Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CggR - Lactobacillaceae

Properties
Regulator type: Transcription factor
Regulator family: SorC
Regulation mode: repressor
Biological process: Glycolysis
Effector: Fructose-1,6-bisphosphate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactobacillus acidophilus NCFM 4 1
Lactobacillus brevis ATCC 367 5 1
Lactobacillus casei ATCC 334 5 1
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 4 1
Lactobacillus fermentum IFO 3956
Lactobacillus helveticus DPC 4571 4 1
Lactobacillus johnsonii NCC 533 5 1
Lactobacillus plantarum WCFS1 5 1
Lactobacillus reuteri JCM 1112
Lactobacillus rhamnosus GG 5 1
Lactobacillus sakei subsp. sakei 23K 5 1
Lactobacillus salivarius subsp. salivarius UCC118 5 1
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
Oenococcus oeni PSU-1
Pediococcus pentosaceus ATCC 25745 5 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
cggR
*
Lactobacillus acidophilus NCFM

Site:
position = 1
score = 7.96728
sequence = TGGATTCGGACTTTTCTTTGCTCGAAGCGCTCGTTCC

Gene: LBA0697: Transcriptional regulator of central glycolytic gene, SorC family
*
Lactobacillus brevis ATCC 367

Site:
position = 1
score = 6.45179
sequence = TGCATGAGGATTGGCAATGGGTAGAGGCCATCATGCC

Gene: LVIS_0660: Transcriptional regulator of central glycolytic gene, SorC family
*
Lactobacillus casei ATCC 334

Site:
position = 1
score = 7.55953
sequence = TGCATACTGAACTTGCGTGGCTCAAAGCGATCGCGCC

Gene: LSEI_0966: Transcriptional regulator of central glycolytic gene, SorC family
*
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Site:
position = 1
score = 6.92848
sequence = TGAACACGGATTTATCCCTGCTCGAACTGCTTGTTCC

Gene: LBUL_0566: Transcriptional regulator of central glycolytic gene, SorC family
 
Lactobacillus fermentum IFO 3956
*
Lactobacillus helveticus DPC 4571

Site:
position = 1
score = 7.91524
sequence = TGAATTCGGACTTTTCTTTGCTCGAAGCGCTCGTTCC

Gene: lhv_0742: Transcriptional regulator of central glycolytic gene, SorC family
*
Lactobacillus johnsonii NCC 533

Site:
position = 1
score = 6.05604
sequence = TGGACTCGGATTTAACCTTGTTGCAAAGCTTAGTTCC

Gene: LJ0871: Transcriptional regulator of central glycolytic gene, SorC family
*
Lactobacillus plantarum WCFS1

Site:
position = 1
score = 6.69215
sequence = TGCATTCAGATATTCAATGGATTGAGGCAATTGCCCC

Gene: lp_0788: Transcriptional regulator of central glycolytic gene, SorC family
 
Lactobacillus reuteri JCM 1112
*
Lactobacillus rhamnosus GG

Site:
position = 1
score = 7.55953
sequence = TGCATACTGAACTTGCGTGGCTCAAAGCGATCGCGCC

Gene: LGG_00932: Transcriptional regulator of central glycolytic gene, SorC family
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = 1
score = 6.46863
sequence = TGCGCGATGAGTTATCTGCAATAGAAGCGGTTGCGCC

Gene: LSA0603: Transcriptional regulator of central glycolytic gene, SorC family
*
Lactobacillus salivarius subsp. salivarius UCC118

Site:
position = 1
score = 6.75933
sequence = TGCGCGAGGAAGTAGAGTTGATTGAGTCAATCGTTCC

Gene: LSL_1167: Transcriptional regulator of central glycolytic gene, SorC family
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0630: Transcriptional regulator of central glycolytic gene, SorC family
 
Oenococcus oeni PSU-1
*
Pediococcus pentosaceus ATCC 25745

Site:
position = 4
score = 5.97702
sequence = ATGATAATGAGATGGATTTATTAGAATCTGTTGTTCC

Gene: PEPE_0458: Transcriptional regulator of central glycolytic gene, SorC family
Transcriptional regulator of central glycolytic gene, SorC family
gap
 
Lactobacillus acidophilus NCFM

Gene: LBA0698: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0661: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Lactobacillus casei ATCC 334

Gene: LSEI_0967: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_0567: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Lactobacillus fermentum IFO 3956

Gene: LAF_0363: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Lactobacillus helveticus DPC 4571

Gene: lhv_0743: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Lactobacillus johnsonii NCC 533

Gene: LJ0872: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Lactobacillus plantarum WCFS1

Gene: lp_0789: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0381: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Lactobacillus rhamnosus GG

Gene: LGG_00933: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA0604: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1166: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0305: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Oenococcus oeni PSU-1

Gene: OEOE_0404: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0459: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
pgk
 
Lactobacillus acidophilus NCFM

Gene: LBA0699: Phosphoglycerate kinase (EC 2.7.2.3)
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0662: Phosphoglycerate kinase (EC 2.7.2.3)
 
Lactobacillus casei ATCC 334

Gene: LSEI_0968: Phosphoglycerate kinase (EC 2.7.2.3)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_0568: Phosphoglycerate kinase (EC 2.7.2.3)
 
Lactobacillus fermentum IFO 3956

Gene: LAF_0364: Phosphoglycerate kinase (EC 2.7.2.3)
 
Lactobacillus helveticus DPC 4571

Gene: lhv_0744: Phosphoglycerate kinase (EC 2.7.2.3)
 
Lactobacillus johnsonii NCC 533

Gene: LJ0873: Phosphoglycerate kinase (EC 2.7.2.3)
 
Lactobacillus plantarum WCFS1

Gene: lp_0790: Phosphoglycerate kinase (EC 2.7.2.3)
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0382: Phosphoglycerate kinase (EC 2.7.2.3)
 
Lactobacillus rhamnosus GG

Gene: LGG_00934: Phosphoglycerate kinase (EC 2.7.2.3)
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA0605: Phosphoglycerate kinase (EC 2.7.2.3)
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1165: Phosphoglycerate kinase (EC 2.7.2.3)
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_1921: Phosphoglycerate kinase (EC 2.7.2.3)
 
Oenococcus oeni PSU-1

Gene: OEOE_0638: Phosphoglycerate kinase (EC 2.7.2.3)
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0460: Phosphoglycerate kinase (EC 2.7.2.3)
Phosphoglycerate kinase (EC 2.7.2.3)
tpiA
 
Lactobacillus acidophilus NCFM

Gene: LBA0700: Triosephosphate isomerase (EC 5.3.1.1)
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0663: Triosephosphate isomerase (EC 5.3.1.1)
 
Lactobacillus casei ATCC 334

Gene: LSEI_0969: Triosephosphate isomerase (EC 5.3.1.1)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_0569: Triosephosphate isomerase (EC 5.3.1.1)
 2
Lactobacillus fermentum IFO 3956

Gene: LAF_0365: Triosephosphate isomerase (EC 5.3.1.1)

Gene: LAF_0415: Triosephosphate isomerase (EC 5.3.1.1)
 
Lactobacillus helveticus DPC 4571

Gene: lhv_0745: Triosephosphate isomerase (EC 5.3.1.1)
 
Lactobacillus johnsonii NCC 533

Gene: LJ0874: Triosephosphate isomerase (EC 5.3.1.1)
 
Lactobacillus plantarum WCFS1

Gene: lp_0791: Triosephosphate isomerase (EC 5.3.1.1)
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0383: Triosephosphate isomerase (EC 5.3.1.1)
 
Lactobacillus rhamnosus GG

Gene: LGG_00935: Triosephosphate isomerase (EC 5.3.1.1)
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA0606: Triosephosphate isomerase (EC 5.3.1.1)
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1164: Triosephosphate isomerase (EC 5.3.1.1)
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0239: Triosephosphate isomerase (EC 5.3.1.1)
 
Oenococcus oeni PSU-1

Gene: OEOE_1652: Triosephosphate isomerase (EC 5.3.1.1)
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0461: Triosephosphate isomerase (EC 5.3.1.1)
Triosephosphate isomerase (EC 5.3.1.1)
enoA1
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0664: Enolase (EC 4.2.1.11)
 
Lactobacillus casei ATCC 334

Gene: LSEI_0970: Enolase (EC 4.2.1.11)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956

Gene: LAF_0366: Enolase (EC 4.2.1.11)
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533

Gene: LJ0875: Enolase (EC 4.2.1.11)
 
Lactobacillus plantarum WCFS1

Gene: lp_0792: Enolase (EC 4.2.1.11)
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0384: Enolase (EC 4.2.1.11)
 
Lactobacillus rhamnosus GG

Gene: LGG_00936: Enolase (EC 4.2.1.11)
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA0607: Enolase (EC 4.2.1.11)
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1163: Enolase (EC 4.2.1.11)
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0240: Enolase (EC 4.2.1.11)
 
Oenococcus oeni PSU-1

Gene: OEOE_1650: Enolase (EC 4.2.1.11)
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0462: Enolase (EC 4.2.1.11)
Enolase (EC 4.2.1.11)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD