Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PflR - Streptococcaceae

Properties
Regulator type: Transcription factor
Regulator family: DeoR
Regulation mode: repressor
Biological process: Formate metabolism
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 28 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactococcus lactis subsp. cremoris SK11
Lactococcus lactis subsp. lactis Il1403
Streptococcus agalactiae 2603V/R 3 2
Streptococcus dysgalactiae subsp. equisimilis GGS_124 6 3
Streptococcus equi subsp. zooepidemicus MGCS10565 6 3
Streptococcus gallolyticus UCN34
Streptococcus gordonii str. Challis substr. CH1 6 3
Streptococcus mitis B6
Streptococcus mutans UA159 5 3
Streptococcus pneumoniae TIGR4 6 3
Streptococcus pyogenes M1 GAS 6 3
Streptococcus sanguinis SK36 6 3
Streptococcus suis 05ZYH33 4 2
Streptococcus thermophilus CNRZ1066
Streptococcus uberis 0140J 5 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
pflR
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
*
Streptococcus agalactiae 2603V/R

Site:
position = -82
score = 5.74597
sequence = ACGTAACAAAGTCAATTACGA

Gene: SAG0326: Pyruvate-formate lyase operon transcriptional regulator, DeoR family
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -80
score = 6.07916
sequence = ACGTAAATAAATCAATTACGA

Gene: SDEG_0170: Pyruvate-formate lyase operon transcriptional regulator, DeoR family
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -83
score = 6.07916
sequence = ACGTAAATAAATCAATTACGA

Gene: Sez_1814: Pyruvate-formate lyase operon transcriptional regulator, DeoR family
 
Streptococcus gallolyticus UCN34
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -79
score = 5.77661
sequence = ACGCAATAAATACAATTACGA

Gene: SGO_1793: Pyruvate-formate lyase operon transcriptional regulator, DeoR family
 
Streptococcus mitis B6
*
Streptococcus mutans UA159

Site:
position = -85
score = 6.02288
sequence = ACGAAACAAAATCAATTACGA

Gene: SMU.491: Pyruvate-formate lyase operon transcriptional regulator, DeoR family
*
Streptococcus pneumoniae TIGR4

Site:
position = -82
score = 5.89671
sequence = ACGAAAGAAAAACAATTACGA

Gene: SP_0246: Pyruvate-formate lyase operon transcriptional regulator, DeoR family
*
Streptococcus pyogenes M1 GAS

Site:
position = -83
score = 6.07916
sequence = ACGTAAATAAATCAATTACGA

Gene: SPy2054: Pyruvate-formate lyase operon transcriptional regulator, DeoR family
*
Streptococcus sanguinis SK36

Site:
position = -85
score = 5.63726
sequence = TAGAAAGAAAAACAATTACGA

Gene: SSA_0278: Pyruvate-formate lyase operon transcriptional regulator, DeoR family
*
Streptococcus suis 05ZYH33

Site:
position = -91
score = 4.94841
sequence = AAGAAAGTTTTACAATTACGA

Gene: SSU05_0706: Pyruvate-formate lyase operon transcriptional regulator, DeoR family
 
Streptococcus thermophilus CNRZ1066
*
Streptococcus uberis 0140J

Site:
position = -86
score = 6.04378
sequence = ACGTAAATAAATCAATTACGT

Gene: SUB0157: Pyruvate-formate lyase operon transcriptional regulator, DeoR family
Pyruvate-formate lyase operon transcriptional regulator, DeoR family
SPy2053
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R

Gene: SAG0327: Predicted transcriptional regulator, DeoR family
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_0171: Predicted transcriptional regulator, DeoR family
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1813: Predicted transcriptional regulator, DeoR family
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1792: Predicted transcriptional regulator, DeoR family
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_0247: Predicted transcriptional regulator, DeoR family
 
Streptococcus pyogenes M1 GAS

Gene: SPy2053: Predicted transcriptional regulator, DeoR family
 
Streptococcus sanguinis SK36

Gene: SSA_0279: Predicted transcriptional regulator, DeoR family
 2
Streptococcus suis 05ZYH33

Gene: SSU05_0708: Predicted transcriptional regulator, DeoR family

Gene: SSU05_0707: Predicted transcriptional regulator, DeoR family
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB0158: Predicted transcriptional regulator, DeoR family
Predicted transcriptional regulator, DeoR family
 
CRON 2.
pflA
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
*
Streptococcus agalactiae 2603V/R

Site:
position = -59
score = 4.78358
sequence = TCGTAATTGACTTTGTTACGT

Gene: SAG0325: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -63
score = 5.75563
sequence = TCGTAATTGATTTATTTACGT

Gene: SDEG_0169: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = 34
score = 5.75563
sequence = TCGTAATTGATTTATTTACGT

Gene: Sez_1815: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
 
Streptococcus gallolyticus UCN34
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -60
score = 5.24234
sequence = TCGTAATTGTATTTATTGCGT

Gene: SGO_1794: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
 
Streptococcus mitis B6
*
Streptococcus mutans UA159

Site:
position = -66
score = 5.08642
sequence = TCGTAATTGATTTTGTTTCGT

Gene: SMU.490: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
*
Streptococcus pneumoniae TIGR4

Site:
position = -60
score = 5.1872
sequence = TCGTAATTGTTTTTCTTTCGT

Gene: SP_0245: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
*
Streptococcus pyogenes M1 GAS

Site:
position = -63
score = 5.75563
sequence = TCGTAATTGATTTATTTACGT

Gene: SPy2055: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
*
Streptococcus sanguinis SK36

Site:
position = -33
score = 4.93144
sequence = TCGTAATTGTTTTTCTTTCTA

Gene: SSA_0277: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
*
Streptococcus suis 05ZYH33

Site:
position = -61
score = 4.95488
sequence = TCGTAATTGTAAAACTTTCTT

Gene: SSU05_0705: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
 
Streptococcus thermophilus CNRZ1066
*
Streptococcus uberis 0140J

Site:
position = -61
score = 5.86501
sequence = ACGTAATTGATTTATTTACGT

Gene: SUB0156: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
 
CRON 3.
pflB
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R

Gene: SAG0331: Pyruvate formate-lyase (EC 2.3.1.54)
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -41
score = 4.87226
sequence = AAGAAACATTTATAATTTCGT

Gene: SDEG_0175: Pyruvate formate-lyase (EC 2.3.1.54)
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -42
score = 5.08444
sequence = AAGAAAGTTATTTAATTTCGT

Gene: Sez_1808: Pyruvate formate-lyase (EC 2.3.1.54)
 
Streptococcus gallolyticus UCN34
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -39
score = 5.56167
sequence = AAGAAATAAAAATAATTTCAT

Gene: SGO_1788: Pyruvate formate-lyase (EC 2.3.1.54)
 
Streptococcus mitis B6
*
Streptococcus mutans UA159

Site:
position = -41
score = 5.10945
sequence = AAGAAATTTAATATATTACGA

Gene: SMU.493: Pyruvate formate-lyase (EC 2.3.1.54)
*
Streptococcus pneumoniae TIGR4

Site:
position = -37
score = 5.73189
sequence = AAGAAATAAAAATATTTTCGA

Gene: SP_0251: Pyruvate formate-lyase (EC 2.3.1.54)
*
Streptococcus pyogenes M1 GAS

Site:
position = -41
score = 4.4107
sequence = AAGAAACGTTTATAATTTCGT

Gene: SPy2049: Pyruvate formate-lyase (EC 2.3.1.54)
*
Streptococcus sanguinis SK36

Site:
position = -39
score = 5.33629
sequence = AAGAAATAAATTAAATTTCAT

Gene: SSA_0285: Pyruvate formate-lyase (EC 2.3.1.54)
 
Streptococcus suis 05ZYH33

Gene: SSU05_0714: Pyruvate formate-lyase (EC 2.3.1.54)
 
Streptococcus thermophilus CNRZ1066
*
Streptococcus uberis 0140J

Site:
position = -42
score = 5.27283
sequence = AAGAAACAAAAATGTTTACGA

Gene: SUB0160: Pyruvate formate-lyase (EC 2.3.1.54)
Pyruvate formate-lyase (EC 2.3.1.54)
tal
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R

Gene: SAG0332: transaldolase family protein
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_0176: transaldolase family protein
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1807: transaldolase family protein
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1787: transaldolase family protein
 
Streptococcus mitis B6
 
Streptococcus mutans UA159

Gene: SMU.494: transaldolase family protein
 
Streptococcus pneumoniae TIGR4

Gene: SP_0252: transaldolase family protein
 
Streptococcus pyogenes M1 GAS

Gene: SPy2048: transaldolase family protein
 
Streptococcus sanguinis SK36

Gene: SSA_0286: transaldolase family protein
 
Streptococcus suis 05ZYH33

Gene: SSU05_0715: transaldolase family protein
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB0161: transaldolase family protein
transaldolase family protein
gldA
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R

Gene: SAG0333: Glycerol dehydrogenase (EC 1.1.1.6)
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_0177: Glycerol dehydrogenase (EC 1.1.1.6)
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1806: Glycerol dehydrogenase (EC 1.1.1.6)
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1786: Glycerol dehydrogenase (EC 1.1.1.6)
 
Streptococcus mitis B6
 
Streptococcus mutans UA159

Gene: SMU.495: Glycerol dehydrogenase (EC 1.1.1.6)
 
Streptococcus pneumoniae TIGR4

Gene: SP_0253: Glycerol dehydrogenase (EC 1.1.1.6)
 
Streptococcus pyogenes M1 GAS

Gene: SPy2047: Glycerol dehydrogenase (EC 1.1.1.6)
 
Streptococcus sanguinis SK36

Gene: SSA_0287: Glycerol dehydrogenase (EC 1.1.1.6)
 2
Streptococcus suis 05ZYH33

Gene: SSU05_0716: Glycerol dehydrogenase (EC 1.1.1.6)

Gene: SSU05_0717: Glycerol dehydrogenase (EC 1.1.1.6)
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Glycerol dehydrogenase (EC 1.1.1.6)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD