Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SPy1285 - Streptococcaceae

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Transport
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 31 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactococcus lactis subsp. cremoris SK11
Lactococcus lactis subsp. lactis Il1403
Streptococcus agalactiae 2603V/R 7 3
Streptococcus dysgalactiae subsp. equisimilis GGS_124 9 3
Streptococcus equi subsp. zooepidemicus MGCS10565 10 3
Streptococcus gallolyticus UCN34 9 3
Streptococcus gordonii str. Challis substr. CH1 2 1
Streptococcus mitis B6 6 2
Streptococcus mutans UA159 8 3
Streptococcus pneumoniae TIGR4 7 3
Streptococcus pyogenes M1 GAS 9 3
Streptococcus sanguinis SK36
Streptococcus suis 05ZYH33 10 3
Streptococcus thermophilus CNRZ1066 3 1
Streptococcus uberis 0140J 9 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
SPy1285
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
*
Streptococcus agalactiae 2603V/R

Site:
position = -51
score = 6.54465
sequence = TTGTACTATTTTTATAGTACAA

Gene: SAG0938: Predicted transcriptional regulator, GntR family
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -51
score = 6.38756
sequence = CTGTACCATTTATTTAGTACAA

Gene: SDEG_1097: Predicted transcriptional regulator, GntR family
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -58
score = 6.78019
sequence = TTGTATCATTTAATTAGTACAA

Gene: Sez_0879: Predicted transcriptional regulator, GntR family
*
Streptococcus gallolyticus UCN34

Site:
position = -57
score = 6.14089
sequence = CTGTACCATTTATGTAGTACAA

Gene: GALLO_0987: Predicted transcriptional regulator, GntR family
 
Streptococcus gordonii str. Challis substr. CH1
*
Streptococcus mitis B6

Site:
position = -46
score = 6.6785
sequence = TTGTATTATTTAATTAAGACAA

Gene: smi_0581: Predicted transcriptional regulator, GntR family
*
Streptococcus mutans UA159

Site:
position = -52
score = 6.588
sequence = TTGTATTATATATATAACACAA

Gene: SMU.1193: Predicted transcriptional regulator, GntR family
*
Streptococcus pneumoniae TIGR4

Site:
position = -46
score = 6.6785
sequence = TTGTATTATTTAATTAAGACAA

Gene: SP_1714: Predicted transcriptional regulator, GntR family
*
Streptococcus pyogenes M1 GAS

Site:
position = -51
score = 6.4557
sequence = CTGTACCATTTAATTAGTACAA

Gene: SPy1285: Predicted transcriptional regulator, GntR family
 
Streptococcus sanguinis SK36
*
Streptococcus suis 05ZYH33

Site:
position = -48
score = 5.91404
sequence = TTGTATTATTAAGATAAGACAT

Gene: SSU05_0541: Predicted transcriptional regulator, GntR family
*
Streptococcus thermophilus CNRZ1066

Site:
position = -59
score = 6.29072
sequence = TTGTATCATTACTTTAGTACAA

Gene: str1435: Predicted transcriptional regulator, GntR family
*
Streptococcus uberis 0140J

Site:
position = -54
score = 6.52385
sequence = CTGTACCATTTAAATAGTACAA

Gene: SUB1003: Predicted transcriptional regulator, GntR family
Predicted transcriptional regulator, GntR family
SPy1286
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1098: Predicted ABC transporter, ATP-binding protein 1
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_0878: Predicted ABC transporter, ATP-binding protein 1
 
Streptococcus gallolyticus UCN34

Gene: GALLO_0986: Predicted ABC transporter, ATP-binding protein 1
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1342: Predicted ABC transporter, ATP-binding protein 1
 
Streptococcus mitis B6

Gene: smi_0580: Predicted ABC transporter, ATP-binding protein 1
 
Streptococcus mutans UA159

Gene: SMU.1194: Predicted ABC transporter, ATP-binding protein 1
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS

Gene: SPy1286: Predicted ABC transporter, ATP-binding protein 1
 
Streptococcus sanguinis SK36

Gene: SSA_0845: Predicted ABC transporter, ATP-binding protein 1
 
Streptococcus suis 05ZYH33

Gene: SSU05_0540: Predicted ABC transporter, ATP-binding protein 1
 
Streptococcus thermophilus CNRZ1066

Gene: str1436: Predicted ABC transporter, ATP-binding protein 1
 
Streptococcus uberis 0140J

Gene: SUB1004: Predicted ABC transporter, ATP-binding protein 1
Predicted ABC transporter, ATP-binding protein 1
SPy1287
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1099: Predicted ABC transporter, ATP-binding protein 2
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_0877: Predicted ABC transporter, ATP-binding protein 2
 
Streptococcus gallolyticus UCN34

Gene: GALLO_0985: Predicted ABC transporter, ATP-binding protein 2
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1343: Predicted ABC transporter, ATP-binding protein 2
 
Streptococcus mitis B6

Gene: smi_0579: Predicted ABC transporter, ATP-binding protein 2
 
Streptococcus mutans UA159

Gene: SMU.1195: Predicted ABC transporter, ATP-binding protein 2
 
Streptococcus pneumoniae TIGR4

Gene: SP_1715: Predicted ABC transporter, ATP-binding protein 2
 
Streptococcus pyogenes M1 GAS

Gene: SPy1287: Predicted ABC transporter, ATP-binding protein 2
 
Streptococcus sanguinis SK36

Gene: SSA_0844: Predicted ABC transporter, ATP-binding protein 2
 
Streptococcus suis 05ZYH33

Gene: SSU05_0539: Predicted ABC transporter, ATP-binding protein 2
 
Streptococcus thermophilus CNRZ1066

Gene: str1437: Predicted ABC transporter, ATP-binding protein 2
 
Streptococcus uberis 0140J

Gene: SUB1005: Predicted ABC transporter, ATP-binding protein 2
Predicted ABC transporter, ATP-binding protein 2
 
CRON 2.
SPy0836
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
*
Streptococcus agalactiae 2603V/R

Site:
position = -35
score = 6.20622
sequence = TTGTTCTATATTAATAATACAA

Gene: SAG1361: Predicted ABC transporter, periplasmic protein
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -37
score = 6.6362
sequence = TTGTCTTATAAAAATAGTACAA

Gene: SDEG_0798: Predicted ABC transporter, periplasmic protein
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -37
score = 6.2285
sequence = TTGTCTTAAAAAAATAGTACAA

Gene: Sez_1122: Predicted ABC transporter, periplasmic protein
*
Streptococcus gallolyticus UCN34

Site:
position = -48
score = 5.64208
sequence = TTGTCTTATCGCAACAATACAA

Gene: GALLO_1332: Predicted ABC transporter, periplasmic protein
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0750: Predicted ABC transporter, periplasmic protein
*
Streptococcus mitis B6

Site:
position = -153
score = 6.45495
sequence = GTGTATTATATATCTAGTACAA

Gene: smi_0839: Predicted ABC transporter, periplasmic protein
*
Streptococcus mutans UA159

Site:
position = -112
score = 5.85187
sequence = TTGTATTATAGCCTTAAGACAA

Gene: SMU.862: Predicted ABC transporter, periplasmic protein
*
Streptococcus pneumoniae TIGR4

Site:
position = -129
score = 6.45495
sequence = GTGTATTATATATCTAGTACAA

Gene: SP_0785: Predicted ABC transporter, periplasmic protein
*
Streptococcus pyogenes M1 GAS

Site:
position = -37
score = 6.47
sequence = TTGTCTTATACAAATAGTACAA

Gene: SPy0836: Predicted ABC transporter, periplasmic protein
 
Streptococcus sanguinis SK36

Gene: SSA_1532: Predicted ABC transporter, periplasmic protein
*
Streptococcus suis 05ZYH33

Site:
position = -28
score = 5.86828
sequence = GTGTATTATATAGACAACACAA

Gene: SSU05_0513: Predicted ABC transporter, periplasmic protein
 
Streptococcus thermophilus CNRZ1066
*
Streptococcus uberis 0140J

Site:
position = -37
score = 6.54257
sequence = TTGTCTTATATTAATAATACAA

Gene: SUB0736: Predicted ABC transporter, periplasmic protein
Predicted ABC transporter, periplasmic protein
SPy0837
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R

Gene: SAG1360: Predicted ABC transporter, ATP-binding protein
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_0799: Predicted ABC transporter, ATP-binding protein
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1121: Predicted ABC transporter, ATP-binding protein
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1331: Predicted ABC transporter, ATP-binding protein
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0751: Predicted ABC transporter, ATP-binding protein
 
Streptococcus mitis B6

Gene: smi_0840: Predicted ABC transporter, ATP-binding protein
 
Streptococcus mutans UA159

Gene: SMU.863: Predicted ABC transporter, ATP-binding protein
 
Streptococcus pneumoniae TIGR4

Gene: SP_0786: Predicted ABC transporter, ATP-binding protein
 
Streptococcus pyogenes M1 GAS

Gene: SPy0837: Predicted ABC transporter, ATP-binding protein
 
Streptococcus sanguinis SK36

Gene: SSA_1531: Predicted ABC transporter, ATP-binding protein
 2
Streptococcus suis 05ZYH33

Gene: SSU05_0514: Predicted ABC transporter, ATP-binding protein

Gene: SSU05_0515: Predicted ABC transporter, ATP-binding protein
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB0737: Predicted ABC transporter, ATP-binding protein
Predicted ABC transporter, ATP-binding protein
SPy0838
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R

Gene: SAG1359: Predicted ABC transporter, permease protein
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_0800: Predicted ABC transporter, permease protein
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1120: Predicted ABC transporter, permease protein
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1330: Predicted ABC transporter, permease protein
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0752: Predicted ABC transporter, permease protein
 
Streptococcus mitis B6

Gene: smi_0841: Predicted ABC transporter, permease protein
 
Streptococcus mutans UA159

Gene: SMU.864: Predicted ABC transporter, permease protein
 
Streptococcus pneumoniae TIGR4

Gene: SP_0787: Predicted ABC transporter, permease protein
 
Streptococcus pyogenes M1 GAS

Gene: SPy0838: Predicted ABC transporter, permease protein
 
Streptococcus sanguinis SK36

Gene: SSA_1530: Predicted ABC transporter, permease protein
 2
Streptococcus suis 05ZYH33

Gene: SSU05_0517: Predicted ABC transporter, permease protein

Gene: SSU05_0516: Predicted ABC transporter, permease protein
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB0738: Predicted ABC transporter, permease protein
Predicted ABC transporter, permease protein
 
CRON 3.
SAG0279
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
*
Streptococcus agalactiae 2603V/R

Site:
position = -56
score = 5.27941
sequence = TTGTATATATAAAATAATACAA

Gene: SAG0279: hypothetical protein
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -39
score = 5.07544
sequence = TTGTATTAGCGTAAAAGTACAA

Gene: SDEG_1734: hypothetical protein
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -39
score = 4.51397
sequence = TTGTATTAGCGTAAACGTACAA

Gene: Sez_1597: hypothetical protein
*
Streptococcus gallolyticus UCN34

Site:
position = -43
score = 5.68893
sequence = TTGTGTTACTTTAATAGTACAA

Gene: GALLO_0401: hypothetical protein
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
*
Streptococcus pyogenes M1 GAS

Site:
position = -39
score = 5.07544
sequence = TTGTATTAGCGTAAAAGTACAA

Gene: SPy1675: hypothetical protein
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
*
Streptococcus uberis 0140J

Site:
position = -34
score = 5.65198
sequence = TTGTATTAGATTAAAAGTACAA

Gene: SUB1426: hypothetical protein
hypothetical protein
SAG0280
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R

Gene: SAG0280: ABC-type multidrug transport system, ATPase component
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1733: ABC-type multidrug transport system, ATPase component
 2
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1596: ABC-type multidrug transport system, ATPase component

Gene: Sez_1595: ABC-type multidrug transport system, ATPase component
 
Streptococcus gallolyticus UCN34

Gene: GALLO_0402: ABC-type multidrug transport system, ATPase component
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -42
score = 4.12907
sequence = ATATATAATAAATATATTATAA

Gene: SGO_0798: ABC-type multidrug transport system, ATPase component
 
Streptococcus mitis B6

Gene: smi_0751: ABC-type multidrug transport system, ATPase component
*
Streptococcus mutans UA159

Site:
position = -46
score = 5.36643
sequence = TTGTATGATTTCAGTAGTATAA

Gene: SMU.1041: ABC-type multidrug transport system, ATPase component
*
Streptococcus pneumoniae TIGR4

Site:
position = -57
score = 4.33534
sequence = TTGTATCAAAGTGCTAGTATAG

Gene: SP_1381: ABC-type multidrug transport system, ATPase component
 
Streptococcus pyogenes M1 GAS

Gene: SPy1674: ABC-type multidrug transport system, ATPase component
 
Streptococcus sanguinis SK36

Gene: SSA_1026: ABC-type multidrug transport system, ATPase component
*
Streptococcus suis 05ZYH33

Site:
position = -124
score = 5.00488
sequence = TTGTACTAATTCAGCAGTATAA

Gene: SSU05_0748: ABC-type multidrug transport system, ATPase component
 
Streptococcus thermophilus CNRZ1066

Gene: str1713: ABC-type multidrug transport system, ATPase component
 
Streptococcus uberis 0140J

Gene: SUB1425: ABC-type multidrug transport system, ATPase component
ABC-type multidrug transport system, ATPase component
SAG0281
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_0981: ABC transporter permease protein
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R

Gene: SAG0281: ABC transporter permease protein
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1732: ABC transporter permease protein
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1594: ABC transporter permease protein
 
Streptococcus gallolyticus UCN34

Gene: GALLO_0403: ABC transporter permease protein
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0799: ABC transporter permease protein
 
Streptococcus mitis B6

Gene: smi_0752: ABC transporter permease protein
 
Streptococcus mutans UA159

Gene: SMU.1042: ABC transporter permease protein
 
Streptococcus pneumoniae TIGR4

Gene: SP_1380: ABC transporter permease protein
 
Streptococcus pyogenes M1 GAS

Gene: SPy1673: ABC transporter permease protein
 
Streptococcus sanguinis SK36

Gene: SSA_1027: ABC transporter permease protein
 
Streptococcus suis 05ZYH33

Gene: SSU05_0747: ABC transporter permease protein
 
Streptococcus thermophilus CNRZ1066

Gene: str1712: ABC transporter permease protein
 
Streptococcus uberis 0140J

Gene: SUB1424: ABC transporter permease protein
ABC transporter permease protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD