Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CitB - Corynebacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: CitB
Regulation mode: activator
Biological process: Citrate utilization
Effector: Citrate
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Corynebacterium amycolatum SK46
Corynebacterium aurimucosum ATCC 700975
Corynebacterium diphtheriae NCTC 13129
Corynebacterium efficiens YS-314 3 2
Corynebacterium glutamicum ATCC 13032 6 3
Corynebacterium jeikeium K411
Corynebacterium kroppenstedtii DSM 44385
Corynebacterium urealyticum DSM 7109
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
citH
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
*
Corynebacterium efficiens YS-314

Site:
position = -35
score = 6.00283
sequence = GAACTAAATGCACTTAATTC

Gene: CE2906: Citrate transporter
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -148
score = 5.70863
sequence = GATCATAATGCACAAAAGTC

Gene: cg0088: Citrate transporter
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Citrate transporter
 
CRON 2.
citA
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
*
Corynebacterium efficiens YS-314

Site:
position = -81
score = 5.7749
sequence = GAATTAAGTGCATTTAGTTC

Gene: CE2905: Citrate transport regulation two-component system histidine kinase
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -80
score = 5.24241
sequence = GACTTTTGTGCATTATGATC

Gene: cg0089: Citrate transport regulation two-component system histidine kinase
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Citrate transport regulation two-component system histidine kinase
citB
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE2904: Citrate transport regulation two-component system response regulator, LuxR family
 
Corynebacterium glutamicum ATCC 13032

Gene: cg0090: Citrate transport regulation two-component system response regulator, LuxR family
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Citrate transport regulation two-component system response regulator, LuxR family
 
CRON 3.
tctC
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -43
score = 5.14334
sequence = GAGCTTGTTGTCCAAAAGTC

Gene: cg3127: Citrate TTT family transporter, subunit C
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Citrate TTT family transporter, subunit C
tctB
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032

Gene: cg3126: Citrate TTT family transporter, subunit B
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Citrate TTT family transporter, subunit B
tctA
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032

Gene: cg3125: Citrate TTT family transporter, subunit A
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Citrate TTT family transporter, subunit A
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD