: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
CRON 3.
paaA
*
Burkholderia pseudomallei K96243

Site:
position = -62
score = 7.10894
sequence = ATTAACCGACCGGTCGGTTGGT

Gene: BPSL3230: Phenylacetate-CoA oxygenase, PaaA subunit
*
Burkholderia mallei ATCC 23344

Site:
position = -62
score = 7.10894
sequence = ATTAACCGACCGGTCGGTTGGT

Gene: BMA2573: Phenylacetate-CoA oxygenase, PaaA subunit
*
Burkholderia sp. 383

Site:
position = -61
score = 7.10894
sequence = ATTAACCGACCGGTCGGTTGGT

Gene: Bcep18194_A3429: Phenylacetate-CoA oxygenase, PaaA subunit
*
Burkholderia cepacia AMMD

Site:
position = -62
score = 7.10894
sequence = ATTAACCGACCGGTCGGTTGGT

Gene: Bamb_0249: Phenylacetate-CoA oxygenase, PaaA subunit
*
Burkholderia glumae BGR1

Site:
position = -62
score = 6.77945
sequence = ATTAACCGACCGGACGGTTGGT

Gene: bglu_1g02410: Phenylacetate-CoA oxygenase, PaaA subunit
*
Burkholderia vietnamiensis G4

Site:
position = -62
score = 7.10894
sequence = ATTAACCGACCGGTCGGTTGGT

Gene: Bcep1808_0312: Phenylacetate-CoA oxygenase, PaaA subunit
*
Burkholderia xenovorans LB400

Site:
position = -65
score = 7.10894
sequence = ATTAACCGACCGGTCGGTTGGT

Gene: Bxe_A0295: Phenylacetate-CoA oxygenase, PaaA subunit
*
Burkholderia phymatum STM815

Site:
position = -66
score = 6.77945
sequence = ATTAACCGACCGGACGGTTGGT

Gene: Bphy_2857: Phenylacetate-CoA oxygenase, PaaA subunit
Phenylacetate-CoA oxygenase, PaaA subunit
paaB
 
Burkholderia pseudomallei K96243

Gene: BPSL3231: Phenylacetate-CoA oxygenase, PaaB subunit
 
Burkholderia mallei ATCC 23344

Gene: BMA2574: Phenylacetate-CoA oxygenase, PaaB subunit
 
Burkholderia sp. 383

Gene: Bcep18194_A3428: Phenylacetate-CoA oxygenase, PaaB subunit
 
Burkholderia cepacia AMMD

Gene: Bamb_0248: Phenylacetate-CoA oxygenase, PaaB subunit
 
Burkholderia glumae BGR1

Gene: bglu_1g02400: Phenylacetate-CoA oxygenase, PaaB subunit
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_0311: Phenylacetate-CoA oxygenase, PaaB subunit
 
Burkholderia xenovorans LB400

Gene: Bxe_A0294: Phenylacetate-CoA oxygenase, PaaB subunit
 
Burkholderia phymatum STM815

Gene: Bphy_2858: Phenylacetate-CoA oxygenase, PaaB subunit
Phenylacetate-CoA oxygenase, PaaB subunit
paaC
 
Burkholderia pseudomallei K96243

Gene: BPSL3232: Phenylacetate-CoA oxygenase, PaaC subunit
 
Burkholderia mallei ATCC 23344

Gene: BMA2575: Phenylacetate-CoA oxygenase, PaaC subunit
 
Burkholderia sp. 383

Gene: Bcep18194_A3427: Phenylacetate-CoA oxygenase, PaaC subunit
 
Burkholderia cepacia AMMD

Gene: Bamb_0247: Phenylacetate-CoA oxygenase, PaaC subunit
 
Burkholderia glumae BGR1

Gene: bglu_1g02390: Phenylacetate-CoA oxygenase, PaaC subunit
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_0310: Phenylacetate-CoA oxygenase, PaaC subunit
 
Burkholderia xenovorans LB400

Gene: Bxe_A0293: Phenylacetate-CoA oxygenase, PaaC subunit
 
Burkholderia phymatum STM815

Gene: Bphy_2859: Phenylacetate-CoA oxygenase, PaaC subunit
Phenylacetate-CoA oxygenase, PaaC subunit
paaD
 
Burkholderia pseudomallei K96243

Gene: BPSL3233: Phenylacetate-CoA oxygenase, PaaD subunit
 
Burkholderia mallei ATCC 23344

Gene: BMA2576: Phenylacetate-CoA oxygenase, PaaD subunit
 
Burkholderia sp. 383

Gene: Bcep18194_A3426: Phenylacetate-CoA oxygenase, PaaD subunit
 
Burkholderia cepacia AMMD

Gene: Bamb_0246: Phenylacetate-CoA oxygenase, PaaD subunit
 
Burkholderia glumae BGR1

Gene: bglu_1g02380: Phenylacetate-CoA oxygenase, PaaD subunit
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_0309: Phenylacetate-CoA oxygenase, PaaD subunit
 
Burkholderia xenovorans LB400

Gene: Bxe_A0292: Phenylacetate-CoA oxygenase, PaaD subunit
 
Burkholderia phymatum STM815

Gene: Bphy_2860: Phenylacetate-CoA oxygenase, PaaD subunit
Phenylacetate-CoA oxygenase, PaaD subunit
paaE
 
Burkholderia pseudomallei K96243

Gene: BPSL3234: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Burkholderia mallei ATCC 23344

Gene: BMA2577: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Burkholderia sp. 383

Gene: Bcep18194_A3425: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Burkholderia cepacia AMMD

Gene: Bamb_0245: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Burkholderia glumae BGR1

Gene: bglu_1g02370: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_0308: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Burkholderia xenovorans LB400

Gene: Bxe_A0291: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Burkholderia phymatum STM815

Gene: Bphy_2861: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
paaW
 
Burkholderia pseudomallei K96243

Gene: BPSL3235: Protein of unknown function DUF3658/DUF1835
 
Burkholderia mallei ATCC 23344

Gene: BMA2578: Protein of unknown function DUF3658/DUF1835
 
Burkholderia sp. 383

Gene: Bcep18194_A3424: Protein of unknown function DUF3658/DUF1835
 
Burkholderia cepacia AMMD

Gene: Bamb_0244: Protein of unknown function DUF3658/DUF1835
 
Burkholderia glumae BGR1

Gene: bglu_1g02360: Protein of unknown function DUF3658/DUF1835
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_0307: Protein of unknown function DUF3658/DUF1835
 
Burkholderia xenovorans LB400

Gene: Bxe_A0290: Protein of unknown function DUF3658/DUF1835
 
Burkholderia phymatum STM815

Gene: Bphy_2862: Protein of unknown function DUF3658/DUF1835
Protein of unknown function DUF3658/DUF1835
paaR
 
Burkholderia pseudomallei K96243

Gene: BPSL3236: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Burkholderia mallei ATCC 23344

Gene: BMA2579: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Burkholderia sp. 383

Gene: Bcep18194_A3423: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Burkholderia cepacia AMMD

Gene: Bamb_0243: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Burkholderia glumae BGR1

Gene: bglu_1g02350: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_0306: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Burkholderia xenovorans LB400

Gene: Bxe_A0289: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Burkholderia phymatum STM815

Gene: Bphy_2863: Transcriptional regulator of phenylacetic acid degradation, TetR family
Transcriptional regulator of phenylacetic acid degradation, TetR family
 
CRON 4.
paaG
*
Burkholderia pseudomallei K96243

Site:
position = -70
score = 6.6069
sequence = ATTAACCGACCGGTTGGTCGGA

Gene: BPSL3040: Enoyl-CoA hydratase (EC 4.2.1.17)
*
Burkholderia mallei ATCC 23344

Site:
position = -88
score = 6.07262
sequence = ATTAACCGACCGGTTAGTCGGA

Gene: BMAA0544: Enoyl-CoA hydratase (EC 4.2.1.17)
*
Burkholderia sp. 383

Site:
position = -88
score = 6.6069
sequence = ATTAACCGACCGGTTGGTCGGA

Gene: Bcep18194_A3631: Enoyl-CoA hydratase (EC 4.2.1.17)
*
Burkholderia cepacia AMMD

Site:
position = -88
score = 6.6069
sequence = ATTAACCGACCGGTTGGTCGGA

Gene: Bamb_0449: Enoyl-CoA hydratase (EC 4.2.1.17)
*
Burkholderia glumae BGR1

Site:
position = -87
score = 6.45764
sequence = ATTAACCGACCGGTTGGTCGGC

Gene: bglu_1g04500: Enoyl-CoA hydratase (EC 4.2.1.17)
*
Burkholderia vietnamiensis G4

Site:
position = -88
score = 6.6069
sequence = ATTAACCGACCGGTTGGTCGGA

Gene: Bcep1808_0521: Enoyl-CoA hydratase (EC 4.2.1.17)
*
Burkholderia xenovorans LB400

Site:
position = -93
score = 6.50983
sequence = ATTGACCGACCGGTTGGTTGGG

Gene: Bxe_A0471: Enoyl-CoA hydratase (EC 4.2.1.17)
*
Burkholderia phymatum STM815

Site:
position = -90
score = 6.88031
sequence = ATTGACCGACCGGTTGGTTGGT

Gene: Bphy_2688: Enoyl-CoA hydratase (EC 4.2.1.17)
Enoyl-CoA hydratase (EC 4.2.1.17)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD