Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NagR - Streptococcaceae

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: N-acetylglucosamine utilization
Effector: N-acetylglucosamine-6-phosphate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 66 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactococcus lactis subsp. cremoris SK11 3 3
Lactococcus lactis subsp. lactis Il1403 3 3
Streptococcus agalactiae 2603V/R 3 3
Streptococcus dysgalactiae subsp. equisimilis GGS_124 3 3
Streptococcus equi subsp. zooepidemicus MGCS10565 3 3
Streptococcus gallolyticus UCN34 3 3
Streptococcus gordonii str. Challis substr. CH1 3 3
Streptococcus mitis B6 3 3
Streptococcus mutans UA159 3 3
Streptococcus pneumoniae TIGR4 3 3
Streptococcus pyogenes M1 GAS 3 3
Streptococcus sanguinis SK36 3 3
Streptococcus suis 05ZYH33 2 2
Streptococcus thermophilus CNRZ1066 2 2
Streptococcus uberis 0140J 3 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
glmS
*
Lactococcus lactis subsp. cremoris SK11

Site:
position = -47
score = 5.0068
sequence = ATAATTAAATATACCAATTT

Gene: LACR_1094: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
*
Lactococcus lactis subsp. lactis Il1403

Site:
position = -47
score = 4.99979
sequence = ATAATTAACTATACCAATTT

Site:
position = -155
score = 5.2139
sequence = AAAATAAATTATACCAATTA

Gene: L33556: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
*
Streptococcus agalactiae 2603V/R

Site:
position = -75
score = 5.22005
sequence = ATATTAATATATACCAATTC

Site:
position = -153
score = 5.43989
sequence = CAAAAAGACTATACCAATTT

Gene: SAG0944: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -146
score = 5.44627
sequence = CGATTAGACTATACCAATTT

Site:
position = -68
score = 5.10912
sequence = TCTAAGGACTATACCAATTA

Gene: SDEG_1092: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -148
score = 5.74737
sequence = AAATATGACTATACCAATTT

Site:
position = -69
score = 5.27519
sequence = ATATCTGACTATACCAATTA

Gene: Sez_0884: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
*
Streptococcus gallolyticus UCN34

Site:
position = -157
score = 5.13604
sequence = TAATTGGTATATACAAAACT

Site:
position = -69
score = 5.76225
sequence = TTATTAGACTATACCAATTT

Gene: GALLO_0992: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -65
score = 5.7955
sequence = AAATCAGACTATACCAATTT

Gene: SGO_1757: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
*
Streptococcus mitis B6

Site:
position = -136
score = 5.76663
sequence = AATTTGAACTATACCAATTT

Site:
position = -96
score = 4.85586
sequence = AAACAAGTATATACTGTTTT

Site:
position = -57
score = 5.89228
sequence = GAATTAGACTATACCAATTT

Gene: smi_1850: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
*
Streptococcus mutans UA159

Site:
position = -148
score = 5.43989
sequence = CAAAAAGACTATACCAATTT

Site:
position = -71
score = 5.84116
sequence = TTATTAGACTATACCAATTA

Gene: SMU.1187: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
*
Streptococcus pneumoniae TIGR4

Site:
position = -57
score = 5.89228
sequence = GAATTAGACTATACCAATTT

Site:
position = -96
score = 4.85586
sequence = AAACAAGTATATACTGTTTT

Site:
position = -136
score = 5.76663
sequence = AATTTGAACTATACCAATTT

Gene: SP_0266: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
*
Streptococcus pyogenes M1 GAS

Site:
position = -150
score = 6.10243
sequence = TAATTAGACTATACCAATTT

Site:
position = -72
score = 6.18133
sequence = TAATTAGACTATACCAATTA

Gene: SPy1280: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
*
Streptococcus sanguinis SK36

Site:
position = -147
score = 5.25199
sequence = AAAGAAAACTATACCAATTT

Site:
position = -69
score = 4.96844
sequence = CAAGTATACTATACCAATTT

Gene: SSA_2107: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
*
Streptococcus suis 05ZYH33

Site:
position = -57
score = 5.88066
sequence = AAATTAGACTAGACCAATTT

Site:
position = -135
score = 5.95957
sequence = AAATTAGACTAGACCAATTA

Gene: SSU05_0549: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
*
Streptococcus thermophilus CNRZ1066

Site:
position = -107
score = 4.41029
sequence = TATATGGAATATACTGTCTT

Site:
position = -68
score = 4.83631
sequence = CTTATTGACTATACCAATTT

Gene: str0873: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
*
Streptococcus uberis 0140J

Site:
position = -67
score = 5.50321
sequence = TTATTTGACTATACCAATTT

Site:
position = -145
score = 5.8462
sequence = AAATTAGACTATACCAATAA

Gene: SUB0998: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
 
CRON 2.
nagA
*
Lactococcus lactis subsp. cremoris SK11

Site:
position = -74
score = 5.61182
sequence = TAATTGGTATATACTGTTTA

Gene: LACR_1458: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
*
Lactococcus lactis subsp. lactis Il1403

Site:
position = -74
score = 5.61182
sequence = TAATTGGTATATACTGTTTA

Gene: L173068: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
*
Streptococcus agalactiae 2603V/R

Site:
position = -67
score = 6.42699
sequence = AAATAGGTATATACCATTTA

Gene: SAG0266: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -67
score = 6.16029
sequence = TAAGTGGTATATACCATTTA

Gene: SDEG_1751: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -68
score = 5.4421
sequence = GGACTGGTATATACCATTTA

Gene: Sez_0477: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
*
Streptococcus gallolyticus UCN34

Site:
position = -69
score = 6.42262
sequence = AATTTGGTATATACCATTTA

Gene: GALLO_0390: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -118
score = 6.41998
sequence = AAATAGGTCTATACCATTTA

Gene: SGO_0549: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
*
Streptococcus mitis B6

Site:
position = -95
score = 6.41998
sequence = AAATAGGTCTATACCATTTA

Gene: smi_0202: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
*
Streptococcus mutans UA159

Site:
position = -43
score = 6.42262
sequence = AATTTGGTATATACCATTTA

Gene: SMU.435: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
*
Streptococcus pneumoniae TIGR4

Site:
position = -95
score = 6.41998
sequence = AAATAGGTCTATACCATTTA

Gene: SP_2056: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
*
Streptococcus pyogenes M1 GAS

Site:
position = -68
score = 6.28262
sequence = AAAGTGGTATATACCATTTA

Gene: SPy1694: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
*
Streptococcus sanguinis SK36

Site:
position = -174
score = 6.42699
sequence = AAATAGGTATATACCATTTA

Gene: SSA_1893: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Streptococcus suis 05ZYH33

Gene: SSU05_1259: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Streptococcus thermophilus CNRZ1066

Gene: str0501: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
*
Streptococcus uberis 0140J

Site:
position = -67
score = 6.22058
sequence = AAACTGGTATATACCATTTA

Gene: SUB1443: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
CRON 3.
nagB
*
Lactococcus lactis subsp. cremoris SK11

Site:
position = -39
score = 6.1395
sequence = AAATTGATATATACCAATTT

Gene: LACR_1667: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Lactococcus lactis subsp. lactis Il1403

Site:
position = -38
score = 6.1395
sequence = AAATTGATATATACCAATTT

Gene: L14408: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Streptococcus agalactiae 2603V/R

Site:
position = -34
score = 5.66738
sequence = ATAAAGGTCTATACCAAATA

Site:
position = -62
score = 6.50219
sequence = AAATTGGTATATACCATATA

Gene: SAG0799: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -64
score = 6.50219
sequence = AAATTGGTATATACCATATA

Site:
position = -35
score = 5.57092
sequence = TAAAAGGTCTATACCAATAA

Gene: SDEG_1443: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -63
score = 6.37986
sequence = TAATTGGTATATACCATATA

Site:
position = -34
score = 5.25338
sequence = CAAAAGGTCTATACCAATCA

Gene: Sez_0658: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Streptococcus gallolyticus UCN34

Site:
position = -43
score = 4.79721
sequence = TAAGAGGTCTATACCAAAAC

Site:
position = -74
score = 6.50219
sequence = AAATTGGTATATACCATATA

Gene: GALLO_0666: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -52
score = 6.49517
sequence = AAATTGGTCTATACCATATA

Gene: SGO_1586: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Streptococcus mitis B6

Site:
position = -51
score = 6.49517
sequence = AAATTGGTCTATACCATATA

Gene: smi_0714: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Streptococcus mutans UA159

Site:
position = -30
score = 4.72431
sequence = CTATTTGTATAGACCGATTA

Site:
position = -50
score = 6.04144
sequence = AAATTGGTCTATACCTTATA

Gene: SMU.636: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Streptococcus pneumoniae TIGR4

Site:
position = -51
score = 6.49517
sequence = AAATTGGTCTATACCATATA

Gene: SP_1415: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Streptococcus pyogenes M1 GAS

Site:
position = -35
score = 5.37222
sequence = CGAAAGGTCTATACCAATTA

Site:
position = -64
score = 6.50219
sequence = AAATTGGTATATACCATATA

Gene: SPy1399: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Streptococcus sanguinis SK36

Site:
position = -51
score = 6.49517
sequence = AAATTGGTCTATACCATATA

Gene: SSA_0746: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Streptococcus suis 05ZYH33

Site:
position = -28
score = 5.32398
sequence = AAAATGGTATAGACCAAAGA

Site:
position = -60
score = 6.49517
sequence = AAATTGGTCTATACCATATA

Gene: SSU05_0634: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Streptococcus thermophilus CNRZ1066

Site:
position = 42
score = 5.8397
sequence = AAAATGGTATATACCAATAT

Gene: str0541: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Streptococcus uberis 0140J

Site:
position = -31
score = 5.57092
sequence = TAAAAGGTCTATACCAATAA

Site:
position = -60
score = 6.50219
sequence = AAATTGGTATATACCATATA

Gene: SUB1239: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD