Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SufR - Corynebacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Corynebacterium amycolatum SK46 7 1
Corynebacterium aurimucosum ATCC 700975 7 1
Corynebacterium diphtheriae NCTC 13129 7 1
Corynebacterium efficiens YS-314 7 1
Corynebacterium glutamicum ATCC 13032 7 1
Corynebacterium jeikeium K411 7 1
Corynebacterium kroppenstedtii DSM 44385 7 1
Corynebacterium urealyticum DSM 7109 7 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
sufR
*
Corynebacterium amycolatum SK46

Site:
position = -119
score = 7.04522
sequence = TTACGACACAATTATGTTGTCTAA

Gene: CORAM0001_0944: Iron-sulfur cluster biogenesis transcriptional regulator SufR, ArsR family
*
Corynebacterium aurimucosum ATCC 700975

Site:
position = -57
score = 7.294
sequence = TTAAGGAACACTAGTGTTGTCTAA

Gene: cauri_1215: Iron-sulfur cluster biogenesis transcriptional regulator SufR, ArsR family
*
Corynebacterium diphtheriae NCTC 13129

Site:
position = -163
score = 5.33588
sequence = CTAACCTGCACTTTTGTGGGTTAT

Gene: DIP1296: Iron-sulfur cluster biogenesis transcriptional regulator SufR, ArsR family
*
Corynebacterium efficiens YS-314

Site:
position = -72
score = 7.47129
sequence = TTAGGGAACACTTGTGTTGTCTAA

Gene: CE1687: Iron-sulfur cluster biogenesis transcriptional regulator SufR, ArsR family
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -58
score = 7.47129
sequence = TTAGGGAACACTTGTGTTGTCTAA

Gene: cg1765: Iron-sulfur cluster biogenesis transcriptional regulator SufR, ArsR family
*
Corynebacterium jeikeium K411

Site:
position = -88
score = 7.47129
sequence = TTACGACACACTTTTGTTGTCTAA

Gene: jk0985: Iron-sulfur cluster biogenesis transcriptional regulator SufR, ArsR family
*
Corynebacterium kroppenstedtii DSM 44385

Site:
position = -223
score = 6.06671
sequence = TTCCGACACACTAATGTTGTGTAA

Gene: ckrop_0953: Iron-sulfur cluster biogenesis transcriptional regulator SufR, ArsR family
*
Corynebacterium urealyticum DSM 7109

Site:
position = -59
score = 7.294
sequence = TTAAGACACACTCTTGTTGTCTAA

Gene: cur_1006: Iron-sulfur cluster biogenesis transcriptional regulator SufR, ArsR family
Iron-sulfur cluster biogenesis transcriptional regulator SufR, ArsR family
sufB
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_0945: Iron-sulfur cluster assembly protein SufB
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_1216: Iron-sulfur cluster assembly protein SufB
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP1295: Iron-sulfur cluster assembly protein SufB
 
Corynebacterium efficiens YS-314

Gene: CE1686: Iron-sulfur cluster assembly protein SufB
 
Corynebacterium glutamicum ATCC 13032

Gene: cg1764: Iron-sulfur cluster assembly protein SufB
 
Corynebacterium jeikeium K411

Gene: jk0984: Iron-sulfur cluster assembly protein SufB
 
Corynebacterium kroppenstedtii DSM 44385

Gene: ckrop_0952: Iron-sulfur cluster assembly protein SufB
 
Corynebacterium urealyticum DSM 7109

Gene: cur_1007: Iron-sulfur cluster assembly protein SufB
Iron-sulfur cluster assembly protein SufB
sufD
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_0946: Iron-sulfur cluster assembly protein SufD
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_1217: Iron-sulfur cluster assembly protein SufD
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP1294: Iron-sulfur cluster assembly protein SufD
 
Corynebacterium efficiens YS-314

Gene: CE1685: Iron-sulfur cluster assembly protein SufD
 
Corynebacterium glutamicum ATCC 13032

Gene: cg1763: Iron-sulfur cluster assembly protein SufD
 
Corynebacterium jeikeium K411

Gene: jk0983: Iron-sulfur cluster assembly protein SufD
 
Corynebacterium kroppenstedtii DSM 44385

Gene: ckrop_0951: Iron-sulfur cluster assembly protein SufD
 
Corynebacterium urealyticum DSM 7109

Gene: cur_1008: Iron-sulfur cluster assembly protein SufD
Iron-sulfur cluster assembly protein SufD
sufC
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_0947: Iron-sulfur cluster assembly ATPase protein SufC
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_1218: Iron-sulfur cluster assembly ATPase protein SufC
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP1293: Iron-sulfur cluster assembly ATPase protein SufC
 
Corynebacterium efficiens YS-314

Gene: CE1684: Iron-sulfur cluster assembly ATPase protein SufC
 
Corynebacterium glutamicum ATCC 13032

Gene: cg1762: Iron-sulfur cluster assembly ATPase protein SufC
 
Corynebacterium jeikeium K411

Gene: jk0982: Iron-sulfur cluster assembly ATPase protein SufC
 
Corynebacterium kroppenstedtii DSM 44385

Gene: ckrop_0950: Iron-sulfur cluster assembly ATPase protein SufC
 
Corynebacterium urealyticum DSM 7109

Gene: cur_1009: Iron-sulfur cluster assembly ATPase protein SufC
Iron-sulfur cluster assembly ATPase protein SufC
sufS
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_0948: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_1219: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP1292: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Corynebacterium efficiens YS-314

Gene: CE1683: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Corynebacterium glutamicum ATCC 13032

Gene: cg1761: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Corynebacterium jeikeium K411

Gene: jk0981: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Corynebacterium kroppenstedtii DSM 44385

Gene: ckrop_0948: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Corynebacterium urealyticum DSM 7109

Gene: cur_1010: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
sufU
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_0949: Iron-sulfur cluster assembly scaffold protein
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_1220: Iron-sulfur cluster assembly scaffold protein
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP1291: Iron-sulfur cluster assembly scaffold protein
 
Corynebacterium efficiens YS-314

Gene: CE1682: Iron-sulfur cluster assembly scaffold protein
 
Corynebacterium glutamicum ATCC 13032

Gene: cg1760: Iron-sulfur cluster assembly scaffold protein
 
Corynebacterium jeikeium K411

Gene: jk0980: Iron-sulfur cluster assembly scaffold protein
 
Corynebacterium kroppenstedtii DSM 44385

Gene: ckrop_0947: Iron-sulfur cluster assembly scaffold protein
 
Corynebacterium urealyticum DSM 7109

Gene: cur_1011: Iron-sulfur cluster assembly scaffold protein
Iron-sulfur cluster assembly scaffold protein
sufT
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_0950: Predicted Fe-S cluster assembly protein
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_1221: Predicted Fe-S cluster assembly protein
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP1290: Predicted Fe-S cluster assembly protein
 
Corynebacterium efficiens YS-314

Gene: CE1681: Predicted Fe-S cluster assembly protein
 
Corynebacterium glutamicum ATCC 13032

Gene: cg1759: Predicted Fe-S cluster assembly protein
 
Corynebacterium jeikeium K411

Gene: jk0979: Predicted Fe-S cluster assembly protein
 
Corynebacterium kroppenstedtii DSM 44385

Gene: ckrop_0946: Predicted Fe-S cluster assembly protein
 
Corynebacterium urealyticum DSM 7109

Gene: cur_1012: Predicted Fe-S cluster assembly protein
Predicted Fe-S cluster assembly protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD