Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PaaR - Actinobacteria

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 85 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acidothermus cellulolyticus 11B 6 2
Arthrobacter chlorophenolicus A6 15 6
Arthrobacter sp. FB24 14 6
Brevibacterium linens BL2 11 3
Corynebacterium efficiens YS-314 17 7
Kocuria rhizophila DC2201 15 5
Mycobacterium abscessus ATCC 19977 13 4
Nakamurella multipartita DSM 44233 9 2
Nocardia farcinica IFM 10152 14 3
Rhodococcus erythropolis PR4 14 5
Rhodococcus opacus B4 15 5
Rhodococcus sp. RHA1 15 5
Saccharomonospora viridis DSM 43017 10 3
Saccharopolyspora erythraea NRRL 2338 8 2
Streptomyces avermitilis MA-4680 12 5
Streptomyces coelicolor A3(2) 13 5
Streptomyces griseus subsp. griseus NBRC 13350 11 5
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
bkdA
 
Acidothermus cellulolyticus 11B
 
Arthrobacter chlorophenolicus A6

Gene: Achl_2905: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
 
Arthrobacter sp. FB24

Gene: Arth_3193: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
 
Brevibacterium linens BL2

Gene: BlinB01003357: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
 
Corynebacterium efficiens YS-314
 
Kocuria rhizophila DC2201

Gene: KRH_21250: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
 
Mycobacterium abscessus ATCC 19977
 
Nakamurella multipartita DSM 44233
 
Nocardia farcinica IFM 10152
 
Rhodococcus erythropolis PR4
 
Rhodococcus opacus B4
 
Rhodococcus sp. RHA1
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338

Gene: SACE_5542: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
*
Streptomyces avermitilis MA-4680

Site:
position = -77
score = 5.51192
sequence = GACGACCGAACAATCGGTAGGT

Gene: SAV_4362: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
*
Streptomyces coelicolor A3(2)

Site:
position = -78
score = 5.51192
sequence = GACGACCGAACAATCGGTAGGT

Gene: SCO3831: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -127
score = 5.59169
sequence = CGCGACCGAACAATCGGTAGGT

Gene: SGR_3748: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
bkdB
 
Acidothermus cellulolyticus 11B
 
Arthrobacter chlorophenolicus A6

Gene: Achl_2904: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
 
Arthrobacter sp. FB24

Gene: Arth_3192: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
 
Brevibacterium linens BL2

Gene: BlinB01003356: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
 
Corynebacterium efficiens YS-314
 
Kocuria rhizophila DC2201

Gene: KRH_21260: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
 
Mycobacterium abscessus ATCC 19977
 
Nakamurella multipartita DSM 44233
 
Nocardia farcinica IFM 10152
 
Rhodococcus erythropolis PR4
 
Rhodococcus opacus B4
 
Rhodococcus sp. RHA1
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338

Gene: SACE_5543: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
 
Streptomyces avermitilis MA-4680

Gene: SAV_4363: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
 
Streptomyces coelicolor A3(2)

Gene: SCO3830: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_3749: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
bkdC
 
Acidothermus cellulolyticus 11B
 
Arthrobacter chlorophenolicus A6

Gene: Achl_2903: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
 
Arthrobacter sp. FB24

Gene: Arth_3191: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
 
Brevibacterium linens BL2

Gene: BlinB01003355: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
 
Corynebacterium efficiens YS-314
 
Kocuria rhizophila DC2201

Gene: KRH_21270: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
 
Mycobacterium abscessus ATCC 19977
 
Nakamurella multipartita DSM 44233
 
Nocardia farcinica IFM 10152
 
Rhodococcus erythropolis PR4
 
Rhodococcus opacus B4
 
Rhodococcus sp. RHA1
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338

Gene: SACE_5544: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
 
Streptomyces avermitilis MA-4680

Gene: SAV_4364: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
 
Streptomyces coelicolor A3(2)

Gene: SCO3829: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_3750: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
 
CRON 2.
hisE
 
Acidothermus cellulolyticus 11B
 
Arthrobacter chlorophenolicus A6

Gene: Achl_1674: phosphoribosyl-ATP diphosphatase
 
Arthrobacter sp. FB24

Gene: Arth_1679: phosphoribosyl-ATP diphosphatase
 
Brevibacterium linens BL2

Gene: BlinB01000126: phosphoribosyl-ATP diphosphatase
*
Corynebacterium efficiens YS-314

Site:
position = -23
score = 5.13982
sequence = AACAACCGCACGATCGGTATGT

Gene: CE1635: phosphoribosyl-ATP diphosphatase
 
Kocuria rhizophila DC2201

Gene: KRH_11730: phosphoribosyl-ATP diphosphatase
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_2131: phosphoribosyl-ATP diphosphatase
 
Nakamurella multipartita DSM 44233

Gene: Namu_2980: phosphoribosyl-ATP diphosphatase
 
Nocardia farcinica IFM 10152

Gene: nfa31860: phosphoribosyl-ATP diphosphatase
 
Rhodococcus erythropolis PR4

Gene: RER_31850: phosphoribosyl-ATP diphosphatase
 
Rhodococcus opacus B4

Gene: ROP_05930: phosphoribosyl-ATP diphosphatase
 
Rhodococcus sp. RHA1

Gene: RHA1_ro00855: phosphoribosyl-ATP diphosphatase
 
Saccharomonospora viridis DSM 43017

Gene: Svir_22180: phosphoribosyl-ATP diphosphatase
 
Saccharopolyspora erythraea NRRL 2338

Gene: SACE_2237: phosphoribosyl-ATP diphosphatase
 
Streptomyces avermitilis MA-4680

Gene: SAV_6906: phosphoribosyl-ATP diphosphatase
 
Streptomyces coelicolor A3(2)

Gene: SCO1439: phosphoribosyl-ATP diphosphatase
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_6094: phosphoribosyl-ATP diphosphatase
phosphoribosyl-ATP diphosphatase
hisG
 
Acidothermus cellulolyticus 11B

Gene: Acel_1270: ATP phosphoribosyltransferase (EC 2.4.2.17)
 
Arthrobacter chlorophenolicus A6

Gene: Achl_1675: ATP phosphoribosyltransferase (EC 2.4.2.17)
 
Arthrobacter sp. FB24

Gene: Arth_1680: ATP phosphoribosyltransferase (EC 2.4.2.17)
 
Brevibacterium linens BL2

Gene: BlinB01000125: ATP phosphoribosyltransferase (EC 2.4.2.17)
 
Corynebacterium efficiens YS-314

Gene: CE1634: ATP phosphoribosyltransferase (EC 2.4.2.17)
 
Kocuria rhizophila DC2201

Gene: KRH_11740: ATP phosphoribosyltransferase (EC 2.4.2.17)
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_2132: ATP phosphoribosyltransferase (EC 2.4.2.17)
 
Nakamurella multipartita DSM 44233

Gene: Namu_2979: ATP phosphoribosyltransferase (EC 2.4.2.17)
 
Nocardia farcinica IFM 10152

Gene: nfa31850: ATP phosphoribosyltransferase (EC 2.4.2.17)
 
Rhodococcus erythropolis PR4

Gene: RER_31840: ATP phosphoribosyltransferase (EC 2.4.2.17)
 
Rhodococcus opacus B4

Gene: ROP_05920: ATP phosphoribosyltransferase (EC 2.4.2.17)
 
Rhodococcus sp. RHA1

Gene: RHA1_ro00854: ATP phosphoribosyltransferase (EC 2.4.2.17)
 
Saccharomonospora viridis DSM 43017

Gene: Svir_22170: ATP phosphoribosyltransferase (EC 2.4.2.17)
 
Saccharopolyspora erythraea NRRL 2338

Gene: SACE_2238: ATP phosphoribosyltransferase (EC 2.4.2.17)
 
Streptomyces avermitilis MA-4680

Gene: SAV_6907: ATP phosphoribosyltransferase (EC 2.4.2.17)
 
Streptomyces coelicolor A3(2)

Gene: SCO1438: ATP phosphoribosyltransferase (EC 2.4.2.17)
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_6095: ATP phosphoribosyltransferase (EC 2.4.2.17)
ATP phosphoribosyltransferase (EC 2.4.2.17)
 
CRON 3.
paaJ
 
Acidothermus cellulolyticus 11B
*
Arthrobacter chlorophenolicus A6

Site:
position = -83
score = 6.06424
sequence = ACAGAACGAACGGTCGGTAAGT

Gene: Achl_3063: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
*
Arthrobacter sp. FB24

Site:
position = -83
score = 5.38954
sequence = ATAGAACGAACGGTCGGTAAAT

Gene: Arth_3268: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
 
Brevibacterium linens BL2

Gene: BlinB01000727: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
 
Corynebacterium efficiens YS-314

Gene: CE0673: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
 
Kocuria rhizophila DC2201

Gene: KRH_02300: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
*
Mycobacterium abscessus ATCC 19977

Site:
position = -44
score = 6.19901
sequence = ACCGACCGAACGATCGGTTATT

Gene: MAB_0902: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
 
Nakamurella multipartita DSM 44233
*
Nocardia farcinica IFM 10152

Site:
position = -49
score = 5.81919
sequence = ACTGACCGAATGTTCGGTAATA

Gene: nfa21570: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
 
Rhodococcus erythropolis PR4
*
Rhodococcus opacus B4

Site:
position = -148
score = 5.14428
sequence = TTTCACCGTACGTTCGGTCGGT

Site:
position = -53
score = 5.33985
sequence = ACCGACCGAAGATTCGGTTATT

Gene: ROP_25860: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
*
Rhodococcus sp. RHA1

Site:
position = -149
score = 5.14428
sequence = TTTCACCGTACGTTCGGTCGGT

Site:
position = -53
score = 5.33985
sequence = ACCGACCGAAGATTCGGTTATT

Gene: RHA1_ro02863: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
 
Streptomyces avermitilis MA-4680
 
Streptomyces coelicolor A3(2)
 
Streptomyces griseus subsp. griseus NBRC 13350
Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
paaF
 
Acidothermus cellulolyticus 11B
 
Arthrobacter chlorophenolicus A6

Gene: Achl_3062: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Arthrobacter sp. FB24

Gene: Arth_3267: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Brevibacterium linens BL2

Gene: BlinB01000728: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Corynebacterium efficiens YS-314

Gene: CE0674: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Kocuria rhizophila DC2201

Gene: KRH_02290: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_0903: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Nakamurella multipartita DSM 44233
 
Nocardia farcinica IFM 10152

Gene: nfa21580: Enoyl-CoA hydratase (EC 4.2.1.17)
*
Rhodococcus erythropolis PR4

Site:
position = 29
score = 5.68047
sequence = AACGACCGAATGTTCGGTTATT

Gene: RER_55530: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Rhodococcus opacus B4

Gene: ROP_25850: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Rhodococcus sp. RHA1

Gene: RHA1_ro02862: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
 
Streptomyces avermitilis MA-4680
 
Streptomyces coelicolor A3(2)
 
Streptomyces griseus subsp. griseus NBRC 13350
Enoyl-CoA hydratase (EC 4.2.1.17)
paaH
 
Acidothermus cellulolyticus 11B

Gene: Acel_0147: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Arthrobacter chlorophenolicus A6

Gene: Achl_3061: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Arthrobacter sp. FB24

Gene: Arth_3266: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Brevibacterium linens BL2

Gene: BlinB01000729: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Corynebacterium efficiens YS-314

Gene: CE0675: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Kocuria rhizophila DC2201

Gene: KRH_02280: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_0904: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Nakamurella multipartita DSM 44233

Gene: Namu_2482: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Nocardia farcinica IFM 10152

Gene: nfa21590: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Rhodococcus erythropolis PR4

Gene: RER_55520: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Rhodococcus opacus B4

Gene: ROP_25840: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Rhodococcus sp. RHA1

Gene: RHA1_ro02861: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
*
Saccharomonospora viridis DSM 43017

Site:
position = -116
score = 5.74761
sequence = ACTGACCGAATGGACGGTTACT

Gene: Svir_26550: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Saccharopolyspora erythraea NRRL 2338
*
Streptomyces avermitilis MA-4680

Site:
position = -74
score = 6.04741
sequence = AGTAACCGAACGATCGGTCGGG

Gene: SAV_4359: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
*
Streptomyces coelicolor A3(2)

Site:
position = -74
score = 6.04741
sequence = AGTAACCGAACGATCGGTCGGG

Gene: SCO3834: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Streptomyces griseus subsp. griseus NBRC 13350
3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
paaG
 
Acidothermus cellulolyticus 11B

Gene: Acel_1836: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Arthrobacter chlorophenolicus A6

Gene: Achl_2959: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Arthrobacter sp. FB24

Gene: Arth_3213: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Brevibacterium linens BL2

Gene: BlinB01000730: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Corynebacterium efficiens YS-314

Gene: CE0672: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Kocuria rhizophila DC2201

Gene: KRH_02100: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_0905: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Nakamurella multipartita DSM 44233

Gene: Namu_2150: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Nocardia farcinica IFM 10152

Gene: nfa21600: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Rhodococcus erythropolis PR4

Gene: RER_55510: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Rhodococcus opacus B4

Gene: ROP_25830: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Rhodococcus sp. RHA1

Gene: RHA1_ro02860: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Saccharomonospora viridis DSM 43017

Gene: Svir_06370: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Saccharopolyspora erythraea NRRL 2338

Gene: SACE_1028: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Streptomyces avermitilis MA-4680

Gene: SAV_3120: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Streptomyces coelicolor A3(2)

Gene: SCO5144: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_2381: Enoyl-CoA hydratase (EC 4.2.1.17)
Enoyl-CoA hydratase (EC 4.2.1.17)
paaA
*
Acidothermus cellulolyticus 11B

Site:
position = -41
score = 5.34778
sequence = GTCAACCGAACATTCGGTCGGT

Gene: Acel_1443: Phenylacetate-CoA oxygenase, PaaA subunit
*
Arthrobacter chlorophenolicus A6

Site:
position = -64
score = 5.82946
sequence = CCTGAACGAACGGTCGGTAAAT

Gene: Achl_2964: Phenylacetate-CoA oxygenase, PaaA subunit
*
Arthrobacter sp. FB24

Site:
position = -49
score = 5.88382
sequence = CCTGAACGAACGGTCGGTAATT

Gene: Arth_3218: Phenylacetate-CoA oxygenase, PaaA subunit
*
Brevibacterium linens BL2

Site:
position = -105
score = 4.50547
sequence = CAATACAGAACAAATGGTCAGT

Gene: BlinB01000722: Phenylacetate-CoA oxygenase, PaaA subunit
*
Corynebacterium efficiens YS-314

Site:
position = -128
score = 6.07241
sequence = ACTGACCGGGCGGTCGGTTAGT

Gene: CE0667: Phenylacetate-CoA oxygenase, PaaA subunit
*
Kocuria rhizophila DC2201

Site:
position = -210
score = 5.57424
sequence = ATTTTCAGAACGATCGGTCAGT

Site:
position = -67
score = 5.00629
sequence = TCTGAACGAGCGGTCAGTTATT

Gene: KRH_02150: Phenylacetate-CoA oxygenase, PaaA subunit
*
Mycobacterium abscessus ATCC 19977

Site:
position = -37
score = 6.17773
sequence = AATAACCGAACATTCGGTCGGT

Gene: MAB_0906: Phenylacetate-CoA oxygenase, PaaA subunit
*
Nakamurella multipartita DSM 44233

Site:
position = -70
score = 6.0197
sequence = TCTTACTGACCGTTCGGTCAGT

Gene: Namu_2491: Phenylacetate-CoA oxygenase, PaaA subunit
 
Nocardia farcinica IFM 10152

Gene: nfa21610: Phenylacetate-CoA oxygenase, PaaA subunit
*
Rhodococcus erythropolis PR4

Site:
position = -35
score = 5.03299
sequence = ACCAACCGATCATTCGGTAATA

Gene: RER_55500: Phenylacetate-CoA oxygenase, PaaA subunit
*
Rhodococcus opacus B4

Site:
position = 23
score = 5.03299
sequence = ACCAACCGATCATTCGGTAATA

Gene: ROP_25820: Phenylacetate-CoA oxygenase, PaaA subunit
*
Rhodococcus sp. RHA1

Site:
position = -34
score = 5.03299
sequence = ACCAACCGATCATTCGGTAATA

Gene: RHA1_ro02859: Phenylacetate-CoA oxygenase, PaaA subunit
 
Saccharomonospora viridis DSM 43017

Gene: Svir_26530: Phenylacetate-CoA oxygenase, PaaA subunit
 
Saccharopolyspora erythraea NRRL 2338

Gene: SACE_3544: Phenylacetate-CoA oxygenase, PaaA subunit
*
Streptomyces avermitilis MA-4680

Site:
position = -52
score = 5.93709
sequence = GCGAACCGAACGATCGGTCGGT

Gene: SAV_4354: Phenylacetate-CoA oxygenase, PaaA subunit
*
Streptomyces coelicolor A3(2)

Site:
position = -157
score = 5.27229
sequence = CCCGACCGACCATTCGGTTAGC

Site:
position = -34
score = 5.31018
sequence = ACCGAACGAATGGTCGGTTGGG

Gene: SCO7471: Phenylacetate-CoA oxygenase, PaaA subunit
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -34
score = 6.14672
sequence = AGGAACCGAACGATCGGTCGGT

Gene: SGR_3741: Phenylacetate-CoA oxygenase, PaaA subunit
Phenylacetate-CoA oxygenase, PaaA subunit
paaB
 
Acidothermus cellulolyticus 11B

Gene: Acel_1442: Phenylacetate-CoA oxygenase, PaaB subunit
 
Arthrobacter chlorophenolicus A6

Gene: Achl_2963: Phenylacetate-CoA oxygenase, PaaB subunit
 
Arthrobacter sp. FB24

Gene: Arth_3217: Phenylacetate-CoA oxygenase, PaaB subunit
 
Brevibacterium linens BL2

Gene: BlinB01000723: Phenylacetate-CoA oxygenase, PaaB subunit
 
Corynebacterium efficiens YS-314

Gene: CE0668: Phenylacetate-CoA oxygenase, PaaB subunit
 
Kocuria rhizophila DC2201

Gene: KRH_02140: Phenylacetate-CoA oxygenase, PaaB subunit
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_0907: Phenylacetate-CoA oxygenase, PaaB subunit
 
Nakamurella multipartita DSM 44233

Gene: Namu_2490: Phenylacetate-CoA oxygenase, PaaB subunit
 
Nocardia farcinica IFM 10152

Gene: nfa21620: Phenylacetate-CoA oxygenase, PaaB subunit
 
Rhodococcus erythropolis PR4

Gene: RER_55490: Phenylacetate-CoA oxygenase, PaaB subunit
 
Rhodococcus opacus B4

Gene: ROP_25810: Phenylacetate-CoA oxygenase, PaaB subunit
 
Rhodococcus sp. RHA1

Gene: RHA1_ro02858: Phenylacetate-CoA oxygenase, PaaB subunit
 
Saccharomonospora viridis DSM 43017

Gene: Svir_26520: Phenylacetate-CoA oxygenase, PaaB subunit
 
Saccharopolyspora erythraea NRRL 2338

Gene: SACE_3545: Phenylacetate-CoA oxygenase, PaaB subunit
 
Streptomyces avermitilis MA-4680

Gene: SAV_4353: Phenylacetate-CoA oxygenase, PaaB subunit
 
Streptomyces coelicolor A3(2)

Gene: SCO7472: Phenylacetate-CoA oxygenase, PaaB subunit
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_3740: Phenylacetate-CoA oxygenase, PaaB subunit
Phenylacetate-CoA oxygenase, PaaB subunit
paaC
 
Acidothermus cellulolyticus 11B

Gene: Acel_1441: Phenylacetate-CoA oxygenase, PaaC subunit
 
Arthrobacter chlorophenolicus A6

Gene: Achl_2962: Phenylacetate-CoA oxygenase, PaaC subunit
 
Arthrobacter sp. FB24

Gene: Arth_3216: Phenylacetate-CoA oxygenase, PaaC subunit
 
Brevibacterium linens BL2

Gene: BlinB01000724: Phenylacetate-CoA oxygenase, PaaC subunit
 
Corynebacterium efficiens YS-314

Gene: CE0669: Phenylacetate-CoA oxygenase, PaaC subunit
 
Kocuria rhizophila DC2201

Gene: KRH_02130: Phenylacetate-CoA oxygenase, PaaC subunit
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_0908: Phenylacetate-CoA oxygenase, PaaC subunit
 
Nakamurella multipartita DSM 44233

Gene: Namu_2489: Phenylacetate-CoA oxygenase, PaaC subunit
 
Nocardia farcinica IFM 10152

Gene: nfa21630: Phenylacetate-CoA oxygenase, PaaC subunit
 
Rhodococcus erythropolis PR4

Gene: RER_55480: Phenylacetate-CoA oxygenase, PaaC subunit
 
Rhodococcus opacus B4

Gene: ROP_25800: Phenylacetate-CoA oxygenase, PaaC subunit
 
Rhodococcus sp. RHA1

Gene: RHA1_ro02857: Phenylacetate-CoA oxygenase, PaaC subunit
 
Saccharomonospora viridis DSM 43017

Gene: Svir_26510: Phenylacetate-CoA oxygenase, PaaC subunit
 
Saccharopolyspora erythraea NRRL 2338

Gene: SACE_3546: Phenylacetate-CoA oxygenase, PaaC subunit
 
Streptomyces avermitilis MA-4680

Gene: SAV_4352: Phenylacetate-CoA oxygenase, PaaC subunit
 
Streptomyces coelicolor A3(2)

Gene: SCO7473: Phenylacetate-CoA oxygenase, PaaC subunit
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_3739: Phenylacetate-CoA oxygenase, PaaC subunit
Phenylacetate-CoA oxygenase, PaaC subunit
paaD
 
Acidothermus cellulolyticus 11B

Gene: Acel_1440: Phenylacetate-CoA oxygenase, PaaD subunit
 
Arthrobacter chlorophenolicus A6

Gene: Achl_2961: Phenylacetate-CoA oxygenase, PaaD subunit
 
Arthrobacter sp. FB24

Gene: Arth_3215: Phenylacetate-CoA oxygenase, PaaD subunit
 
Brevibacterium linens BL2

Gene: BlinB01000725: Phenylacetate-CoA oxygenase, PaaD subunit
 
Corynebacterium efficiens YS-314

Gene: CE0670: Phenylacetate-CoA oxygenase, PaaD subunit
 
Kocuria rhizophila DC2201

Gene: KRH_02120: Phenylacetate-CoA oxygenase, PaaD subunit
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_0909: Phenylacetate-CoA oxygenase, PaaD subunit
 
Nakamurella multipartita DSM 44233

Gene: Namu_2488: Phenylacetate-CoA oxygenase, PaaD subunit
 
Nocardia farcinica IFM 10152

Gene: nfa21640: Phenylacetate-CoA oxygenase, PaaD subunit
 
Rhodococcus erythropolis PR4

Gene: RER_55470: Phenylacetate-CoA oxygenase, PaaD subunit
 
Rhodococcus opacus B4

Gene: ROP_25790: Phenylacetate-CoA oxygenase, PaaD subunit
 
Rhodococcus sp. RHA1

Gene: RHA1_ro02856: Phenylacetate-CoA oxygenase, PaaD subunit
 
Saccharomonospora viridis DSM 43017

Gene: Svir_26500: Phenylacetate-CoA oxygenase, PaaD subunit
 
Saccharopolyspora erythraea NRRL 2338

Gene: SACE_3547: Phenylacetate-CoA oxygenase, PaaD subunit
 
Streptomyces avermitilis MA-4680

Gene: SAV_4351: Phenylacetate-CoA oxygenase, PaaD subunit
 
Streptomyces coelicolor A3(2)

Gene: SCO7474: Phenylacetate-CoA oxygenase, PaaD subunit
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_3738: Phenylacetate-CoA oxygenase, PaaD subunit
Phenylacetate-CoA oxygenase, PaaD subunit
paaE
 
Acidothermus cellulolyticus 11B

Gene: Acel_1439: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Arthrobacter chlorophenolicus A6

Gene: Achl_2960: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Arthrobacter sp. FB24

Gene: Arth_3214: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Brevibacterium linens BL2

Gene: BlinB01000726: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Corynebacterium efficiens YS-314

Gene: CE0671: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Kocuria rhizophila DC2201

Gene: KRH_02110: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_0910: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Nakamurella multipartita DSM 44233

Gene: Namu_2487: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Nocardia farcinica IFM 10152

Gene: nfa21650: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Rhodococcus erythropolis PR4

Gene: RER_55460: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Rhodococcus opacus B4

Gene: ROP_25780: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Rhodococcus sp. RHA1

Gene: RHA1_ro02855: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Saccharomonospora viridis DSM 43017

Gene: Svir_26490: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Saccharopolyspora erythraea NRRL 2338

Gene: SACE_3548: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Streptomyces avermitilis MA-4680

Gene: SAV_4350: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Streptomyces coelicolor A3(2)

Gene: SCO7475: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_3737: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
paaK
 
Acidothermus cellulolyticus 11B
 
Arthrobacter chlorophenolicus A6

Gene: Achl_3048: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Arthrobacter sp. FB24

Gene: Arth_3247: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Brevibacterium linens BL2

Gene: BlinB01000720: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
*
Corynebacterium efficiens YS-314

Site:
position = -176
score = 5.43404
sequence = ACTTACCGACTGGTCAGTTGGT

Gene: CE0663: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Kocuria rhizophila DC2201

Gene: KRH_02170: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_0911: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Nakamurella multipartita DSM 44233
 
Nocardia farcinica IFM 10152

Gene: nfa21660: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Rhodococcus erythropolis PR4

Gene: RER_55450: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Rhodococcus opacus B4

Gene: ROP_25770: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Rhodococcus sp. RHA1

Gene: RHA1_ro02854: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Saccharomonospora viridis DSM 43017

Gene: Svir_26570: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
*
Saccharopolyspora erythraea NRRL 2338

Site:
position = -232
score = 5.18149
sequence = TTTTACCGACCGTTCGTTCGGT

Site:
position = -94
score = 5.48238
sequence = AATAACCGACTACTCGGTCAGT

Gene: SACE_3542: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
*
Streptomyces avermitilis MA-4680

Site:
position = -56
score = 4.6858
sequence = GGCTACCGAATGATCGGTCGCC

Gene: SAV_1257: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Streptomyces coelicolor A3(2)

Gene: SCO7469: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -77
score = 4.96859
sequence = ATCGACCGAATGATCGGTCGCC

Gene: SGR_6814: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
paaZ
*
Acidothermus cellulolyticus 11B

Site:
position = -177
score = 4.86841
sequence = GCCGACCGAACGTTCGGTCTAG

Gene: Acel_1435: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Arthrobacter chlorophenolicus A6

Site:
position = -82
score = 6.04604
sequence = TATTACCGAACGGACGGTCAGT

Gene: Achl_3053: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Arthrobacter sp. FB24

Site:
position = -72
score = 6.04604
sequence = TATTACCGAACGGACGGTCAGT

Gene: Arth_3255: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Brevibacterium linens BL2

Site:
position = -101
score = 5.88031
sequence = AATAACCGACCGATTGGTTAGT

Gene: BlinB01000711: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Corynebacterium efficiens YS-314

Site:
position = -121
score = 5.78983
sequence = ACTGACCGGCCGTTCGGTAACT

Gene: CE0677: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Kocuria rhizophila DC2201

Site:
position = -48
score = 4.80935
sequence = ACTGACCGATCGTTCGGCTAAC

Gene: KRH_02200: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Mycobacterium abscessus ATCC 19977

Site:
position = -35
score = 5.43532
sequence = ACCGAACGAATGGACGGTTGGT

Gene: MAB_0900c: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
 
Nakamurella multipartita DSM 44233

Gene: Namu_2485: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Nocardia farcinica IFM 10152

Site:
position = -36
score = 5.09163
sequence = AATTACCGACCGAATGTTCAGT

Gene: nfa21550: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Rhodococcus erythropolis PR4

Site:
position = -32
score = 5.42981
sequence = ACCGACCGAACGTACGGTGAGA

Gene: RER_55550: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Rhodococcus opacus B4

Site:
position = -127
score = 5.56083
sequence = AATAACCGAATCTTCGGTCGGT

Site:
position = -32
score = 5.11525
sequence = ACCGACCGAACGTACGGTGAAA

Gene: ROP_25870: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Rhodococcus sp. RHA1

Site:
position = -32
score = 5.11525
sequence = ACCGACCGAACGTACGGTGAAA

Site:
position = -128
score = 5.56083
sequence = AATAACCGAATCTTCGGTCGGT

Gene: RHA1_ro02864: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Saccharomonospora viridis DSM 43017

Site:
position = -39
score = 5.74156
sequence = ACTTCCTGAACGTTCGGTTGGT

Gene: Svir_26540: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Saccharopolyspora erythraea NRRL 2338

Site:
position = -186
score = 5.62814
sequence = ACTGACCGAGTAGTCGGTTATT

Site:
position = -52
score = 5.83397
sequence = CGTTACCGAACGAACGGTCGGT

Gene: SACE_3543: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Streptomyces avermitilis MA-4680

Site:
position = -96
score = 5.16879
sequence = CCCGACCGATCGTTCGGTTACT

Gene: SAV_4358: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Streptomyces coelicolor A3(2)

Site:
position = -106
score = 5.16879
sequence = CCCGACCGATCGTTCGGTTACT

Gene: SCO3835: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -72
score = 5.16879
sequence = CCCGACCGATCGTTCGGTTACT

Gene: SGR_3745: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
paaT
 
Acidothermus cellulolyticus 11B
*
Arthrobacter chlorophenolicus A6

Site:
position = -73
score = 5.28592
sequence = ACCAACTGACCGTTCTGTCGGT

Gene: Achl_2302: Predicted phylacetic acid transporter PaaT
*
Arthrobacter sp. FB24

Site:
position = -87
score = 5.52782
sequence = ACTGACCGTTCGATCGGTAATT

Gene: Arth_2568: Predicted phylacetic acid transporter PaaT
*
Brevibacterium linens BL2

Site:
position = -191
score = 5.28281
sequence = ACTAACCAATCGGTCGGTTATT

Gene: BlinB01000710: Predicted phylacetic acid transporter PaaT
 
Corynebacterium efficiens YS-314

Gene: CE0662: Predicted phylacetic acid transporter PaaT
*
Kocuria rhizophila DC2201

Site:
position = -85
score = 4.76001
sequence = ACGTCAAGACCAATCGGTCGGT

Gene: KRH_02310: Predicted phylacetic acid transporter PaaT
 
Mycobacterium abscessus ATCC 19977
 
Nakamurella multipartita DSM 44233
 
Nocardia farcinica IFM 10152
*
Rhodococcus erythropolis PR4

Site:
position = -178
score = 4.60944
sequence = ACCTACCGATCATTCGGTTGCC

Gene: RER_44780: Predicted phylacetic acid transporter PaaT
*
Rhodococcus opacus B4

Site:
position = -122
score = 5.49122
sequence = ACCAACCGAACGTACGGTTATA

Site:
position = -39
score = 5.40443
sequence = CCTGACCGAACAATCGGTCGAG

Gene: ROP_17540: Predicted phylacetic acid transporter PaaT
*
Rhodococcus sp. RHA1

Site:
position = -124
score = 5.49122
sequence = ACCAACCGAACGTACGGTTATA

Site:
position = -40
score = 4.80433
sequence = CCTGACCGAACAGTCGTTCGCA

Gene: RHA1_ro02082: Predicted phylacetic acid transporter PaaT
 
Saccharomonospora viridis DSM 43017

Gene: Svir_18260: Predicted phylacetic acid transporter PaaT
 
Saccharopolyspora erythraea NRRL 2338
 
Streptomyces avermitilis MA-4680
 
Streptomyces coelicolor A3(2)
 
Streptomyces griseus subsp. griseus NBRC 13350
Predicted phylacetic acid transporter PaaT
ethD
 
Acidothermus cellulolyticus 11B
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
 
Brevibacterium linens BL2
 
Corynebacterium efficiens YS-314
 
Kocuria rhizophila DC2201
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_0899c: Possible ethyl tert-butyl ether degradation protein EthD
 
Nakamurella multipartita DSM 44233
 
Nocardia farcinica IFM 10152

Gene: nfa21540: Possible ethyl tert-butyl ether degradation protein EthD
 
Rhodococcus erythropolis PR4

Gene: RER_55560: Possible ethyl tert-butyl ether degradation protein EthD
 
Rhodococcus opacus B4

Gene: ROP_25880: Possible ethyl tert-butyl ether degradation protein EthD
 
Rhodococcus sp. RHA1

Gene: RHA1_ro02865: Possible ethyl tert-butyl ether degradation protein EthD
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
 
Streptomyces avermitilis MA-4680
 
Streptomyces coelicolor A3(2)
 
Streptomyces griseus subsp. griseus NBRC 13350
Possible ethyl tert-butyl ether degradation protein EthD
paaI
 
Acidothermus cellulolyticus 11B

Gene: Acel_1660: Phenylacetic acid degradation protein PaaI, thioesterase
*
Arthrobacter chlorophenolicus A6

Site:
position = -42
score = 5.25667
sequence = ACCTAATGAACATTCGGTAAAT

Gene: Achl_3047: Phenylacetic acid degradation protein PaaI, thioesterase
*
Arthrobacter sp. FB24

Site:
position = -42
score = 5.25667
sequence = ACCTAATGAACATTCGGTAAAT

Gene: Arth_3246: Phenylacetic acid degradation protein PaaI, thioesterase
 
Brevibacterium linens BL2

Gene: BlinB01000721: Phenylacetic acid degradation protein PaaI, thioesterase
*
Corynebacterium efficiens YS-314

Site:
position = -58
score = 5.09696
sequence = TACTACCGTCCATTCGGTAAGT

Gene: CE0666: Phenylacetic acid degradation protein PaaI, thioesterase
*
Kocuria rhizophila DC2201

Site:
position = -38
score = 4.65102
sequence = ACTGACCGATCGTTCTGAAAAT

Site:
position = -181
score = 4.79563
sequence = AATAACTGACCGCTCGTTCAGA

Gene: KRH_02160: Phenylacetic acid degradation protein PaaI, thioesterase
 
Mycobacterium abscessus ATCC 19977
 
Nakamurella multipartita DSM 44233

Gene: Namu_2481: Phenylacetic acid degradation protein PaaI, thioesterase
 
Nocardia farcinica IFM 10152

Gene: nfa21530: Phenylacetic acid degradation protein PaaI, thioesterase
 
Rhodococcus erythropolis PR4

Gene: RER_55570: Phenylacetic acid degradation protein PaaI, thioesterase
 
Rhodococcus opacus B4

Gene: ROP_25890: Phenylacetic acid degradation protein PaaI, thioesterase
 
Rhodococcus sp. RHA1

Gene: RHA1_ro02866: Phenylacetic acid degradation protein PaaI, thioesterase
*
Saccharomonospora viridis DSM 43017

Site:
position = -42
score = 5.73763
sequence = AGTAACCGTCCATTCGGTCAGT

Gene: Svir_26560: Phenylacetic acid degradation protein PaaI, thioesterase
 
Saccharopolyspora erythraea NRRL 2338
 
Streptomyces avermitilis MA-4680
*
Streptomyces coelicolor A3(2)

Site:
position = -152
score = 5.01265
sequence = CCCAACCGACCATTCGTTCGGT

Site:
position = -29
score = 5.54906
sequence = GCTAACCGAATGGTCGGTCGGG

Gene: SCO7470: Phenylacetic acid degradation protein PaaI, thioesterase
 
Streptomyces griseus subsp. griseus NBRC 13350
Phenylacetic acid degradation protein PaaI, thioesterase
paaR
 
Acidothermus cellulolyticus 11B

Gene: Acel_1436: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Arthrobacter chlorophenolicus A6

Gene: Achl_3049: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Arthrobacter sp. FB24

Gene: Arth_3248: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Brevibacterium linens BL2

Gene: BlinB01000719: Transcriptional regulator of phenylacetic acid degradation, TetR family
*
Corynebacterium efficiens YS-314

Site:
position = -599
score = 5.61864
sequence = ACTAACCGACCGCCCGGTCAGT

Gene: CE0665: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Kocuria rhizophila DC2201

Gene: KRH_02180: Transcriptional regulator of phenylacetic acid degradation, TetR family
*
Mycobacterium abscessus ATCC 19977

Site:
position = -92
score = 5.87975
sequence = AATAACCGATCGTTCGGTCGGT

Gene: MAB_0901c: Transcriptional regulator of phenylacetic acid degradation, TetR family
*
Nakamurella multipartita DSM 44233

Site:
position = -43
score = 6.14096
sequence = ACTGACCGAATGATCGGTCAGC

Gene: Namu_2483: Transcriptional regulator of phenylacetic acid degradation, TetR family
*
Nocardia farcinica IFM 10152

Site:
position = -81
score = 6.05123
sequence = TATTACCGAACATTCGGTCAGT

Gene: nfa21560: Transcriptional regulator of phenylacetic acid degradation, TetR family
*
Rhodococcus erythropolis PR4

Site:
position = -80
score = 5.91754
sequence = AATAACCGAACATTCGGTCGTT

Gene: RER_55540: Transcriptional regulator of phenylacetic acid degradation, TetR family
*
Rhodococcus opacus B4

Site:
position = -80
score = 4.63114
sequence = CTGAACCGAACCTTCGGTCGGC

Gene: ROP_23860: Transcriptional regulator of phenylacetic acid degradation, TetR family
*
Rhodococcus sp. RHA1

Site:
position = -80
score = 4.73987
sequence = TTCAACCGAACCTTCGGTCGGC

Gene: RHA1_ro02633: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Saccharomonospora viridis DSM 43017

Gene: Svir_26580: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Saccharopolyspora erythraea NRRL 2338

Gene: SACE_3541: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Streptomyces avermitilis MA-4680

Gene: SAV_4360: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Streptomyces coelicolor A3(2)

Gene: SCO3833: Transcriptional regulator of phenylacetic acid degradation, TetR family
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -106
score = 6.04741
sequence = AGTAACCGAACGATCGGTCGGG

Gene: SGR_3746: Transcriptional regulator of phenylacetic acid degradation, TetR family
Transcriptional regulator of phenylacetic acid degradation, TetR family
paaY
 
Acidothermus cellulolyticus 11B
*
Arthrobacter chlorophenolicus A6

Site:
position = -66
score = 5.5101
sequence = ACTGACCGTCCGTTCGGTAATA

Gene: Achl_3054: thioesterase superfamily protein
*
Arthrobacter sp. FB24

Site:
position = -128
score = 5.5101
sequence = ACTGACCGTCCGTTCGGTAATA

Gene: Arth_3256: thioesterase superfamily protein
 
Brevibacterium linens BL2
*
Corynebacterium efficiens YS-314

Site:
position = -47
score = 6.01934
sequence = AGTTACCGAACGGCCGGTCAGT

Gene: CE0676: thioesterase superfamily protein
*
Kocuria rhizophila DC2201

Site:
position = -268
score = 5.46504
sequence = GTTAGCCGAACGATCGGTCAGT

Gene: KRH_02210: thioesterase superfamily protein
 
Mycobacterium abscessus ATCC 19977
 
Nakamurella multipartita DSM 44233
 
Nocardia farcinica IFM 10152
 
Rhodococcus erythropolis PR4
 
Rhodococcus opacus B4
 
Rhodococcus sp. RHA1
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
 
Streptomyces avermitilis MA-4680
 
Streptomyces coelicolor A3(2)
 
Streptomyces griseus subsp. griseus NBRC 13350
thioesterase superfamily protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD