Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NrtR - Streptococcaceae

Properties
Regulator type: Transcription factor
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactococcus lactis subsp. cremoris SK11
Lactococcus lactis subsp. lactis Il1403
Streptococcus agalactiae 2603V/R
Streptococcus dysgalactiae subsp. equisimilis GGS_124
Streptococcus equi subsp. zooepidemicus MGCS10565
Streptococcus gallolyticus UCN34
Streptococcus gordonii str. Challis substr. CH1 3 1
Streptococcus mitis B6 3 1
Streptococcus mutans UA159
Streptococcus pneumoniae TIGR4
Streptococcus pyogenes M1 GAS
Streptococcus sanguinis SK36 3 1
Streptococcus suis 05ZYH33 4 1
Streptococcus thermophilus CNRZ1066 2 1
Streptococcus uberis 0140J
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
nadR
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -121
score = 4.6622
sequence = ATATTTGAGTTTAAAAATATT

Site:
position = -60
score = 7.20481
sequence = ATAGTTTATAATAAAAACATA

Gene: SGO_1997: Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22)
*
Streptococcus mitis B6

Site:
position = -47
score = 6.9006
sequence = ATAGTTTATAATAAAAATATC

Site:
position = -84
score = 4.9128
sequence = ATAAAAAATAATAAAAACCTA

Gene: smi_2044: Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22)
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
*
Streptococcus sanguinis SK36

Site:
position = -61
score = 7.08926
sequence = ATAGTTTATAATAAAATCATA

Gene: SSA_2195: Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22)
*2
Streptococcus suis 05ZYH33

Site:
position = -90
score = 4.60859
sequence = ATCTTTTTATAAAAAAATATA

Gene: SSU05_1974: Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22)

Gene: SSU05_1973: Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22)
*
Streptococcus thermophilus CNRZ1066

Site:
position = -26
score = 5.84173
sequence = TTACTATATTTAAAAAGGATA

Gene: str0429: Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22)
 
Streptococcus uberis 0140J
Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22)
pnuC
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1996: Ribosyl nicotinamide transporter, PnuC-like
 
Streptococcus mitis B6

Gene: smi_2043: Ribosyl nicotinamide transporter, PnuC-like
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36

Gene: SSA_2194: Ribosyl nicotinamide transporter, PnuC-like
 
Streptococcus suis 05ZYH33

Gene: SSU05_1972: Ribosyl nicotinamide transporter, PnuC-like
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Ribosyl nicotinamide transporter, PnuC-like
nrtR
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1995: NAD biosynthesis transcriptional regulator NrtR, NrtR family
 
Streptococcus mitis B6

Gene: smi_2042: NAD biosynthesis transcriptional regulator NrtR, NrtR family
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36

Gene: SSA_2193: NAD biosynthesis transcriptional regulator NrtR, NrtR family
 
Streptococcus suis 05ZYH33

Gene: SSU05_1971: NAD biosynthesis transcriptional regulator NrtR, NrtR family
 
Streptococcus thermophilus CNRZ1066

Gene: str0428: NAD biosynthesis transcriptional regulator NrtR, NrtR family
 
Streptococcus uberis 0140J
NAD biosynthesis transcriptional regulator NrtR, NrtR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD