Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GutR - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: GutR
Regulation mode: activator
Biological process: Sorbitol utilization
Effector: Sorbitol
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Anoxybacillus flavithermus WK1
Bacillus amyloliquefaciens FZB42 3 2
Bacillus cereus ATCC 14579
Bacillus clausii KSM-K16
Bacillus halodurans C-125
Bacillus licheniformis DSM 13
Bacillus pumilus SAFR-032
Bacillus subtilis subsp. subtilis str. 168 3 2
Geobacillus kaustophilus HTA426
Oceanobacillus iheyensis HTE831
Paenibacillus sp. JDR-2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
gutB
 
Anoxybacillus flavithermus WK1
*
Bacillus amyloliquefaciens FZB42

Site:
position = -140
score = 6.79702
sequence = TAAAAAGTACAGTGCGGCTGTCCTTTTAT

Gene: RBAM_006540: Sorbitol dehydrogenase (EC 1.1.1.14)
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -142
score = 7.34577
sequence = ATAAAAGTACAGTGCCGCTGTCCTTTTAT

Gene: BSU06150: Sorbitol dehydrogenase (EC 1.1.1.14)
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Sorbitol dehydrogenase (EC 1.1.1.14)
gutA
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_006550: Glucitol/sorbitol-specific transport protein
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU06160: Glucitol/sorbitol-specific transport protein
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Glucitol/sorbitol-specific transport protein
 
CRON 2.
gutR
 
Anoxybacillus flavithermus WK1
*
Bacillus amyloliquefaciens FZB42

Site:
position = -89
score = 6.79702
sequence = ATAAAAGGACAGCCGCACTGTACTTTTTA

Gene: RBAM_006530: Transcriptional regulator of the sorbitol operon
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -88
score = 7.34577
sequence = ATAAAAGGACAGCGGCACTGTACTTTTAT

Gene: BSU06140: Transcriptional regulator of the sorbitol operon
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Transcriptional regulator of the sorbitol operon
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD