Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MntR - Streptococcaceae

Properties
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 37 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactococcus lactis subsp. cremoris SK11 1 1
Lactococcus lactis subsp. lactis Il1403 4 2
Streptococcus agalactiae 2603V/R 10 4
Streptococcus dysgalactiae subsp. equisimilis GGS_124 5 3
Streptococcus equi subsp. zooepidemicus MGCS10565 9 3
Streptococcus gallolyticus UCN34 4 2
Streptococcus gordonii str. Challis substr. CH1 3 1
Streptococcus mitis B6 5 3
Streptococcus mutans UA159 3 1
Streptococcus pneumoniae TIGR4 4 2
Streptococcus pyogenes M1 GAS 5 3
Streptococcus sanguinis SK36 3 1
Streptococcus suis 05ZYH33 2 2
Streptococcus thermophilus CNRZ1066
Streptococcus uberis 0140J 6 4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
SPy1434
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -54
score = 5.02662
sequence = ATAATTAATATATCTTAAAGAT

Gene: SDEG_1473: Predicted cation transporting ATPase (EC 3.6.3.3)
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159

Gene: SMU.2057c: Predicted cation transporting ATPase (EC 3.6.3.3)
 
Streptococcus pneumoniae TIGR4
*
Streptococcus pyogenes M1 GAS

Site:
position = -86
score = 5.10521
sequence = CTAAATTACTTGACTTATTTAT

Site:
position = -53
score = 5.02662
sequence = ATAATTAATATATCTTAAAGAT

Gene: SPy1434: Predicted cation transporting ATPase (EC 3.6.3.3)
 
Streptococcus sanguinis SK36
*
Streptococcus suis 05ZYH33

Site:
position = -135
score = 5.35356
sequence = ATAAATAACTTGACTTTCTTTT

Site:
position = -103
score = 5.27973
sequence = ATAATTAACTTAGTTAAATGAT

Gene: SSU05_0309: Predicted cation transporting ATPase (EC 3.6.3.3)
 
Streptococcus thermophilus CNRZ1066
*
Streptococcus uberis 0140J

Site:
position = -54
score = 5.34384
sequence = ATAATTAAGATGAATTAAATTG

Gene: SUB1266: Predicted cation transporting ATPase (EC 3.6.3.3)
Predicted cation transporting ATPase (EC 3.6.3.3)
 
CRON 2.
mntR
*
Lactococcus lactis subsp. cremoris SK11

Site:
position = -31
score = 5.12554
sequence = ATAATTAAATGGAGAAAAGTAA

Gene: LACR_1369: Manganese homeostasis transcriptional regulator MntR, DtxR family
*
Lactococcus lactis subsp. lactis Il1403

Site:
position = -31
score = 5.09735
sequence = ATAATTAAATCAAGAAAAGTAA

Gene: L84767: Manganese homeostasis transcriptional regulator MntR, DtxR family
*
Streptococcus agalactiae 2603V/R

Site:
position = -151
score = 5.05341
sequence = AAAATTAATATAAGTTATGTAT

Site:
position = -129
score = 6.20842
sequence = TAAATTAAGTTAACTTAATTTT

Gene: SAG1534: Manganese homeostasis transcriptional regulator MntR, DtxR family
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -116
score = 5.97345
sequence = TTAATTAAGTATAGTTAAATAT

Gene: SDEG_0487: Manganese homeostasis transcriptional regulator MntR, DtxR family
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -116
score = 6.20754
sequence = TTAATTAAGTATAGTTAATTAT

Gene: Sez_1470: Manganese homeostasis transcriptional regulator MntR, DtxR family
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1718: Manganese homeostasis transcriptional regulator MntR, DtxR family
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1816: Manganese homeostasis transcriptional regulator MntR, DtxR family
 
Streptococcus mitis B6

Gene: smi_0645: Manganese homeostasis transcriptional regulator MntR, DtxR family
 
Streptococcus mutans UA159

Gene: SMU.186: Manganese homeostasis transcriptional regulator MntR, DtxR family
 
Streptococcus pneumoniae TIGR4

Gene: SP_1638: Manganese homeostasis transcriptional regulator MntR, DtxR family
*
Streptococcus pyogenes M1 GAS

Site:
position = -116
score = 6.25894
sequence = TTAATTAAGTTTAGTTAATTAT

Gene: SPy0450: Manganese homeostasis transcriptional regulator MntR, DtxR family
 
Streptococcus sanguinis SK36

Gene: SSA_0256: Manganese homeostasis transcriptional regulator MntR, DtxR family
 
Streptococcus suis 05ZYH33

Gene: SSU05_2087: Manganese homeostasis transcriptional regulator MntR, DtxR family
 
Streptococcus thermophilus CNRZ1066
*
Streptococcus uberis 0140J

Site:
position = -117
score = 5.9289
sequence = TTAATTAAGTATGGTTAATTAT

Gene: SUBp03: Manganese homeostasis transcriptional regulator MntR, DtxR family
Manganese homeostasis transcriptional regulator MntR, DtxR family
 
CRON 3.
nikA
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
*
Streptococcus agalactiae 2603V/R

Site:
position = -56
score = 5.18199
sequence = CTAATTAAGTTTGCTTAAAAAA

Site:
position = -34
score = 5.21345
sequence = ATAATTAACTAAACTTAAAAGA

Gene: SAG1518: Nickel ABC transporter, substrate-binding protein
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -79
score = 5.91236
sequence = TAAATTAACCATACTTAATTTT

Gene: Sez_1456: Nickel ABC transporter, substrate-binding protein
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Nickel ABC transporter, substrate-binding protein
nikB
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R

Gene: SAG1517: Nickel ABC transporter, permease protein 1
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1455: Nickel ABC transporter, permease protein 1
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Nickel ABC transporter, permease protein 1
nikC
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R

Gene: SAG1516: Nickel ABC transporter, permease protein 2
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1454: Nickel ABC transporter, permease protein 2
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Nickel ABC transporter, permease protein 2
nikD
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R

Gene: SAG1515: Nickel ABC transporter, ATP-binding protein 1
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1453: Nickel ABC transporter, ATP-binding protein 1
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Nickel ABC transporter, ATP-binding protein 1
nikE
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R

Gene: SAG1514: Nickel ABC transporter, ATP-binding protein 2
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1452: Nickel ABC transporter, ATP-binding protein 2
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Nickel ABC transporter, ATP-binding protein 2
 
CRON 4.
mntH
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
*
Streptococcus agalactiae 2603V/R

Site:
position = -85
score = 5.53946
sequence = ATTATTAAGTAGCGTTAATTTT

Gene: SAG0745: Manganese transport protein MntH
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
*
Streptococcus gallolyticus UCN34

Site:
position = -78
score = 5.2153
sequence = TTAATTAAATACGCTTTATTTT

Gene: GALLO_0590: Manganese transport protein MntH
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0217: Manganese transport protein MntH
*
Streptococcus mitis B6

Site:
position = -164
score = 5.20338
sequence = AAAATTAACCAATATTAATAAT

Gene: smi_1232: Manganese transport protein MntH
 
Streptococcus mutans UA159

Gene: SMU.770c: Manganese transport protein MntH
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066

Gene: str0677: Manganese transport protein MntH
 
Streptococcus uberis 0140J
Manganese transport protein MntH
 
CRON 5.
mntB
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_1440: Manganese ABC transporter, ATP-binding protein
*
Lactococcus lactis subsp. lactis Il1403

Site:
position = -87
score = 4.90626
sequence = CAAAATATATTGATTTAATTTT

Gene: L150744: Manganese ABC transporter, ATP-binding protein
 
Streptococcus agalactiae 2603V/R

Gene: SAG1532: Manganese ABC transporter, ATP-binding protein
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_0489: Manganese ABC transporter, ATP-binding protein
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1468: Manganese ABC transporter, ATP-binding protein
 
Streptococcus gallolyticus UCN34

Gene: GALLO_2046: Manganese ABC transporter, ATP-binding protein
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -60
score = 6.43283
sequence = AAAATTAACTTGACTTAATTTT

Gene: SGO_1800: Manganese ABC transporter, ATP-binding protein
*
Streptococcus mitis B6

Site:
position = -62
score = 6.07966
sequence = AAAATTAACTTGACTTAACTTT

Gene: smi_0636: Manganese ABC transporter, ATP-binding protein
*
Streptococcus mutans UA159

Site:
position = -57
score = 6.43283
sequence = AAAATTAACTTGACTTAATTTT

Gene: SMU.182: Manganese ABC transporter, ATP-binding protein
*
Streptococcus pneumoniae TIGR4

Site:
position = -62
score = 6.43283
sequence = AAAATTAACTTGACTTAATTTT

Gene: SP_1648: Manganese ABC transporter, ATP-binding protein
 
Streptococcus pyogenes M1 GAS

Gene: SPy0454: Manganese ABC transporter, ATP-binding protein
*
Streptococcus sanguinis SK36

Site:
position = -29
score = 6.43283
sequence = AAAATTAACTTGACTTAATTTT

Gene: SSA_0262: Manganese ABC transporter, ATP-binding protein
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB0474: Manganese ABC transporter, ATP-binding protein
Manganese ABC transporter, ATP-binding protein
mntC
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_1439: Manganese ABC transporter, permease protein
 
Lactococcus lactis subsp. lactis Il1403

Gene: L149891: Manganese ABC transporter, permease protein
 
Streptococcus agalactiae 2603V/R

Gene: SAG1531: Manganese ABC transporter, permease protein
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_0490: Manganese ABC transporter, permease protein
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1467: Manganese ABC transporter, permease protein
 
Streptococcus gallolyticus UCN34

Gene: GALLO_2045: Manganese ABC transporter, permease protein
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1801: Manganese ABC transporter, permease protein
 
Streptococcus mitis B6

Gene: smi_0635: Manganese ABC transporter, permease protein
 
Streptococcus mutans UA159

Gene: SMU.183: Manganese ABC transporter, permease protein
 
Streptococcus pneumoniae TIGR4

Gene: SP_1649: Manganese ABC transporter, permease protein
 
Streptococcus pyogenes M1 GAS

Gene: SPy0456: Manganese ABC transporter, permease protein
 
Streptococcus sanguinis SK36

Gene: SSA_0261: Manganese ABC transporter, permease protein
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB0475: Manganese ABC transporter, permease protein
Manganese ABC transporter, permease protein
mntA
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403

Gene: L148957: Manganese ABC transporter, substrate-binding protein
*
Streptococcus agalactiae 2603V/R

Site:
position = -59
score = 6.26389
sequence = AAAATTAAGTTAACTTAATTTA

Gene: SAG1533: Manganese ABC transporter, substrate-binding protein
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -51
score = 6.07104
sequence = ATATTTAACTATACTTAATTAA

Gene: SDEG_0488: Manganese ABC transporter, substrate-binding protein
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -51
score = 6.3792
sequence = ATAATTAACTATACTTAATTAA

Gene: Sez_1469: Manganese ABC transporter, substrate-binding protein
*
Streptococcus gallolyticus UCN34

Site:
position = -53
score = 5.78171
sequence = AAAATTAAGCATGCTTAATTTT

Gene: GALLO_2047: Manganese ABC transporter, substrate-binding protein
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1802: Manganese ABC transporter, substrate-binding protein
 
Streptococcus mitis B6

Gene: smi_0634: Manganese ABC transporter, substrate-binding protein
 
Streptococcus mutans UA159

Gene: SMU.184: Manganese ABC transporter, substrate-binding protein
 
Streptococcus pneumoniae TIGR4

Gene: SP_1650: Manganese ABC transporter, substrate-binding protein
*
Streptococcus pyogenes M1 GAS

Site:
position = -51
score = 6.35101
sequence = ATAATTAACTAAACTTAATTAA

Gene: SPy0453: Manganese ABC transporter, substrate-binding protein
 
Streptococcus sanguinis SK36

Gene: SSA_0260: Manganese ABC transporter, substrate-binding protein
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
*
Streptococcus uberis 0140J

Site:
position = -32
score = 4.90236
sequence = TTAATTATATAATATAAATTAA

Site:
position = -50
score = 6.08223
sequence = ATAATTAACCATACTTAATTAA

Gene: SUB0473: Manganese ABC transporter, substrate-binding protein
Manganese ABC transporter, substrate-binding protein
 
CRON 6.
prtA
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
*
Streptococcus mitis B6

Site:
position = -194
score = 5.6468
sequence = AAAATTAACCAGCCTTAATTTT

Gene: smi_0705: C5a peptidase precursor (EC 3.4.21.-)
 
Streptococcus mutans UA159
*
Streptococcus pneumoniae TIGR4

Site:
position = -194
score = 5.84153
sequence = TAAATTAACTAATGTTAATTTT

Gene: SP_0641: C5a peptidase precursor (EC 3.4.21.-)
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
*
Streptococcus suis 05ZYH33

Site:
position = -32
score = 5.14573
sequence = TAAATTAATTAAACTTAAAAAA

Gene: SSU05_1982: C5a peptidase precursor (EC 3.4.21.-)
 
Streptococcus thermophilus CNRZ1066
*
Streptococcus uberis 0140J

Site:
position = -83
score = 5.65866
sequence = ATTATTAAGTATACTTAATAAT

Gene: SUB0826: C5a peptidase precursor (EC 3.4.21.-)
C5a peptidase precursor (EC 3.4.21.-)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD