Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MurR - Streptococcaceae

Properties
Regulator type: Transcription factor
Regulator family: RpiR
Regulation mode: repressor
Biological process: N-acetylmuramate utilization
Effector: N-acetylmuramate-6-phosphate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactococcus lactis subsp. cremoris SK11 4 1
Lactococcus lactis subsp. lactis Il1403 5 1
Streptococcus agalactiae 2603V/R
Streptococcus dysgalactiae subsp. equisimilis GGS_124
Streptococcus equi subsp. zooepidemicus MGCS10565
Streptococcus gallolyticus UCN34
Streptococcus gordonii str. Challis substr. CH1
Streptococcus mitis B6
Streptococcus mutans UA159
Streptococcus pneumoniae TIGR4
Streptococcus pyogenes M1 GAS
Streptococcus sanguinis SK36
Streptococcus suis 05ZYH33
Streptococcus thermophilus CNRZ1066
Streptococcus uberis 0140J
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
murX
*
Lactococcus lactis subsp. cremoris SK11

Site:
position = -111
score = 6.60059
sequence = AAACGAAATAATATTTCTTAA

Site:
position = -71
score = 6.55814
sequence = GCTTGAAATAATAATTCGTTT

Gene: LACR_1240: Predicted outer membrane protein
*
Lactococcus lactis subsp. lactis Il1403

Site:
position = -71
score = 6.78934
sequence = ACTTGAAATAATAATTCTTTT

Site:
position = -112
score = 6.36939
sequence = CAATGAAATAATATTTCAAAA

Gene: L143292: Predicted outer membrane protein
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Predicted outer membrane protein
murQ
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_1241: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)
 
Lactococcus lactis subsp. lactis Il1403

Gene: L144334: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)
murP
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_1242: MurNAc-specific PTS system, EIIBC component
 2
Lactococcus lactis subsp. lactis Il1403

Gene: L146642: MurNAc-specific PTS system, EIIBC component

Gene: L145238: MurNAc-specific PTS system, EIIBC component
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
MurNAc-specific PTS system, EIIBC component
murR
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_1243: N-acetylmuramate utilization transcriptional regulator MurR, RpiR family
 
Lactococcus lactis subsp. lactis Il1403

Gene: L147291: N-acetylmuramate utilization transcriptional regulator MurR, RpiR family
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
N-acetylmuramate utilization transcriptional regulator MurR, RpiR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD