Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog FasR - Corynebacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid biosynthesis
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Corynebacterium amycolatum SK46 2 2
Corynebacterium aurimucosum ATCC 700975 2 2
Corynebacterium diphtheriae NCTC 13129 2 2
Corynebacterium efficiens YS-314 2 2
Corynebacterium glutamicum ATCC 13032 4 4
Corynebacterium jeikeium K411
Corynebacterium kroppenstedtii DSM 44385
Corynebacterium urealyticum DSM 7109
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
accD1
*
Corynebacterium amycolatum SK46

Site:
position = -2
score = 5.70866
sequence = ACATGACTATTTCCTCACGT

Gene: CORAM0001_2207: Propionyl-CoA carboxylase beta chain (EC 6.4.1.3)
*
Corynebacterium aurimucosum ATCC 700975

Site:
position = -2
score = 5.65765
sequence = ACATGACTATTTCCTCACAT

Gene: cauri_0563: Propionyl-CoA carboxylase beta chain (EC 6.4.1.3)
*
Corynebacterium diphtheriae NCTC 13129

Site:
position = -2
score = 5.50434
sequence = ACATGACCATTTCCTCATCT

Gene: DIP0660: Propionyl-CoA carboxylase beta chain (EC 6.4.1.3)
*
Corynebacterium efficiens YS-314

Site:
position = -2
score = 5.25607
sequence = ACATGACCATTTCCTCACCT

Gene: CE0738: Propionyl-CoA carboxylase beta chain (EC 6.4.1.3)
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -2
score = 5.25607
sequence = ACATGACCATTTCCTCACCT

Gene: cg0812: Propionyl-CoA carboxylase beta chain (EC 6.4.1.3)
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Propionyl-CoA carboxylase beta chain (EC 6.4.1.3)
 
CRON 2.
fasA
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_0280: [Acyl-carrier-protein] acetyl transferase of FASI (EC 2.3.1.38) / Enoyl-[acyl-carrier-protein] reductase of FASI (EC 1.3.1.9) / 3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase of FASI (EC 4.2.1.61) / [Acyl-carrier-protein] malonyl transferase of ...
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE0913: [Acyl-carrier-protein] acetyl transferase of FASI (EC 2.3.1.38) / Enoyl-[acyl-carrier-protein] reductase of FASI (EC 1.3.1.9) / 3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase of FASI (EC 4.2.1.61) / [Acyl-carrier-protein] malonyl transferase of ...
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -105
score = 5.70294
sequence = ACATGAGGGTTTAGTCATCT

Gene: cg0957: [Acyl-carrier-protein] acetyl transferase of FASI (EC 2.3.1.38) / Enoyl-[acyl-carrier-protein] reductase of FASI (EC 1.3.1.9) / 3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase of FASI (EC 4.2.1.61) / [Acyl-carrier-protein] malonyl transferase of ...
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
[Acyl-carrier-protein] acetyl transferase of FASI (EC 2.3.1.38) / Enoyl-[acyl-carrier-protein] reductase of FASI (EC 1.3.1.9) / 3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase of FASI (EC 4.2.1.61) / [Acyl-carrier-protein] malonyl transferase of ...
 
CRON 3.
fasB
*
Corynebacterium amycolatum SK46

Site:
position = -102
score = 5.84073
sequence = ACATGATGGATTCCTCATGA

Gene: CORAM0001_1183: [Acyl-carrier-protein] acetyl transferase of FASI (EC 2.3.1.38) / Enoyl-[acyl-carrier-protein] reductase of FASI (EC 1.3.1.9) / 3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase of FASI (EC 4.2.1.61) / [Acyl-carrier-protein] malonyl transferase of ...
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_2079: [Acyl-carrier-protein] acetyl transferase of FASI (EC 2.3.1.38) / Enoyl-[acyl-carrier-protein] reductase of FASI (EC 1.3.1.9) / 3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase of FASI (EC 4.2.1.61) / [Acyl-carrier-protein] malonyl transferase of ...
*
Corynebacterium diphtheriae NCTC 13129

Site:
position = -101
score = 5.9466
sequence = AGATGACAGTTTCCTCATAT

Gene: DIP1846: [Acyl-carrier-protein] acetyl transferase of FASI (EC 2.3.1.38) / Enoyl-[acyl-carrier-protein] reductase of FASI (EC 1.3.1.9) / 3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase of FASI (EC 4.2.1.61) / [Acyl-carrier-protein] malonyl transferase of ...
*
Corynebacterium efficiens YS-314

Site:
position = -165
score = 5.87696
sequence = AGATGACGTTTTCCTCATGA

Gene: CE2392: [Acyl-carrier-protein] acetyl transferase of FASI (EC 2.3.1.38) / Enoyl-[acyl-carrier-protein] reductase of FASI (EC 1.3.1.9) / 3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase of FASI (EC 4.2.1.61) / [Acyl-carrier-protein] malonyl transferase of ...
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -168
score = 5.87696
sequence = AGATGACGTTTTCCTCATGA

Gene: cg2743: [Acyl-carrier-protein] acetyl transferase of FASI (EC 2.3.1.38) / Enoyl-[acyl-carrier-protein] reductase of FASI (EC 1.3.1.9) / 3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase of FASI (EC 4.2.1.61) / [Acyl-carrier-protein] malonyl transferase of ...
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
[Acyl-carrier-protein] acetyl transferase of FASI (EC 2.3.1.38) / Enoyl-[acyl-carrier-protein] reductase of FASI (EC 1.3.1.9) / 3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase of FASI (EC 4.2.1.61) / [Acyl-carrier-protein] malonyl transferase of ...
 
CRON 4.
accBC
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_1963: Biotin carboxylase of acetyl-CoA carboxylase (EC 6.3.4.14) / Biotin carboxyl carrier protein of acetyl-CoA carboxylase
*
Corynebacterium aurimucosum ATCC 700975

Site:
position = -78
score = 5.67725
sequence = ATGTGAAGGTATCCTCATGT

Gene: cauri_0555: Biotin carboxylase of acetyl-CoA carboxylase (EC 6.3.4.14) / Biotin carboxyl carrier protein of acetyl-CoA carboxylase
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP0649: Biotin carboxylase of acetyl-CoA carboxylase (EC 6.3.4.14) / Biotin carboxyl carrier protein of acetyl-CoA carboxylase
 
Corynebacterium efficiens YS-314

Gene: CE0719: Biotin carboxylase of acetyl-CoA carboxylase (EC 6.3.4.14) / Biotin carboxyl carrier protein of acetyl-CoA carboxylase
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -121
score = 5.43558
sequence = ATATGAGTAAGTCCTCATAT

Gene: cg0802: Biotin carboxylase of acetyl-CoA carboxylase (EC 6.3.4.14) / Biotin carboxyl carrier protein of acetyl-CoA carboxylase
 
Corynebacterium jeikeium K411

Gene: jk1669: Biotin carboxylase of acetyl-CoA carboxylase (EC 6.3.4.14) / Biotin carboxyl carrier protein of acetyl-CoA carboxylase
 
Corynebacterium kroppenstedtii DSM 44385

Gene: ckrop_1542: Biotin carboxylase of acetyl-CoA carboxylase (EC 6.3.4.14) / Biotin carboxyl carrier protein of acetyl-CoA carboxylase
 
Corynebacterium urealyticum DSM 7109

Gene: cur_0446: Biotin carboxylase of acetyl-CoA carboxylase (EC 6.3.4.14) / Biotin carboxyl carrier protein of acetyl-CoA carboxylase
Biotin carboxylase of acetyl-CoA carboxylase (EC 6.3.4.14) / Biotin carboxyl carrier protein of acetyl-CoA carboxylase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD