Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog YjdR - Streptococcaceae

Properties
Regulator type: Transcription factor
Regulator family: MarR
Regulation mode:
Biological process: Multidrug resistance
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 21 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactococcus lactis subsp. cremoris SK11
Lactococcus lactis subsp. lactis Il1403
Streptococcus agalactiae 2603V/R 3 2
Streptococcus dysgalactiae subsp. equisimilis GGS_124 3 1
Streptococcus equi subsp. zooepidemicus MGCS10565 1 1
Streptococcus gallolyticus UCN34 3 1
Streptococcus gordonii str. Challis substr. CH1 3 1
Streptococcus mitis B6 3 1
Streptococcus mutans UA159 3 1
Streptococcus pneumoniae TIGR4 3 1
Streptococcus pyogenes M1 GAS 3 1
Streptococcus sanguinis SK36 3 1
Streptococcus suis 05ZYH33 4 1
Streptococcus thermophilus CNRZ1066 3 1
Streptococcus uberis 0140J 5 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
yjdR
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
*
Streptococcus agalactiae 2603V/R

Site:
position = -35
score = 6.38723
sequence = ATAGTTCTCACGGTAACTAT

Gene: SAG1332: Predicted multidrug resistance transcriptional regulator, MarR family
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -55
score = 6.37238
sequence = ATAGTTATCCAGAGAACTAA

Gene: SDEG_1978: Predicted multidrug resistance transcriptional regulator, MarR family
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -52
score = 6.26046
sequence = ATAGTTCCCAAGAGAACTAA

Site:
position = -31
score = 6.07592
sequence = ATGGTTATCATGAGAACTAA

Gene: Sez_0219: Predicted multidrug resistance transcriptional regulator, MarR family
*
Streptococcus gallolyticus UCN34

Site:
position = -71
score = 6.68152
sequence = ATAGTTCTCATAAGAACTAT

Gene: GALLO_1290: Predicted multidrug resistance transcriptional regulator, MarR family
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -37
score = 5.90313
sequence = TTTGTTCTCAAGAGAACTAA

Site:
position = -57
score = 6.13512
sequence = ATAGTTCTCACGGTAACTTA

Gene: SGO_1752: Predicted multidrug resistance transcriptional regulator, MarR family
*
Streptococcus mitis B6

Site:
position = -117
score = 5.96433
sequence = ATAGTTCTCTAGGAAACTTT

Site:
position = -66
score = 6.2145
sequence = ATAGTTCTCATGGAAACTTA

Gene: smi_1836: Predicted multidrug resistance transcriptional regulator, MarR family
*
Streptococcus mutans UA159

Site:
position = -52
score = 6.53336
sequence = ATAGTTTTCATGAGAACTAT

Gene: SMU.921: Predicted multidrug resistance transcriptional regulator, MarR family
*
Streptococcus pneumoniae TIGR4

Site:
position = -42
score = 5.89221
sequence = ATTATTCTCCAGAGAACTAT

Gene: SP_1920: Predicted multidrug resistance transcriptional regulator, MarR family
*
Streptococcus pyogenes M1 GAS

Site:
position = -282
score = 6.37238
sequence = ATAGTTATCTAGAGAACTAA

Gene: SPy0228: Predicted multidrug resistance transcriptional regulator, MarR family
*
Streptococcus sanguinis SK36

Site:
position = -89
score = 6.2145
sequence = ATAGTTCTCATGGAAACTTT

Site:
position = -39
score = 6.56276
sequence = ATAGTTCTCACGAAAACTAT

Gene: SSA_0460: Predicted multidrug resistance transcriptional regulator, MarR family
*
Streptococcus suis 05ZYH33

Site:
position = -40
score = 5.90529
sequence = ATAGTTCTCATGGTAATTAT

Site:
position = -61
score = 6.56967
sequence = ATAGTTCTTAAGAGAACTAT

Gene: SSU05_2039: Predicted multidrug resistance transcriptional regulator, MarR family
*
Streptococcus thermophilus CNRZ1066

Site:
position = -58
score = 6.42941
sequence = ATAGTTCTTATAAGAACTAA

Gene: str0432: Predicted multidrug resistance transcriptional regulator, MarR family
*
Streptococcus uberis 0140J

Site:
position = -51
score = 6.46661
sequence = ATAGTTCTCTTAAGAACTAA

Site:
position = -30
score = 5.90734
sequence = ATGGTTTTCACGAGAACTAA

Gene: SUB1690: Predicted multidrug resistance transcriptional regulator, MarR family
Predicted multidrug resistance transcriptional regulator, MarR family
ydaG
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_0346: Predicted ABC multidrug transporter, ATP-binding and permease protein
 
Lactococcus lactis subsp. lactis Il1403

Gene: L109162: Predicted ABC multidrug transporter, ATP-binding and permease protein
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1977: Predicted ABC multidrug transporter, ATP-binding and permease protein
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_0220: Predicted ABC multidrug transporter, ATP-binding and permease protein
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0165: Predicted ABC multidrug transporter, ATP-binding and permease protein
 
Streptococcus mitis B6

Gene: smi_0153: Predicted ABC multidrug transporter, ATP-binding and permease protein
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_2075: Predicted ABC multidrug transporter, ATP-binding and permease protein
 
Streptococcus pyogenes M1 GAS

Gene: SPy0229: Predicted ABC multidrug transporter, ATP-binding and permease protein
 
Streptococcus sanguinis SK36

Gene: SSA_2167: Predicted ABC multidrug transporter, ATP-binding and permease protein
 
Streptococcus suis 05ZYH33

Gene: SSU05_2038: Predicted ABC multidrug transporter, ATP-binding and permease protein
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB1689: Predicted ABC multidrug transporter, ATP-binding and permease protein
Predicted ABC multidrug transporter, ATP-binding and permease protein
ydbA
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_0347: Predicted ABC multidrug transporter, ATP-binding and permease protein
 
Lactococcus lactis subsp. lactis Il1403

Gene: L110899: Predicted ABC multidrug transporter, ATP-binding and permease protein
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1976: Predicted ABC multidrug transporter, ATP-binding and permease protein
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_0221: Predicted ABC multidrug transporter, ATP-binding and permease protein
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0166: Predicted ABC multidrug transporter, ATP-binding and permease protein
 
Streptococcus mitis B6

Gene: smi_0154: Predicted ABC multidrug transporter, ATP-binding and permease protein
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_2073: Predicted ABC multidrug transporter, ATP-binding and permease protein
 
Streptococcus pyogenes M1 GAS

Gene: SPy0230: Predicted ABC multidrug transporter, ATP-binding and permease protein
 
Streptococcus sanguinis SK36

Gene: SSA_2166: Predicted ABC multidrug transporter, ATP-binding and permease protein
 2
Streptococcus suis 05ZYH33

Gene: SSU05_2036: Predicted ABC multidrug transporter, ATP-binding and permease protein

Gene: SSU05_2037: Predicted ABC multidrug transporter, ATP-binding and permease protein
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB1688: Predicted ABC multidrug transporter, ATP-binding and permease protein
Predicted ABC multidrug transporter, ATP-binding and permease protein
yfiB
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1289: Predicted ABC multidrug transporter, ATP-binding and permease protein
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1751: Predicted ABC multidrug transporter, ATP-binding and permease protein
 
Streptococcus mitis B6

Gene: smi_1835: Predicted ABC multidrug transporter, ATP-binding and permease protein
 
Streptococcus mutans UA159

Gene: SMU.922: Predicted ABC multidrug transporter, ATP-binding and permease protein
 
Streptococcus pneumoniae TIGR4

Gene: SP_1919: Predicted ABC multidrug transporter, ATP-binding and permease protein
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36

Gene: SSA_0461: Predicted ABC multidrug transporter, ATP-binding and permease protein
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066

Gene: str0433: Predicted ABC multidrug transporter, ATP-binding and permease protein
 
Streptococcus uberis 0140J
Predicted ABC multidrug transporter, ATP-binding and permease protein
yfiC
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1288: Predicted ABC multidrug transporter, ATP-binding and permease protein
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1750: Predicted ABC multidrug transporter, ATP-binding and permease protein
 
Streptococcus mitis B6

Gene: smi_1834: Predicted ABC multidrug transporter, ATP-binding and permease protein
 
Streptococcus mutans UA159

Gene: SMU.923: Predicted ABC multidrug transporter, ATP-binding and permease protein
 
Streptococcus pneumoniae TIGR4

Gene: SP_1918: Predicted ABC multidrug transporter, ATP-binding and permease protein
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36

Gene: SSA_0462: Predicted ABC multidrug transporter, ATP-binding and permease protein
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066

Gene: str0434: Predicted ABC multidrug transporter, ATP-binding and permease protein
 
Streptococcus uberis 0140J
Predicted ABC multidrug transporter, ATP-binding and permease protein
 
CRON 2.
yjdE
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_1383: Predicted drug resistance transporter, EmrB/QacA family
 
Lactococcus lactis subsp. lactis Il1403

Gene: L132251: Predicted drug resistance transporter, EmrB/QacA family
*
Streptococcus agalactiae 2603V/R

Site:
position = -144
score = 6.56276
sequence = ATAGTTCTCACGATAACTAA

Gene: SAG1707: Predicted drug resistance transporter, EmrB/QacA family
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1345: Predicted drug resistance transporter, EmrB/QacA family
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
*
Streptococcus uberis 0140J

Site:
position = -87
score = 6.04976
sequence = ATAGTTCTCAGGGTAACTAT

Gene: SUB1642: Predicted drug resistance transporter, EmrB/QacA family
Predicted drug resistance transporter, EmrB/QacA family
yjdF
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_1382: Conserved hypothetical protein
 
Lactococcus lactis subsp. lactis Il1403

Gene: L133825: Conserved hypothetical protein
 
Streptococcus agalactiae 2603V/R

Gene: SAG1706: Conserved hypothetical protein
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB1643: Conserved hypothetical protein
Conserved hypothetical protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD