Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PaaR - Corynebacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Corynebacterium amycolatum SK46
Corynebacterium aurimucosum ATCC 700975
Corynebacterium diphtheriae NCTC 13129
Corynebacterium efficiens YS-314 18 7
Corynebacterium glutamicum ATCC 13032
Corynebacterium jeikeium K411
Corynebacterium kroppenstedtii DSM 44385
Corynebacterium urealyticum DSM 7109
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
paaA
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
*
Corynebacterium efficiens YS-314

Site:
position = -128
score = 6.3943
sequence = ACTGACCGGGCGGTCGGTTAGT

Site:
position = -132
score = 4.56481
sequence = ATATACTGACCGGGCGGTCGGT

Gene: CE0667: Phenylacetate-CoA oxygenase, PaaA subunit
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Phenylacetate-CoA oxygenase, PaaA subunit
paaB
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE0668: Phenylacetate-CoA oxygenase, PaaB subunit
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Phenylacetate-CoA oxygenase, PaaB subunit
paaC
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE0669: Phenylacetate-CoA oxygenase, PaaC subunit
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Phenylacetate-CoA oxygenase, PaaC subunit
paaD
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE0670: Phenylacetate-CoA oxygenase, PaaD subunit
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Phenylacetate-CoA oxygenase, PaaD subunit
paaE
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE0671: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
paaG
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE0672: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Enoyl-CoA hydratase (EC 4.2.1.17)
paaJ
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE0673: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
paaF
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE0674: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Enoyl-CoA hydratase (EC 4.2.1.17)
paaH
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE0675: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
CRON 2.
paaK
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
*
Corynebacterium efficiens YS-314

Site:
position = -180
score = 4.9823
sequence = ACCAACTTACCGACTGGTCAGT

Site:
position = -176
score = 5.13171
sequence = ACTTACCGACTGGTCAGTTGGT

Site:
position = -172
score = 4.57525
sequence = ACCGACTGGTCAGTTGGTAAAT

Gene: CE0663: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
paaT
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE0662: predicted phylacetic acid transporter
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
predicted phylacetic acid transporter
 
CRON 3.
paaI
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
*
Corynebacterium efficiens YS-314

Site:
position = -58
score = 5.35932
sequence = TACTACCGTCCATTCGGTAAGT

Gene: CE0666: Phenylacetic acid degradation protein PaaI, thioesterase
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Phenylacetic acid degradation protein PaaI, thioesterase
 
CRON 4.
paaZ
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
*
Corynebacterium efficiens YS-314

Site:
position = -121
score = 5.96546
sequence = ACTGACCGGCCGTTCGGTAACT

Site:
position = -125
score = 5.08965
sequence = AATTACTGACCGGCCGTTCGGT

Gene: CE0677: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
 
CRON 5.
paaY
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
*
Corynebacterium efficiens YS-314

Site:
position = -47
score = 6.58933
sequence = AGTTACCGAACGGCCGGTCAGT

Site:
position = -43
score = 5.15048
sequence = ACCGAACGGCCGGTCAGTAATT

Gene: CE0676: hypothetical protein
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
hypothetical protein
 
CRON 6.
hisE
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_0989: Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_1253: Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP1257: Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
*
Corynebacterium efficiens YS-314

Site:
position = -23
score = 6.01175
sequence = AACAACCGCACGATCGGTATGT

Gene: CE1635: Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Corynebacterium glutamicum ATCC 13032

Gene: cg1699: Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385

Gene: ckrop_0917: Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Corynebacterium urealyticum DSM 7109

Gene: cur_1034: Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
hisG
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_0990: ATP phosphoribosyltransferase (EC 2.4.2.17)
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_1254: ATP phosphoribosyltransferase (EC 2.4.2.17)
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP1256: ATP phosphoribosyltransferase (EC 2.4.2.17)
 
Corynebacterium efficiens YS-314

Gene: CE1634: ATP phosphoribosyltransferase (EC 2.4.2.17)
 
Corynebacterium glutamicum ATCC 13032

Gene: cg1698: ATP phosphoribosyltransferase (EC 2.4.2.17)
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385

Gene: ckrop_0916: ATP phosphoribosyltransferase (EC 2.4.2.17)
 
Corynebacterium urealyticum DSM 7109

Gene: cur_1035: ATP phosphoribosyltransferase (EC 2.4.2.17)
ATP phosphoribosyltransferase (EC 2.4.2.17)
aspA
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_0991: Aspartate ammonia-lyase (EC 4.3.1.1)
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_1255: Aspartate ammonia-lyase (EC 4.3.1.1)
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP1254: Aspartate ammonia-lyase (EC 4.3.1.1)
 
Corynebacterium efficiens YS-314

Gene: CE1633: Aspartate ammonia-lyase (EC 4.3.1.1)
 
Corynebacterium glutamicum ATCC 13032

Gene: cg1697: Aspartate ammonia-lyase (EC 4.3.1.1)
 
Corynebacterium jeikeium K411

Gene: jk0951: Aspartate ammonia-lyase (EC 4.3.1.1)
 
Corynebacterium kroppenstedtii DSM 44385

Gene: ckrop_1567: Aspartate ammonia-lyase (EC 4.3.1.1)
 
Corynebacterium urealyticum DSM 7109

Gene: cur_1036: Aspartate ammonia-lyase (EC 4.3.1.1)
Aspartate ammonia-lyase (EC 4.3.1.1)
 
CRON 7.
paaR
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
*
Corynebacterium efficiens YS-314

Site:
position = 38
score = 4.67642
sequence = ACTTACCGAATGGACGGTAGTA

Site:
position = -595
score = 5.17828
sequence = ACCGACCGCCCGGTCAGTATAT

Site:
position = -599
score = 6.20474
sequence = ACTAACCGACCGCCCGGTCAGT

Gene: CE0665: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Transcriptional regulator of phenylacetic acid degradation, TetR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD