Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog XapR - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: LysR
Regulation mode: activator
Biological process: Xanthosine utilization
Effector: Deoxyinosine; Xanthosine
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Citrobacter koseri ATCC BAA-895 3 1
Edwardsiella tarda EIB202 3 1
Enterobacter sp. 638 3 1
Erwinia amylovora ATCC 49946
Erwinia carotovora subsp. atroseptica SCRI1043
Escherichia coli str. K-12 substr. MG1655 2 1
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Photorhabdus luminescens subsp. laumondii TTO1
Proteus mirabilis HI4320
Salmonella typhimurium LT2
Serratia proteamaculans 568
Yersinia pestis KIM
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
xapA
*
Citrobacter koseri ATCC BAA-895

Site:
position = -120
score = 6.23346
sequence = TCAATATACATTTTATATCGA

Gene: CKO_00389: Xanthosine phosphorylase (EC 2.4.2.1)
*
Edwardsiella tarda EIB202

Site:
position = -115
score = 4.36517
sequence = TCCCTAGCAAATCAATACTGA

Gene: ETAE_2779: Xanthosine phosphorylase (EC 2.4.2.1)
*
Enterobacter sp. 638

Site:
position = -121
score = 5.16572
sequence = TTGATACTGAAAGAGTATTGA

Gene: Ent638_2934: Xanthosine phosphorylase (EC 2.4.2.1)
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -107
score = 5.91526
sequence = TCGATATCGAATCGCTATTGA

Site:
position = -132
score = 4.22582
sequence = TTAATAGAGAAAAGATATAAA

Gene: b2407: Xanthosine phosphorylase (EC 2.4.2.1)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
 
Serratia proteamaculans 568

Gene: Spro_4255: Xanthosine phosphorylase (EC 2.4.2.1)
 
Yersinia pestis KIM
Xanthosine phosphorylase (EC 2.4.2.1)
xapX
 
Citrobacter koseri ATCC BAA-895
 
Edwardsiella tarda EIB202

Gene: ETAE_2780: Predicted xanthosine transporter
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
Predicted xanthosine transporter
xapR
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00391: Xanthosine operon regulatory protein XapR, LysR family
 
Edwardsiella tarda EIB202

Gene: ETAE_2781: Xanthosine operon regulatory protein XapR, LysR family
 
Enterobacter sp. 638

Gene: Ent638_2932: Xanthosine operon regulatory protein XapR, LysR family
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2405: Xanthosine operon regulatory protein XapR, LysR family
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2

Gene: STM2420: Xanthosine operon regulatory protein XapR, LysR family
 
Serratia proteamaculans 568

Gene: Spro_4256: Xanthosine operon regulatory protein XapR, LysR family
 
Yersinia pestis KIM
Xanthosine operon regulatory protein XapR, LysR family
xapB
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00390: Xanthosine permease
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638

Gene: Ent638_2933: Xanthosine permease
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2406: Xanthosine permease
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2

Gene: STM2421: Xanthosine permease
 
Serratia proteamaculans 568

Gene: Spro_4254: Xanthosine permease
 
Yersinia pestis KIM
Xanthosine permease
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD