Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Corynebacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 25 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Corynebacterium amycolatum SK46 3 2
Corynebacterium aurimucosum ATCC 700975 3 2
Corynebacterium diphtheriae NCTC 13129 3 2
Corynebacterium efficiens YS-314 3 2
Corynebacterium glutamicum ATCC 13032 5 2
Corynebacterium jeikeium K411 3 2
Corynebacterium kroppenstedtii DSM 44385 3 2
Corynebacterium urealyticum DSM 7109 3 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
groL2
*
Corynebacterium amycolatum SK46

Site:
position = -249
score = 6.24379
sequence = CTTGCACTCGATGGGGTTGAGTGCTAG

Site:
position = -213
score = 7.16495
sequence = TTAGCACTTGCTCTAATTGAGTGCTAA

Gene: CORAM0001_1328: Heat shock protein 60 family chaperone GroEL
*
Corynebacterium aurimucosum ATCC 700975

Site:
position = -184
score = 5.09539
sequence = CTTGCAGTCGGTAGGCCTGAGTGCCAG

Site:
position = -149
score = 5.18274
sequence = CTAGCACTTCCACATGGCAAGTGCCAG

Gene: cauri_2263: Heat shock protein 60 family chaperone GroEL
*
Corynebacterium diphtheriae NCTC 13129

Site:
position = -218
score = 6.01726
sequence = CTTGCACTCGTACCCGTAGACTGCTAA

Site:
position = -184
score = 7.07446
sequence = TTAGCACTCGATCTAACCGAGTGCTAA

Gene: DIP2020: Heat shock protein 60 family chaperone GroEL
*
Corynebacterium efficiens YS-314

Site:
position = -182
score = 6.73294
sequence = CTTGCACTCGACATGGGCGAGTGCTAG

Site:
position = -148
score = 5.71586
sequence = TTAGCACTTACCTCGTATGAGTGCCAG

Gene: CE2561: Heat shock protein 60 family chaperone GroEL
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -148
score = 5.16384
sequence = TTAGCACTCAACTAATCAGAGTGCCAA

Site:
position = -183
score = 6.97906
sequence = CTTGCACTCACACCCCTTGAGTGCTAG

Gene: cg3011: Heat shock protein 60 family chaperone GroEL
*
Corynebacterium jeikeium K411

Site:
position = -181
score = 5.03112
sequence = CTTGCAGTCGATGGGGGAGAGTGCTAA

Site:
position = -146
score = 6.01326
sequence = TTAGCACTTGAAGTAAGGGAGTGCCAG

Gene: jk0267: Heat shock protein 60 family chaperone GroEL
*
Corynebacterium kroppenstedtii DSM 44385

Site:
position = -184
score = 5.40198
sequence = CTTGCACTCTAAGCCCGAGACTGCTAA

Gene: ckrop_1667: Heat shock protein 60 family chaperone GroEL
*
Corynebacterium urealyticum DSM 7109

Site:
position = -183
score = 5.21999
sequence = CTTGCACTCAAGGGGTGCGAGTGCTAA

Site:
position = -148
score = 7.00711
sequence = TTAGCACTTGCACTGGTTGAGTGCCAG

Gene: cur_1716: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
 
CRON 2.
groS
*
Corynebacterium amycolatum SK46

Site:
position = -154
score = 5.99809
sequence = TTAGCGCTCACTATGGTTGAGTGTTAG

Site:
position = -131
score = 5.83441
sequence = TTAGCACTTGCAGGGGTAGAGTGCTAA

Gene: CORAM0001_0268: Heat shock protein 60 family co-chaperone GroES
*
Corynebacterium aurimucosum ATCC 700975

Site:
position = -144
score = 5.48247
sequence = CTAGCAGTCGCGAGGGTAGAGTGCTAG

Gene: cauri_0474: Heat shock protein 60 family co-chaperone GroES
*
Corynebacterium diphtheriae NCTC 13129

Site:
position = -124
score = 5.24143
sequence = CTGGCACTCTCAGGGGTAGAGTGCCAG

Gene: DIP0575: Heat shock protein 60 family co-chaperone GroES
*
Corynebacterium efficiens YS-314

Site:
position = -134
score = 5.25035
sequence = TTAGCACCCTTAGCGGTTGAGTGCTGG

Gene: CE0601: Heat shock protein 60 family co-chaperone GroES
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -147
score = 5.86435
sequence = TTAGCACCCTCAACAGTTGAGTGCTGG

Gene: cg0690: Heat shock protein 60 family co-chaperone GroES
*
Corynebacterium jeikeium K411

Site:
position = -145
score = 5.68777
sequence = TTAGCACTTGCGAGGGTAGAGTGCCAG

Gene: jk1729: Heat shock protein 60 family co-chaperone GroES
*
Corynebacterium kroppenstedtii DSM 44385

Site:
position = -129
score = 5.66182
sequence = CTGGCACTCACACGGGTAGAGTGCCAA

Site:
position = -152
score = 5.18438
sequence = TTAGCACTCCCGGTGGTTGAGAGCTGG

Gene: ckrop_1737: Heat shock protein 60 family co-chaperone GroES
*
Corynebacterium urealyticum DSM 7109

Site:
position = -11
score = 5.26595
sequence = TTAGCACTTGGGTGGGTAGAGTGCTAG

Gene: cur_0393: Heat shock protein 60 family co-chaperone GroES
Heat shock protein 60 family co-chaperone GroES
groL1
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_0269: Heat shock protein 60 family chaperone GroEL
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_0475: Heat shock protein 60 family chaperone GroEL
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP0576: Heat shock protein 60 family chaperone GroEL
 
Corynebacterium efficiens YS-314

Gene: CE0602: Heat shock protein 60 family chaperone GroEL
 2
Corynebacterium glutamicum ATCC 13032

Gene: cg0693: Heat shock protein 60 family chaperone GroEL

Gene: cg0691: Heat shock protein 60 family chaperone GroEL
 
Corynebacterium jeikeium K411

Gene: jk1728: Heat shock protein 60 family chaperone GroEL
 
Corynebacterium kroppenstedtii DSM 44385

Gene: ckrop_1736: Heat shock protein 60 family chaperone GroEL
 
Corynebacterium urealyticum DSM 7109

Gene: cur_0394: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
tnp1a
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032

Gene: cg0692: Transposase
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Transposase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD