Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Cg1831 - Corynebacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Corynebacterium amycolatum SK46
Corynebacterium aurimucosum ATCC 700975
Corynebacterium diphtheriae NCTC 13129
Corynebacterium efficiens YS-314 4 2
Corynebacterium glutamicum ATCC 13032 4 2
Corynebacterium jeikeium K411
Corynebacterium kroppenstedtii DSM 44385
Corynebacterium urealyticum DSM 7109
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
cg1832
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
*
Corynebacterium efficiens YS-314

Site:
position = -34
score = 5.94376
sequence = AGTCAAACGGGTGATTGAGT

Gene: CE2677: Predicted Fe-siderophore ABC transporter, permease protein
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -34
score = 6.52683
sequence = AGTCAAATGATCATTTGAGT

Gene: cg1832: Predicted Fe-siderophore ABC transporter, permease protein
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Predicted Fe-siderophore ABC transporter, permease protein
cg1833
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE2676: Predicted Fe-siderophore ABC transporter, substrate-binding protein
 
Corynebacterium glutamicum ATCC 13032

Gene: cg1833: Predicted Fe-siderophore ABC transporter, substrate-binding protein
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Predicted Fe-siderophore ABC transporter, substrate-binding protein
cg1834
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE2675: Predicted Fe-siderophore ABC transporter, ATP-binding protein
 
Corynebacterium glutamicum ATCC 13032

Gene: cg1834: Predicted Fe-siderophore ABC transporter, ATP-binding protein
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Predicted Fe-siderophore ABC transporter, ATP-binding protein
 
CRON 2.
cg1831
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
*
Corynebacterium efficiens YS-314

Site:
position = 8
score = 5.94376
sequence = ACTCAATCACCCGTTTGACT

Gene: CE2678: Predicted Fe-siderophore transport transcriptional regulator, MerR family
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -40
score = 6.52683
sequence = ACTCAAATGATCATTTGACT

Gene: cg1831: Predicted Fe-siderophore transport transcriptional regulator, MerR family
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Predicted Fe-siderophore transport transcriptional regulator, MerR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD