Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ArsR - Corynebacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector: Arsenite; Arsenate
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 22 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Corynebacterium amycolatum SK46
Corynebacterium aurimucosum ATCC 700975 2 2
Corynebacterium diphtheriae NCTC 13129
Corynebacterium efficiens YS-314 2 2
Corynebacterium glutamicum ATCC 13032 6 4
Corynebacterium jeikeium K411 3 2
Corynebacterium kroppenstedtii DSM 44385
Corynebacterium urealyticum DSM 7109 3 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
arsR
 
Corynebacterium amycolatum SK46
*
Corynebacterium aurimucosum ATCC 700975

Site:
position = -56
score = 6.10919
sequence = GTATTGATGCGCGTCAATAT

Gene: cauri_1870: Arsenic resistance transcriptional regulator ArsR, ArsR family
 
Corynebacterium diphtheriae NCTC 13129
*
Corynebacterium efficiens YS-314

Site:
position = 30
score = 5.88927
sequence = GTATTGATTGTTATCAATAT

Site:
position = 64
score = 6.41818
sequence = ATATTGATGACTGTCAATAT

Gene: CE0874: Arsenic resistance transcriptional regulator ArsR, ArsR family
*2
Corynebacterium glutamicum ATCC 13032

Site:
position = -65
score = 5.64829
sequence = ATATTGATGTTTGCCGATAT

Site:
position = -32
score = 5.80434
sequence = ATATCGATGTGCGTCTATAT

Gene: cg0317: Arsenic resistance transcriptional regulator ArsR, ArsR family

Site:
position = -65
score = 6.17272
sequence = ATATTGATACCTGTCGATAT

Site:
position = -31
score = 6.08436
sequence = ATATCGACATTCGTCAATAT

Gene: cg1704: Arsenic resistance transcriptional regulator ArsR, ArsR family
*
Corynebacterium jeikeium K411

Site:
position = -59
score = 6.38994
sequence = ATATTGATGCCTGTCAATAT

Site:
position = -32
score = 6.30361
sequence = ATATTGATATCTGTCAATAT

Gene: jk2006: Arsenic resistance transcriptional regulator ArsR, ArsR family
 
Corynebacterium kroppenstedtii DSM 44385
*
Corynebacterium urealyticum DSM 7109

Site:
position = -66
score = 6.04351
sequence = ATATTGATGGTCATCGATAC

Site:
position = -32
score = 6.13687
sequence = ATATAGATGACCGTCAATAT

Gene: cur_0030: Arsenic resistance transcriptional regulator ArsR, ArsR family
Arsenic resistance transcriptional regulator ArsR, ArsR family
 
CRON 2.
arsB
 
Corynebacterium amycolatum SK46
*
Corynebacterium aurimucosum ATCC 700975

Site:
position = -77
score = 6.10919
sequence = ATATTGACGCGCATCAATAC

Gene: cauri_1869: Arsenite efflux membrane protein
 
Corynebacterium diphtheriae NCTC 13129
*
Corynebacterium efficiens YS-314

Site:
position = -36
score = 5.88927
sequence = ATATTGATAACAATCAATAC

Site:
position = -70
score = 6.41818
sequence = ATATTGACAGTCATCAATAT

Gene: CE0875: Arsenite efflux membrane protein
*2
Corynebacterium glutamicum ATCC 13032

Site:
position = -69
score = 6.08436
sequence = ATATTGACGAATGTCGATAT

Site:
position = -35
score = 6.17272
sequence = ATATCGACAGGTATCAATAT

Gene: cg1705: Arsenite efflux membrane protein

Site:
position = -69
score = 5.80434
sequence = ATATAGACGCACATCGATAT

Site:
position = -36
score = 5.64829
sequence = ATATCGGCAAACATCAATAT

Gene: cg0318: Arsenite efflux membrane protein
*
Corynebacterium jeikeium K411

Site:
position = -94
score = 6.30361
sequence = ATATTGACAGATATCAATAT

Site:
position = -67
score = 6.38994
sequence = ATATTGACAGGCATCAATAT

Gene: jk2005: Arsenite efflux membrane protein
 
Corynebacterium kroppenstedtii DSM 44385
*
Corynebacterium urealyticum DSM 7109

Site:
position = -68
score = 6.13687
sequence = ATATTGACGGTCATCTATAT

Site:
position = -34
score = 6.04351
sequence = GTATCGATGACCATCAATAT

Gene: cur_0031: Arsenite efflux membrane protein
Arsenite efflux membrane protein
arsC
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_1082: Arsenate reductase (EC 1.20.4.1)
 
Corynebacterium diphtheriae NCTC 13129
 2
Corynebacterium efficiens YS-314

Gene: CE0876: Arsenate reductase (EC 1.20.4.1)

Gene: CE0877: Arsenate reductase (EC 1.20.4.1)
 2
Corynebacterium glutamicum ATCC 13032

Gene: cg0319: Arsenate reductase (EC 1.20.4.1)

Gene: cg1706: Arsenate reductase (EC 1.20.4.1)
 
Corynebacterium jeikeium K411

Gene: jk2004: Arsenate reductase (EC 1.20.4.1)
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109

Gene: cur_0032: Arsenate reductase (EC 1.20.4.1)
Arsenate reductase (EC 1.20.4.1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD