Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Streptococcaceae

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 49 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactococcus lactis subsp. cremoris SK11 6 3
Lactococcus lactis subsp. lactis Il1403 6 3
Streptococcus agalactiae 2603V/R 6 3
Streptococcus dysgalactiae subsp. equisimilis GGS_124 6 3
Streptococcus equi subsp. zooepidemicus MGCS10565 5 3
Streptococcus gallolyticus UCN34 7 3
Streptococcus gordonii str. Challis substr. CH1 4 2
Streptococcus mitis B6 4 2
Streptococcus mutans UA159 4 2
Streptococcus pneumoniae TIGR4 4 2
Streptococcus pyogenes M1 GAS 5 2
Streptococcus sanguinis SK36 4 2
Streptococcus suis 05ZYH33 6 2
Streptococcus thermophilus CNRZ1066 5 2
Streptococcus uberis 0140J 6 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
clpL
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_0578: ATP-dependent Clp protease, ATP-binding subunit
 
Lactococcus lactis subsp. lactis Il1403

Gene: L0221: ATP-dependent Clp protease, ATP-binding subunit
*
Streptococcus agalactiae 2603V/R

Site:
position = -143
score = 6.94221
sequence = TTAGCACTCTAATATATTCAGTGCTAA

Gene: SAG0488: ATP-dependent Clp protease, ATP-binding subunit
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -141
score = 6.09771
sequence = TTATCACTCTATCCCTGACAGTGCTAA

Gene: SDEG_1496: ATP-dependent Clp protease, ATP-binding subunit
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -141
score = 5.93765
sequence = TTATCACTCTATACTGGATAGTGCTAA

Gene: Sez_0605: ATP-dependent Clp protease, ATP-binding subunit
*
Streptococcus gallolyticus UCN34

Site:
position = -144
score = 7.13899
sequence = ATAGCACTCTTAGCATAAGAGTGCTAA

Gene: GALLO_0612: ATP-dependent Clp protease, ATP-binding subunit
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0688: ATP-dependent Clp protease, ATP-binding subunit
 
Streptococcus mitis B6

Gene: smi_0865: ATP-dependent Clp protease, ATP-binding subunit
 
Streptococcus mutans UA159

Gene: SMU.562: ATP-dependent Clp protease, ATP-binding subunit
 
Streptococcus pneumoniae TIGR4

Gene: SP_0820: ATP-dependent Clp protease, ATP-binding subunit
 
Streptococcus pyogenes M1 GAS

Gene: SPy1509: ATP-dependent Clp protease, ATP-binding subunit
 
Streptococcus sanguinis SK36

Gene: SSA_0669: ATP-dependent Clp protease, ATP-binding subunit
 
Streptococcus suis 05ZYH33

Gene: SSU05_0492: ATP-dependent Clp protease, ATP-binding subunit
 
Streptococcus thermophilus CNRZ1066

Gene: str0602: ATP-dependent Clp protease, ATP-binding subunit
*
Streptococcus uberis 0140J

Site:
position = -140
score = 5.96507
sequence = TTATCACTCTAAGTCACTAAGTGCTAA

Gene: SUB1281: ATP-dependent Clp protease, ATP-binding subunit
ATP-dependent Clp protease, ATP-binding subunit
 
CRON 2.
groS
*
Lactococcus lactis subsp. cremoris SK11

Site:
position = -51
score = 7.12674
sequence = TTAGCACACAACTATTAAGAGTGCTAA

Gene: LACR_0439: Heat shock protein 60 family co-chaperone GroES
*
Lactococcus lactis subsp. lactis Il1403

Site:
position = -52
score = 7.89697
sequence = TTAGCACTCGTTTAATAAGAGTGCTAA

Gene: L198515: Heat shock protein 60 family co-chaperone GroES
*
Streptococcus agalactiae 2603V/R

Site:
position = -64
score = 7.5469
sequence = TTAGCACTCTCTGTATAAGAGTGCTAA

Gene: SAG2075: Heat shock protein 60 family co-chaperone GroES
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -61
score = 7.66213
sequence = TTAGCACTCGTACAACAAGAGTGCTAA

Gene: SDEG_2041: Heat shock protein 60 family co-chaperone GroES
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -65
score = 7.72636
sequence = TTAGCACTCATAAAACAAGAGTGCTAA

Gene: Sez_0145: Heat shock protein 60 family co-chaperone GroES
*
Streptococcus gallolyticus UCN34

Site:
position = -86
score = 7.53403
sequence = TTAGCACTCGATGTATTAGAGTGCTAA

Gene: GALLO_0124: Heat shock protein 60 family co-chaperone GroES
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -50
score = 7.33471
sequence = TTAGCACTCGATAGACGAGAGTGCTAA

Gene: SGO_1886: Heat shock protein 60 family co-chaperone GroES
*
Streptococcus mitis B6

Site:
position = -57
score = 7.72407
sequence = TTAGCACTCATCTATAAAGAGTGCTAA

Gene: smi_0481: Heat shock protein 60 family co-chaperone GroES
*
Streptococcus mutans UA159

Site:
position = -46
score = 6.96514
sequence = TTAGCACTCAGTATATTGGAGTGCTAA

Gene: SMU.1955: Heat shock protein 60 family co-chaperone GroES
*
Streptococcus pneumoniae TIGR4

Site:
position = -57
score = 7.57272
sequence = TTAGCACTCAAGTTCAAAGAGTGCTAA

Gene: SP_1907: Heat shock protein 60 family co-chaperone GroES
*
Streptococcus pyogenes M1 GAS

Site:
position = -62
score = 7.10575
sequence = TTAGCCCTCGATGAACATGAGTGCTAA

Gene: SPy2072: Heat shock protein 60 family co-chaperone GroES
*
Streptococcus sanguinis SK36

Site:
position = -51
score = 7.32891
sequence = TTAGCACTCGATAGTTTAGAGTGCTAA

Gene: SSA_0225: Heat shock protein 60 family co-chaperone GroES
*
Streptococcus suis 05ZYH33

Site:
position = -20
score = 7.71588
sequence = TTAGCACTCGAATACAAAGAGTGCTAA

Gene: SSU05_0147: Heat shock protein 60 family co-chaperone GroES
*
Streptococcus thermophilus CNRZ1066

Site:
position = -79
score = 6.43514
sequence = TTAGCAGTTGTCTATCGTGAGTGCTAA

Gene: str0203: Heat shock protein 60 family co-chaperone GroES
*
Streptococcus uberis 0140J

Site:
position = -63
score = 7.46042
sequence = TTGGCACTCTTTTTTAAAGAGTGCTAA

Gene: SUB1742: Heat shock protein 60 family co-chaperone GroES
Heat shock protein 60 family co-chaperone GroES
groL
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_0440: Heat shock protein 60 family chaperone GroEL
 
Lactococcus lactis subsp. lactis Il1403

Gene: L198893: Heat shock protein 60 family chaperone GroEL
 
Streptococcus agalactiae 2603V/R

Gene: SAG2074: Heat shock protein 60 family chaperone GroEL
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_2040: Heat shock protein 60 family chaperone GroEL
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_0146: Heat shock protein 60 family chaperone GroEL
 
Streptococcus gallolyticus UCN34

Gene: GALLO_0125: Heat shock protein 60 family chaperone GroEL
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1885: Heat shock protein 60 family chaperone GroEL
 
Streptococcus mitis B6

Gene: smi_0482: Heat shock protein 60 family chaperone GroEL
 
Streptococcus mutans UA159

Gene: SMU.1954: Heat shock protein 60 family chaperone GroEL
 
Streptococcus pneumoniae TIGR4

Gene: SP_1906: Heat shock protein 60 family chaperone GroEL
 
Streptococcus pyogenes M1 GAS

Gene: SPy2070: Heat shock protein 60 family chaperone GroEL
 
Streptococcus sanguinis SK36

Gene: SSA_0226: Heat shock protein 60 family chaperone GroEL
 2
Streptococcus suis 05ZYH33

Gene: SSU05_0148: Heat shock protein 60 family chaperone GroEL

Gene: SSU05_0149: Heat shock protein 60 family chaperone GroEL
 
Streptococcus thermophilus CNRZ1066

Gene: str0204: Heat shock protein 60 family chaperone GroEL
 
Streptococcus uberis 0140J

Gene: SUB1741: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
 
CRON 3.
hrcA
*
Lactococcus lactis subsp. cremoris SK11

Site:
position = -61
score = 6.98125
sequence = TTAGCACTTAGAGGTAAAGAGTGCTAA

Site:
position = -141
score = 8.07475
sequence = TTAGCACTCTAATAAAAAGAGTGCTAA

Gene: LACR_1025: Heat shock response transcriptional regulator HrcA, HrcA family
*
Lactococcus lactis subsp. lactis Il1403

Site:
position = -134
score = 6.73416
sequence = TTAGCACTTAGAGATGAAGAGTGCTAA

Site:
position = -214
score = 7.84319
sequence = TTAGCACTCTACCAAAAAGAGTGCTAA

Gene: L0212: Heat shock response transcriptional regulator HrcA, HrcA family
*
Streptococcus agalactiae 2603V/R

Site:
position = -58
score = 7.18738
sequence = TTAGCAGTCGATGTGTAAGAGTGCTAA

Site:
position = -140
score = 7.92485
sequence = TTAGCACTCTTTGAATAAGAGTGCTAA

Gene: SAG0095: Heat shock response transcriptional regulator HrcA, HrcA family
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -47
score = 7.12648
sequence = TTAGCAGTCAGATACATAGAGTGCTAA

Gene: SDEG_1830: Heat shock response transcriptional regulator HrcA, HrcA family
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -48
score = 6.87441
sequence = TTAGCAGTCCGATGTATAGAGTGCTAA

Gene: Sez_0400: Heat shock response transcriptional regulator HrcA, HrcA family
*
Streptococcus gallolyticus UCN34

Site:
position = -47
score = 7.14967
sequence = TTAGCAGTCGAGGTATATGAGTGCTAA

Site:
position = -130
score = 7.98648
sequence = TTAGCACTCTACTAAAAAGAGTGCTAA

Gene: GALLO_0241: Heat shock response transcriptional regulator HrcA, HrcA family
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -59
score = 6.34345
sequence = TTAGCACTCAAAGTGGTCGAGTGCTAA

Site:
position = -142
score = 7.89283
sequence = TTAGCACTCTTGCAAAAAGAGTGCTAA

Gene: SGO_0400: Heat shock response transcriptional regulator HrcA, HrcA family
*
Streptococcus mitis B6

Site:
position = -53
score = 6.45482
sequence = TTAGCACTTGAGTGCATCGAGTGCTAA

Site:
position = -136
score = 7.5173
sequence = TTAGCACTCTTGATGAAAGAGTGCTAA

Gene: smi_0353: Heat shock response transcriptional regulator HrcA, HrcA family
*
Streptococcus mutans UA159

Site:
position = -59
score = 7.24026
sequence = TTAGCAGTCGTCTGTTAAGAGTGCTAA

Site:
position = -143
score = 7.47985
sequence = TTAGCACTCAAGCAGAAAGAGTGCTAA

Gene: SMU.80: Heat shock response transcriptional regulator HrcA, HrcA family
*
Streptococcus pneumoniae TIGR4

Site:
position = -53
score = 6.47442
sequence = TTAGCACTTGGATGCATTGAGTGCTAA

Site:
position = -136
score = 7.83794
sequence = TTAGCACTCTTGATAAAAGAGTGCTAA

Gene: SP_0515: Heat shock response transcriptional regulator HrcA, HrcA family
*
Streptococcus pyogenes M1 GAS

Site:
position = -48
score = 7.60178
sequence = TTAGCAGTCTACTAAATAGAGTGCTAA

Site:
position = -132
score = 7.39069
sequence = TTAGCGCTCTTTATAAAAGAGTGCTAA

Gene: SPy1763: Heat shock response transcriptional regulator HrcA, HrcA family
*
Streptococcus sanguinis SK36

Site:
position = -142
score = 8.03612
sequence = TTAGCACTCTTGTAAAAAGAGTGCTAA

Site:
position = -59
score = 6.95013
sequence = TTAGCACTCGAGGTGATTGAGTGCTAA

Gene: SSA_2009: Heat shock response transcriptional regulator HrcA, HrcA family
*
Streptococcus suis 05ZYH33

Site:
position = -140
score = 7.37719
sequence = TTAGCACTCGATATCATAGAGTGCTAA

Site:
position = -226
score = 7.76551
sequence = TTAGCACTCTAAGCAAAAGAGTGCTAA

Gene: SSU05_0298: Heat shock response transcriptional regulator HrcA, HrcA family
*
Streptococcus thermophilus CNRZ1066

Site:
position = -49
score = 7.179
sequence = TTAGCAGTCGTTGTACGAGAGTGCTAA

Site:
position = -137
score = 7.95571
sequence = TTAGCACTCTTTCAAAAAGAGTGCTAA

Gene: str0118: Heat shock response transcriptional regulator HrcA, HrcA family
*
Streptococcus uberis 0140J

Site:
position = -45
score = 7.12004
sequence = TTAGCAGTCTTAGCATCAGAGTGCTAA

Gene: SUB1506: Heat shock response transcriptional regulator HrcA, HrcA family
Heat shock response transcriptional regulator HrcA, HrcA family
grpE
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_1026: Heat shock protein GrpE
 
Lactococcus lactis subsp. lactis Il1403

Gene: L0273: Heat shock protein GrpE
 
Streptococcus agalactiae 2603V/R

Gene: SAG0096: Heat shock protein GrpE
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1829: Heat shock protein GrpE
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_0401: Heat shock protein GrpE
 
Streptococcus gallolyticus UCN34

Gene: GALLO_0242: Heat shock protein GrpE
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0401: Heat shock protein GrpE
 
Streptococcus mitis B6

Gene: smi_0354: Heat shock protein GrpE
 
Streptococcus mutans UA159

Gene: SMU.81: Heat shock protein GrpE
 
Streptococcus pneumoniae TIGR4

Gene: SP_0516: Heat shock protein GrpE
 
Streptococcus pyogenes M1 GAS

Gene: SPy1761: Heat shock protein GrpE
 
Streptococcus sanguinis SK36

Gene: SSA_2008: Heat shock protein GrpE
 
Streptococcus suis 05ZYH33

Gene: SSU05_0299: Heat shock protein GrpE
 
Streptococcus thermophilus CNRZ1066

Gene: str0119: Heat shock protein GrpE
 
Streptococcus uberis 0140J

Gene: SUB1505: Heat shock protein GrpE
Heat shock protein GrpE
dnaK
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_1027: Chaperone protein DnaK
 
Lactococcus lactis subsp. lactis Il1403

Gene: L178206: Chaperone protein DnaK
 
Streptococcus agalactiae 2603V/R

Gene: SAG0097: Chaperone protein DnaK
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1827: Chaperone protein DnaK
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_0402: Chaperone protein DnaK
 
Streptococcus gallolyticus UCN34

Gene: GALLO_0243: Chaperone protein DnaK
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0402: Chaperone protein DnaK
 
Streptococcus mitis B6

Gene: smi_0355: Chaperone protein DnaK
 
Streptococcus mutans UA159

Gene: SMU.82: Chaperone protein DnaK
 
Streptococcus pneumoniae TIGR4

Gene: SP_0517: Chaperone protein DnaK
 
Streptococcus pyogenes M1 GAS

Gene: SPy1760: Chaperone protein DnaK
 
Streptococcus sanguinis SK36

Gene: SSA_2007: Chaperone protein DnaK
 
Streptococcus suis 05ZYH33

Gene: SSU05_0300: Chaperone protein DnaK
 
Streptococcus thermophilus CNRZ1066

Gene: str0120: Chaperone protein DnaK
 
Streptococcus uberis 0140J

Gene: SUB1504: Chaperone protein DnaK
Chaperone protein DnaK
dnaJ
*
Lactococcus lactis subsp. cremoris SK11

Site:
position = -108
score = 7.87005
sequence = TTAGCACTCTGATAAAAAGAGTGCTAA

Gene: LACR_2529: Chaperone protein DnaJ
*
Lactococcus lactis subsp. lactis Il1403

Site:
position = -108
score = 8.06015
sequence = TTAGCACTCTTATAAAAAGAGTGCTAA

Gene: L0272: Chaperone protein DnaJ
 
Streptococcus agalactiae 2603V/R

Gene: SAG0098: Chaperone protein DnaJ
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1825: Chaperone protein DnaJ
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_0403: Chaperone protein DnaJ
 
Streptococcus gallolyticus UCN34

Gene: GALLO_0245: Chaperone protein DnaJ
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0404: Chaperone protein DnaJ
 
Streptococcus mitis B6
 
Streptococcus mutans UA159

Gene: SMU.83: Chaperone protein DnaJ
 
Streptococcus pneumoniae TIGR4

Gene: SP_0519: Chaperone protein DnaJ
 
Streptococcus pyogenes M1 GAS

Gene: SPy1759: Chaperone protein DnaJ
 
Streptococcus sanguinis SK36

Gene: SSA_2005: Chaperone protein DnaJ
 
Streptococcus suis 05ZYH33

Gene: SSU05_0302: Chaperone protein DnaJ
 
Streptococcus thermophilus CNRZ1066

Gene: str0121: Chaperone protein DnaJ
 
Streptococcus uberis 0140J

Gene: SUB1503: Chaperone protein DnaJ
Chaperone protein DnaJ
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD