Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RbsR - Lactobacillaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 18 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactobacillus acidophilus NCFM
Lactobacillus brevis ATCC 367 3 3
Lactobacillus casei ATCC 334 5 1
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Lactobacillus fermentum IFO 3956 5 3
Lactobacillus helveticus DPC 4571
Lactobacillus johnsonii NCC 533
Lactobacillus plantarum WCFS1 3 1
Lactobacillus reuteri JCM 1112 2 1
Lactobacillus rhamnosus GG 2 1
Lactobacillus sakei subsp. sakei 23K 4 1
Lactobacillus salivarius subsp. salivarius UCC118
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 2 2
Oenococcus oeni PSU-1 4 2
Pediococcus pentosaceus ATCC 25745 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rbsR
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367

Gene: LVIS_1422: Transcriptional repressor of ribose utilization, LacI family
*
Lactobacillus casei ATCC 334

Site:
position = -45
score = 6.73597
sequence = TAAGTAAAACGTTTTACCTA

Gene: LSEI_0306: Transcriptional repressor of ribose utilization, LacI family
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
*
Lactobacillus fermentum IFO 3956

Site:
position = -44
score = 5.98689
sequence = TTAGTAAACTGTTTTATTAA

Gene: LAF_1343: Transcriptional repressor of ribose utilization, LacI family
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_3661: Transcriptional repressor of ribose utilization, LacI family
*
Lactobacillus reuteri JCM 1112

Site:
position = -35
score = 4.66901
sequence = TAGATAAAACTGTTTACTAA

Gene: LAR_1219: Transcriptional repressor of ribose utilization, LacI family
*
Lactobacillus rhamnosus GG

Site:
position = -46
score = 6.73597
sequence = TAAGTAAAACGTTTTACCTA

Gene: LGG_00372: Transcriptional repressor of ribose utilization, LacI family
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA0203: Transcriptional repressor of ribose utilization, LacI family
 
Lactobacillus salivarius subsp. salivarius UCC118
*
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Site:
position = -123
score = 6.56921
sequence = TTAGTAAAACGTTTAACCAA

Gene: LEUM_0795: Transcriptional repressor of ribose utilization, LacI family
*
Oenococcus oeni PSU-1

Site:
position = -47
score = 5.11961
sequence = TGTTGTAAACGTTTTAAGAA

Gene: OEOE_0146: Transcriptional repressor of ribose utilization, LacI family
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_1700: Transcriptional repressor of ribose utilization, LacI family
Transcriptional repressor of ribose utilization, LacI family
rbsD
 
Lactobacillus acidophilus NCFM

Gene: LBA1484: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
*
Lactobacillus brevis ATCC 367

Site:
position = -125
score = 5.03979
sequence = TAAGTAAATCGATTTACGCA

Gene: LVIS_1589: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Lactobacillus casei ATCC 334

Gene: LSEI_0307: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956

Gene: LAF_1737: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533

Gene: LJ1214: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Lactobacillus plantarum WCFS1

Gene: lp_3659: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0400: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA0201: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1

Gene: OEOE_1613: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_1698: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsA
 
Lactobacillus acidophilus NCFM

Gene: LBA1483: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_0308: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
rbsC
 
Lactobacillus acidophilus NCFM

Gene: LBA1482: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_0309: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
rbsB
 
Lactobacillus acidophilus NCFM

Gene: LBA1481: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_0310: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
rbsU
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533

Gene: LJ1213: Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5)
 
Lactobacillus plantarum WCFS1

Gene: lp_3658: Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5)
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = -49
score = 6.91678
sequence = TTAGTAAAACGTTTTACTAA

Gene: LSA0200: Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5)
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_1697: Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5)
Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5)
rbsK
 2
Lactobacillus acidophilus NCFM

Gene: LBA0587: Ribokinase (EC 2.7.1.15)

Gene: LBA1485: Ribokinase (EC 2.7.1.15)
*
Lactobacillus brevis ATCC 367

Site:
position = -50
score = 6.46515
sequence = TACGTAAAACGTTTTACAAA

Gene: LVIS_1421: Ribokinase (EC 2.7.1.15)
 
Lactobacillus casei ATCC 334

Gene: LSEI_0312: Ribokinase (EC 2.7.1.15)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_0470: Ribokinase (EC 2.7.1.15)
*2
Lactobacillus fermentum IFO 3956

Site:
position = -47
score = 5.00107
sequence = AACGTAAAACGATTTACTGA

Gene: LAF_1689: Ribokinase (EC 2.7.1.15)

Site:
position = -59
score = 6.22954
sequence = TACGTAAAAGGTTTTAACAA

Gene: LAF_1738: Ribokinase (EC 2.7.1.15)
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533

Gene: LJ0797: Ribokinase (EC 2.7.1.15)
*
Lactobacillus plantarum WCFS1

Site:
position = -74
score = 6.22293
sequence = TTATTAAAACGTTTTCATAA

Site:
position = -61
score = 6.05536
sequence = TTCATAAAACGTTTTAATAA

Gene: lp_3660: Ribokinase (EC 2.7.1.15)
 2
Lactobacillus reuteri JCM 1112

Gene: LAR_1218: Ribokinase (EC 2.7.1.15)

Gene: LAR_0399: Ribokinase (EC 2.7.1.15)
 
Lactobacillus rhamnosus GG

Gene: LGG_00373: Ribokinase (EC 2.7.1.15)
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA0202: Ribokinase (EC 2.7.1.15)
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_0423: Ribokinase (EC 2.7.1.15)
*
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Site:
position = -46
score = 6.56921
sequence = TTAGTAAAACGTTTAACCAA

Gene: LEUM_0794: Ribokinase (EC 2.7.1.15)
*
Oenococcus oeni PSU-1

Site:
position = 25
score = 6.44693
sequence = TTAGTAAAGCGTTTTACTTA

Gene: OEOE_1612: Ribokinase (EC 2.7.1.15)
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -67
score = 5.64475
sequence = CTATTAAAACGTTTTCATAA

Site:
position = -54
score = 5.33283
sequence = TTCATAAAACGTTTTAAACA

Gene: PEPE_1699: Ribokinase (EC 2.7.1.15)
Ribokinase (EC 2.7.1.15)
rbsP
 
Lactobacillus acidophilus NCFM
*
Lactobacillus brevis ATCC 367

Site:
position = -48
score = 5.21207
sequence = GATGTAAAACGTTTTACGAT

Gene: LVIS_1588: Predicted ribose permease
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956

Gene: LAF_1736: Predicted ribose permease
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_0498: Predicted ribose permease
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0401: Predicted ribose permease
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1

Gene: OEOE_1614: Predicted ribose permease
 
Pediococcus pentosaceus ATCC 25745
Predicted ribose permease
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD