Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MntR - Lactobacillaceae

Properties
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactobacillus acidophilus NCFM
Lactobacillus brevis ATCC 367 2 2
Lactobacillus casei ATCC 334 4 2
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Lactobacillus fermentum IFO 3956 1 1
Lactobacillus helveticus DPC 4571
Lactobacillus johnsonii NCC 533
Lactobacillus plantarum WCFS1 4 2
Lactobacillus reuteri JCM 1112 1 1
Lactobacillus rhamnosus GG 4 2
Lactobacillus sakei subsp. sakei 23K 5 3
Lactobacillus salivarius subsp. salivarius UCC118 1 1
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
Oenococcus oeni PSU-1
Pediococcus pentosaceus ATCC 25745
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
mntH
 
Lactobacillus acidophilus NCFM
*2
Lactobacillus brevis ATCC 367

Site:
position = -19
score = 4.9567
sequence = AAGGAAGGGAGTCTTAAAAT

Gene: LVIS_0225: Manganese transport protein MntH

Site:
position = -213
score = 4.34354
sequence = ATTTTTGGTAAGCCAAAAAT

Gene: LVIS_0331: Manganese transport protein MntH
*
Lactobacillus casei ATCC 334

Site:
position = -71
score = 6.35621
sequence = AAGTTAGGGAGACCTAAAAG

Gene: LSEI_2413: Manganese transport protein MntH
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
*
Lactobacillus fermentum IFO 3956

Site:
position = -91
score = 4.82986
sequence = TTTTTATGCTAACCTAACAA

Gene: LAF_1828: Manganese transport protein MntH
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533

Gene: LJ1144: Manganese transport protein MntH
*
Lactobacillus plantarum WCFS1

Site:
position = -98
score = 5.29665
sequence = TTTGTAGGCATACCTAAAAA

Gene: lp_2992: Manganese transport protein MntH
*
Lactobacillus reuteri JCM 1112

Site:
position = -89
score = 4.82387
sequence = TTTTTATGTTACCCTAACAA

Gene: LAR_1743: Manganese transport protein MntH
*
Lactobacillus rhamnosus GG

Site:
position = -72
score = 6.35621
sequence = AAGTTAGGGAGACCTAAAAG

Gene: LGG_02411: Manganese transport protein MntH
*2
Lactobacillus sakei subsp. sakei 23K

Site:
position = 7
score = 5.53341
sequence = AAGTTAAGGGACCCAAAAAG

Gene: LSA0246: Manganese transport protein MntH

Site:
position = -77
score = 5.83553
sequence = AAGTTAGGGCATCCTAAAAT

Gene: LSA1699: Manganese transport protein MntH
*
Lactobacillus salivarius subsp. salivarius UCC118

Site:
position = -87
score = 5.21946
sequence = AGTTAAGGTAGACCTAAAAA

Gene: LSL_0904: Manganese transport protein MntH
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 2
Oenococcus oeni PSU-1

Gene: OEOE_1795: Manganese transport protein MntH

Gene: OEOE_0246: Manganese transport protein MntH
 2
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0045: Manganese transport protein MntH

Gene: PEPE_1701: Manganese transport protein MntH
Manganese transport protein MntH
 
CRON 2.
mntC
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
*
Lactobacillus casei ATCC 334

Site:
position = -32
score = 5.74106
sequence = GAATTAGGTCACCCTAAAAA

Gene: LSEI_2423: Manganese ABC transporter, permease protein
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
*
Lactobacillus plantarum WCFS1

Site:
position = -82
score = 5.19094
sequence = AAGTTAACTGCACCTAACAA

Gene: lp_1095: Manganese ABC transporter, permease protein
 
Lactobacillus reuteri JCM 1112
*
Lactobacillus rhamnosus GG

Site:
position = -31
score = 5.62302
sequence = GAATTAGGTCACCCTAAAAT

Gene: LGG_02421: Manganese ABC transporter, permease protein
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = -34
score = 6.28858
sequence = AAGTTAGGTATACCTAAAAG

Gene: LSA0180: Manganese ABC transporter, permease protein
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0951: Manganese ABC transporter, permease protein
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Manganese ABC transporter, permease protein
mntB
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_2422: Manganese ABC transporter, ATP-binding protein
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_1096: Manganese ABC transporter, ATP-binding protein
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG

Gene: LGG_02420: Manganese ABC transporter, ATP-binding protein
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA0181: Manganese ABC transporter, ATP-binding protein
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0952: Manganese ABC transporter, ATP-binding protein
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Manganese ABC transporter, ATP-binding protein
mntA
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_2421: Manganese ABC transporter, substrate-binding protein
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_1097: Manganese ABC transporter, substrate-binding protein
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG

Gene: LGG_02419: Manganese ABC transporter, substrate-binding protein
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA0182: Manganese ABC transporter, substrate-binding protein
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0953: Manganese ABC transporter, substrate-binding protein
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Manganese ABC transporter, substrate-binding protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD