Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog AmtR - Corynebacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Nitrogen metabolism
Effector: GlnK-AMP, signal transduction protein
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 42 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Corynebacterium amycolatum SK46
Corynebacterium aurimucosum ATCC 700975 1 1
Corynebacterium diphtheriae NCTC 13129 6 3
Corynebacterium efficiens YS-314 29 12
Corynebacterium glutamicum ATCC 13032 35 14
Corynebacterium jeikeium K411
Corynebacterium kroppenstedtii DSM 44385
Corynebacterium urealyticum DSM 7109
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
amtB
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_0757: Ammonium transporter
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_1592: Ammonium transporter
 
Corynebacterium diphtheriae NCTC 13129
*
Corynebacterium efficiens YS-314

Site:
position = -168
score = 5.32366
sequence = GAATTCTATCGACCTATCGAAAGT

Gene: CE1968: Ammonium transporter
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -140
score = 5.03768
sequence = CTATTCTATAGATCTATTGAAATT

Site:
position = -183
score = 5.43365
sequence = ATTACCTGTTAAACTATAGAAAAT

Gene: cg2261: Ammonium transporter
 
Corynebacterium jeikeium K411

Gene: jk1197: Ammonium transporter
 
Corynebacterium kroppenstedtii DSM 44385

Gene: ckrop_1189: Ammonium transporter
 
Corynebacterium urealyticum DSM 7109

Gene: cur_0795: Ammonium transporter
Ammonium transporter
glnK
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_1591: Nitrogen regulatory protein PII
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP1535: Nitrogen regulatory protein PII
 
Corynebacterium efficiens YS-314

Gene: CE1967: Nitrogen regulatory protein PII
 
Corynebacterium glutamicum ATCC 13032

Gene: cg2260: Nitrogen regulatory protein PII
 
Corynebacterium jeikeium K411

Gene: jk1196: Nitrogen regulatory protein PII
 
Corynebacterium kroppenstedtii DSM 44385

Gene: ckrop_1188: Nitrogen regulatory protein PII
 
Corynebacterium urealyticum DSM 7109
Nitrogen regulatory protein PII
glnD
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_1590: [Protein-PII] Uridylyltransferase
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP1534: [Protein-PII] Uridylyltransferase
 
Corynebacterium efficiens YS-314

Gene: CE1966: [Protein-PII] Uridylyltransferase
 
Corynebacterium glutamicum ATCC 13032

Gene: cg2258: [Protein-PII] Uridylyltransferase
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385

Gene: ckrop_1187: [Protein-PII] Uridylyltransferase
 
Corynebacterium urealyticum DSM 7109
[Protein-PII] Uridylyltransferase
 
CRON 2.
cg1296
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE2924: Predicted non-ribosomal peptide synthetase
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -41
score = 5.99485
sequence = ATTTTCTATCAATCTATAGATACT

Gene: cg1296: Predicted non-ribosomal peptide synthetase
 
Corynebacterium jeikeium K411
 2
Corynebacterium kroppenstedtii DSM 44385

Gene: ckrop_0207: Predicted non-ribosomal peptide synthetase

Gene: ckrop_0205: Predicted non-ribosomal peptide synthetase
 
Corynebacterium urealyticum DSM 7109
Predicted non-ribosomal peptide synthetase
 
CRON 3.
cg1295
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -40
score = 6.17596
sequence = AGTATCTATAGATTGATAGAAAAT

Gene: cg1295: Predicted hydrolase/acyltransferase
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Predicted hydrolase/acyltransferase
 
CRON 4.
urtA
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
*
Corynebacterium efficiens YS-314

Site:
position = -39
score = 5.11903
sequence = TAAACCTGTCGATCTATAGAAATC

Site:
position = -65
score = 5.55439
sequence = ATTACCTATAGCTTTATAGAAACA

Gene: CE1000: Urea ABC transporter, substrate-binding protein
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -68
score = 5.06896
sequence = ACTACCTATAGGCTGACAGAAACT

Site:
position = -42
score = 5.50602
sequence = AAAAACTATAGAGCTATAGAAACT

Gene: cg1061: Urea ABC transporter, substrate-binding protein
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Urea ABC transporter, substrate-binding protein
urtB
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE1001: Urea ABC transporter, permease protein 1
 
Corynebacterium glutamicum ATCC 13032

Gene: cg1062: Urea ABC transporter, permease protein 1
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Urea ABC transporter, permease protein 1
urtC
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE1003: Urea ABC transporter, permease protein 2
 
Corynebacterium glutamicum ATCC 13032

Gene: cg1064: Urea ABC transporter, permease protein 2
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Urea ABC transporter, permease protein 2
urtD
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE1004: Urea ABC transporter, ATP-binding protein 1
 
Corynebacterium glutamicum ATCC 13032

Gene: cg1065: Urea ABC transporter, ATP-binding protein 1
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Urea ABC transporter, ATP-binding protein 1
urtE
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE1005: Urea ABC transporter, ATP-binding protein 2
 
Corynebacterium glutamicum ATCC 13032

Gene: cg1066: Urea ABC transporter, ATP-binding protein 2
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Urea ABC transporter, ATP-binding protein 2
 
CRON 5.
gltB
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_1821: Glutamate synthase [NADPH] large chain (EC 1.4.1.13)
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
*
Corynebacterium efficiens YS-314

Site:
position = -107
score = 5.44048
sequence = TTTTCCTATAGGTTGATCGAAAAT

Site:
position = -40
score = 5.11972
sequence = ATTATCGAATGATTAATAGAAACC

Gene: CE0158: Glutamate synthase [NADPH] large chain (EC 1.4.1.13)
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -46
score = 5.45972
sequence = ATTATCGAACGATTGATAGAAACA

Site:
position = -115
score = 5.26205
sequence = TTTTCCTATAGGTTGATCGAAAGT

Gene: cg0229: Glutamate synthase [NADPH] large chain (EC 1.4.1.13)
 
Corynebacterium jeikeium K411

Gene: jk0076: Glutamate synthase [NADPH] large chain (EC 1.4.1.13)
 
Corynebacterium kroppenstedtii DSM 44385

Gene: ckrop_0050: Glutamate synthase [NADPH] large chain (EC 1.4.1.13)
 
Corynebacterium urealyticum DSM 7109
Glutamate synthase [NADPH] large chain (EC 1.4.1.13)
gltD
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_1820: Glutamate synthase [NADPH] small chain (EC 1.4.1.13)
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE0159: Glutamate synthase [NADPH] small chain (EC 1.4.1.13)
 
Corynebacterium glutamicum ATCC 13032

Gene: cg0230: Glutamate synthase [NADPH] small chain (EC 1.4.1.13)
 
Corynebacterium jeikeium K411

Gene: jk0077: Glutamate synthase [NADPH] small chain (EC 1.4.1.13)
 
Corynebacterium kroppenstedtii DSM 44385

Gene: ckrop_0051: Glutamate synthase [NADPH] small chain (EC 1.4.1.13)
 
Corynebacterium urealyticum DSM 7109
Glutamate synthase [NADPH] small chain (EC 1.4.1.13)
 
CRON 6.
hkm
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
*
Corynebacterium efficiens YS-314

Site:
position = -46
score = 5.68381
sequence = ATTTTCGATCAACCTATAGGAAAA

Site:
position = -113
score = 5.08678
sequence = GGTTTCTATTAATCATTCGATAAT

Gene: CE0157: Predicted sensor histidine kinase of two-component system
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -179
score = 5.39009
sequence = TGTTTCTATCAATCGTTCGATAAT

Site:
position = -110
score = 5.52819
sequence = ACTTTCGATCAACCTATAGGAAAA

Gene: cg0228: Predicted sensor histidine kinase of two-component system
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Predicted sensor histidine kinase of two-component system
 
CRON 7.
gluA
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_1423: Glutamate ABC transporter, ATP-binding protein
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_1495: Glutamate ABC transporter, ATP-binding protein
 
Corynebacterium diphtheriae NCTC 13129
*
Corynebacterium efficiens YS-314

Site:
position = -110
score = 4.90032
sequence = TTTACCTATTGAGCTATTGATAAA

Gene: CE1844: Glutamate ABC transporter, ATP-binding protein
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -193
score = 5.23548
sequence = AATATCTATCATGTGATAGGTAAA

Gene: cg2136: Glutamate ABC transporter, ATP-binding protein
 
Corynebacterium jeikeium K411

Gene: jk0654: Glutamate ABC transporter, ATP-binding protein
 
Corynebacterium kroppenstedtii DSM 44385

Gene: ckrop_1106: Glutamate ABC transporter, ATP-binding protein
 
Corynebacterium urealyticum DSM 7109
Glutamate ABC transporter, ATP-binding protein
gluB
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_1424: Glutamate ABC transporter, substrate-binding protein
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_1496: Glutamate ABC transporter, substrate-binding protein
 
Corynebacterium diphtheriae NCTC 13129
 2
Corynebacterium efficiens YS-314

Gene: CE1845: Glutamate ABC transporter, substrate-binding protein

Gene: CE1579: Glutamate ABC transporter, substrate-binding protein
 
Corynebacterium glutamicum ATCC 13032

Gene: cg2137: Glutamate ABC transporter, substrate-binding protein
 
Corynebacterium jeikeium K411

Gene: jk0655: Glutamate ABC transporter, substrate-binding protein
 
Corynebacterium kroppenstedtii DSM 44385

Gene: ckrop_1107: Glutamate ABC transporter, substrate-binding protein
 
Corynebacterium urealyticum DSM 7109
Glutamate ABC transporter, substrate-binding protein
gluC
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_1425: Glutamate ABC transporter, permease protein 1
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_1497: Glutamate ABC transporter, permease protein 1
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE1846: Glutamate ABC transporter, permease protein 1
 
Corynebacterium glutamicum ATCC 13032

Gene: cg2138: Glutamate ABC transporter, permease protein 1
 
Corynebacterium jeikeium K411

Gene: jk0656: Glutamate ABC transporter, permease protein 1
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Glutamate ABC transporter, permease protein 1
gluD
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_1426: Glutamate ABC transporter, permease protein 2
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_1498: Glutamate ABC transporter, permease protein 2
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE1847: Glutamate ABC transporter, permease protein 2
 
Corynebacterium glutamicum ATCC 13032

Gene: cg2139: Glutamate ABC transporter, permease protein 2
 
Corynebacterium jeikeium K411

Gene: jk0657: Glutamate ABC transporter, permease protein 2
 
Corynebacterium kroppenstedtii DSM 44385

Gene: ckrop_1110: Glutamate ABC transporter, permease protein 2
 
Corynebacterium urealyticum DSM 7109
Glutamate ABC transporter, permease protein 2
 
CRON 8.
codA
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE2849: Cytosine deaminase (EC 3.5.4.1)
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -60
score = 4.89894
sequence = AATACCTGTCAAGCAATAGAATAG

Gene: cg0104: Cytosine deaminase (EC 3.5.4.1)
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Cytosine deaminase (EC 3.5.4.1)
 
CRON 9.
crnT
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
*
Corynebacterium efficiens YS-314

Site:
position = -72
score = 5.34262
sequence = TAATTCTATAGATCAATAGAATTA

Site:
position = -27
score = 5.66994
sequence = AGTTTCTATCACTCAATAGAAAAG

Gene: CE2850: Creatinine transporter
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -79
score = 5.71214
sequence = CATTTCTATCAATCTATAGAAAGT

Site:
position = -33
score = 5.9848
sequence = AGTTTCTATAGATTGATAGAAAAG

Gene: cg0103: Creatinine transporter
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Creatinine transporter
 
CRON 10.
gdh
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_1037: NADP-specific glutamate dehydrogenase (EC 1.4.1.4)
*
Corynebacterium aurimucosum ATCC 700975

Site:
position = -86
score = 5.14729
sequence = AATTTAGGTCGATTGATAGAAAAC

Gene: cauri_1607: NADP-specific glutamate dehydrogenase (EC 1.4.1.4)
*
Corynebacterium diphtheriae NCTC 13129

Site:
position = -156
score = 5.33975
sequence = ACTTTCGATAGTTCAATAGGAATT

Gene: DIP1547: NADP-specific glutamate dehydrogenase (EC 1.4.1.4)
*
Corynebacterium efficiens YS-314

Site:
position = -47
score = 4.56043
sequence = TAAAACTATTAACCGTTAGGTATA

Gene: CE1982: NADP-specific glutamate dehydrogenase (EC 1.4.1.4)
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -209
score = 4.02969
sequence = TAAAACTATTAACCGTTAGTATGA

Site:
position = -367
score = 4.89355
sequence = AAAATTGATAAACCTAAAGAAATT

Gene: cg2280: NADP-specific glutamate dehydrogenase (EC 1.4.1.4)
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385

Gene: ckrop_0600: NADP-specific glutamate dehydrogenase (EC 1.4.1.4)
 
Corynebacterium urealyticum DSM 7109

Gene: cur_0800: NADP-specific glutamate dehydrogenase (EC 1.4.1.4)
NADP-specific glutamate dehydrogenase (EC 1.4.1.4)
 
CRON 11.
glnA
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_1470: Glutamine synthetase type I (EC 6.3.1.2)
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_1720: Glutamine synthetase type I (EC 6.3.1.2)
*
Corynebacterium diphtheriae NCTC 13129

Site:
position = -117
score = 5.40303
sequence = TTTTTTGATAGCTCTATAGATAAT

Gene: DIP1644: Glutamine synthetase type I (EC 6.3.1.2)
*2
Corynebacterium efficiens YS-314

Gene: CE2116: Glutamine synthetase type I (EC 6.3.1.2)

Site:
position = -147
score = 5.45141
sequence = AGTTTTGATAGATCGACAGATAAT

Gene: CE2104: Glutamine synthetase type I (EC 6.3.1.2)
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -149
score = 5.2429
sequence = AGTTTTGATAGATCGACAGGTAAT

Gene: cg2429: Glutamine synthetase type I (EC 6.3.1.2)
 
Corynebacterium jeikeium K411

Gene: jk0702: Glutamine synthetase type I (EC 6.3.1.2)
 
Corynebacterium kroppenstedtii DSM 44385

Gene: ckrop_0695: Glutamine synthetase type I (EC 6.3.1.2)
 2
Corynebacterium urealyticum DSM 7109

Gene: cur_1255: Glutamine synthetase type I (EC 6.3.1.2)

Gene: cur_1277: Glutamine synthetase type I (EC 6.3.1.2)
Glutamine synthetase type I (EC 6.3.1.2)
 
CRON 12.
cg2181
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_2002: Predicted ABC transporter, substrate-binding protein
 
Corynebacterium aurimucosum ATCC 700975
*
Corynebacterium diphtheriae NCTC 13129

Site:
position = -162
score = 4.01277
sequence = TAAAACTATTATTTGATAGTTTTA

Gene: DIP0956: Predicted ABC transporter, substrate-binding protein
 
Corynebacterium efficiens YS-314

Gene: CE1884: Predicted ABC transporter, substrate-binding protein
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -218
score = 5.73849
sequence = AATTTCTATCAAACTATAGAAAGA

Gene: cg2181: Predicted ABC transporter, substrate-binding protein
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385

Gene: ckrop_0089: Predicted ABC transporter, substrate-binding protein
 
Corynebacterium urealyticum DSM 7109
Predicted ABC transporter, substrate-binding protein
cg2182
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_2003: Predicted ABC transporter, permease protein 1
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_0214: Predicted ABC transporter, permease protein 1
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP0957: Predicted ABC transporter, permease protein 1
 
Corynebacterium efficiens YS-314

Gene: CE1885: Predicted ABC transporter, permease protein 1
 
Corynebacterium glutamicum ATCC 13032

Gene: cg2182: Predicted ABC transporter, permease protein 1
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385

Gene: ckrop_0090: Predicted ABC transporter, permease protein 1
 
Corynebacterium urealyticum DSM 7109
Predicted ABC transporter, permease protein 1
cg2183
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_2004: Predicted ABC transporter, permease protein 2
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_0213: Predicted ABC transporter, permease protein 2
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP0958: Predicted ABC transporter, permease protein 2
 
Corynebacterium efficiens YS-314

Gene: CE1886: Predicted ABC transporter, permease protein 2
 
Corynebacterium glutamicum ATCC 13032

Gene: cg2183: Predicted ABC transporter, permease protein 2
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385

Gene: ckrop_0091: Predicted ABC transporter, permease protein 2
 
Corynebacterium urealyticum DSM 7109
Predicted ABC transporter, permease protein 2
cg2184
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_2005: Predicted ABC transporter, ATP-binding protein
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_0212: Predicted ABC transporter, ATP-binding protein
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP0959: Predicted ABC transporter, ATP-binding protein
 
Corynebacterium efficiens YS-314

Gene: CE1887: Predicted ABC transporter, ATP-binding protein
 
Corynebacterium glutamicum ATCC 13032

Gene: cg2184: Predicted ABC transporter, ATP-binding protein
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385

Gene: ckrop_0092: Predicted ABC transporter, ATP-binding protein
 
Corynebacterium urealyticum DSM 7109
Predicted ABC transporter, ATP-binding protein
 
CRON 13.
ureA
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
*
Corynebacterium efficiens YS-314

Site:
position = -25
score = 4.73103
sequence = TCTAACTATTGACTTATAGTTATT

Gene: CE0993: Urease, gamma subunit (EC 3.5.1.5)
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -31
score = 4.83986
sequence = AATTTCTGTTACCTGACAGAAAGG

Gene: cg0113: Urease, gamma subunit (EC 3.5.1.5)
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109

Gene: cur_1771: Urease, gamma subunit (EC 3.5.1.5)
Urease, gamma subunit (EC 3.5.1.5)
ureB
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE0994: Urease beta subunit (EC 3.5.1.5)
 
Corynebacterium glutamicum ATCC 13032

Gene: cg0114: Urease beta subunit (EC 3.5.1.5)
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109

Gene: cur_1772: Urease beta subunit (EC 3.5.1.5)
Urease beta subunit (EC 3.5.1.5)
ureC
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE0995: Urease alpha subunit (EC 3.5.1.5)
 
Corynebacterium glutamicum ATCC 13032

Gene: cg0115: Urease alpha subunit (EC 3.5.1.5)
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109

Gene: cur_1773: Urease alpha subunit (EC 3.5.1.5)
Urease alpha subunit (EC 3.5.1.5)
ureE
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE0996: Urease accessory protein UreE
 
Corynebacterium glutamicum ATCC 13032

Gene: cg0116: Urease accessory protein UreE
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109

Gene: cur_1774: Urease accessory protein UreE
Urease accessory protein UreE
ureF
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE0997: Urease accessory protein UreF
 
Corynebacterium glutamicum ATCC 13032

Gene: cg0117: Urease accessory protein UreF
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109

Gene: cur_1775: Urease accessory protein UreF
Urease accessory protein UreF
ureG
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE0998: Urease accessory protein UreG
 
Corynebacterium glutamicum ATCC 13032

Gene: cg0118: Urease accessory protein UreG
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109

Gene: cur_1776: Urease accessory protein UreG
Urease accessory protein UreG
ureD
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE0999: Urease accessory protein UreD
 
Corynebacterium glutamicum ATCC 13032

Gene: cg0119: Urease accessory protein UreD
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109

Gene: cur_1777: Urease accessory protein UreD
Urease accessory protein UreD
 
CRON 14.
amtA
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
*
Corynebacterium efficiens YS-314

Site:
position = -99
score = 5.30129
sequence = TTAAACTATTGACCGATAGAAACA

Site:
position = -65
score = 5.08634
sequence = GTTATCTGTTATGCAATAGAAAAT

Gene: CE1701: Ammonium transporter
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -100
score = 5.19084
sequence = GAAATCTATAGAACGATAGGTAAA

Site:
position = -64
score = 5.29044
sequence = TTTATCTATAGCGGAATAGAAAAT

Gene: cg1785: Ammonium transporter
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Ammonium transporter
ocd
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE1700: Ornithine cyclodeaminase (EC 4.3.1.12)
 
Corynebacterium glutamicum ATCC 13032

Gene: cg1784: Ornithine cyclodeaminase (EC 4.3.1.12)
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Ornithine cyclodeaminase (EC 4.3.1.12)
soxA
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE1699: Sarcosine oxidase
 2
Corynebacterium glutamicum ATCC 13032

Gene: cg1781: Sarcosine oxidase

Gene: cg1783: Sarcosine oxidase
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Sarcosine oxidase
 
CRON 15.
uctT
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
*
Corynebacterium efficiens YS-314

Site:
position = -117
score = 5.89942
sequence = ATTACCTATCGATCGATAGATAAA

Gene: CE0711: Urea carboxylase-related transporter, Amino acid permease family
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Urea carboxylase-related transporter, Amino acid permease family
ucaB
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE0710: Allophanate hydrolase (EC 3.5.1.54)
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Allophanate hydrolase (EC 3.5.1.54)
 
CRON 16.
amt1
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
*
Corynebacterium efficiens YS-314

Site:
position = -102
score = 5.63034
sequence = ATTATCGGTCGATCTATAGATAAA

Gene: CE0715: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
amt2
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE0714: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
ucaA
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE0713: Urea carboxylase (EC 6.3.4.6)
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Urea carboxylase (EC 6.3.4.6)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD